Test on-line:

The programs usage in Scientific publications 3D-Match
Bacterial Genome Explorer
BESTORF
BestPal
BPROM
CpGFinder
CTL epitope-Finder
CYS_REC
EST_map
Fex
FGENES
FGENES-M
FGENESB
FGENESH 2016
FGENESH 2015
FGENESH 2014
FGENESH 2013
FGENESH 2012
FGENESH 2011
FGENESH 2010
FGENESH 2009
FGENESH 2008
FGENESH 2007
FGENESH 2006
FGENESH 2005
FGENESH 2002-2004
FGENESH_GC
FGENESH-M
FGENESH+
FGENESH++
FGENESH-C
FGENESH-2
FGENESH++C
FGENESV, FGENESV0
FindMiRNA
FindTerm
FoldRNA
FPROM
FSPLICE
Genome Comparison Browser
Genome Explorer
GetAtoms
Human-mouse synteny
Human-mouse-rat synteny
MaliN
MaliP
MolQuest
NNSSP
NSITE
NSITE-PL
NSITEM
OligoZip
PATTERN
Pdisorder
PlantProm
POLYAH
PROMH
PROTCOMP
PROT_MAP
PSITE
PSSFinder
Rat-mouse synteny
RegSite
RNASPL
SCAN2
ScanWM-P
SPL
SPLM
SPLICEDB
SSP
SSPAL
TSSG
TSSP
TSSW
Various programs

FGENESH 2016

Insect Molecular Biology
2016 DOI: 10.1111/imb.12262

Ion transport peptide (ITP) regulates wing expansion and cuticle melanism in the brown planthopper, Nilaparvata lugens

Yu, B. et al.,
State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Science, Zhejiang University, Hangzhou, China

... The ORF regions of the detected ITP/ITPL transcripts were analysed using fgenesh (http://linux1.softberry.com/berry.phtml?topic = fgenesh&group = programs&subgroup=gfind). The 3' UTR, 5' UTR and ORF region of each N. lugens ITP/ITPL transcript were obtained. ...


BioMed Research International
2016 Article ID 7496569, 11 pages http://dx.doi.org/10.1155/2016/7496569

ChSte7 Is Required for Vegetative Growth and Various Plant Infection Processes in Colletotrichum higginsianum

Yuan, Q. et al.,
The Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan, Hubei 430070, China

... All primers used in this work were designed with primer premier 5.0 (http://www. premierbiosoft.com/primerdesign/). Open reading frames were further analyzed using the gene prediction program FGENESH (Softberry Inc., Mount Kisco, NY, USA). ...


Theoretical and Applied Genetics
2016, DOI 10.1007/s00122-016-2752-9

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit

Gao, M., Hu, L., Li, Y., Weng, Y
1. College of Life Science, Agriculture and Forestry, Qiqihar University, Qiqihar, 161006, China 2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA

... Gene annotation within this region was performed with FGENESH (http:// sunl.softberry.com/) and function prediction was conducted with BLASTx at the NCBI website (http://blast.ncbi.nlm. ...


Fungal Genetics and Biology
2016, 92, 50-64. http://dx.doi.org/10.1016/j.fgb.2016.05.002

Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii

Im, C. H. et al.,
a Environment-friendly Research Division, Gyeongsangnam-do Agricultural Research and Extension Services, Jinju, Republic of Korea b Department of Horticultural Bioscience, Pusan National University, Milyang, Republic of Korea c US Forest Products Laboratory, Madison, WI, USA

... LOD and R 2 score) was obtained using a P. eryngii genome browser (http://112.220.192.2/per/) and analyzed using the FGENESH (http://www.softberry.com/), UniProt ...


Developmental & Comparative Immunology
2016, 65, 268-279. http://dx.doi.org/10.1016/j.dci.2016.07.018

Identification of a fourth ancient member of the IL-3/IL-5/GM-CSF cytokine family, KK34, in many mammals

Yamaguchi, T., Schares, S., Fischer, U., & Dijkstra, J. M.
a Laboratory of Fish Immunology, Institute of Infectology, Friedrich-Loeffler-Institut, Sudufer 10, Greifswald-Insel Riems 17493, Germany b Institute for Comprehensive Medical Science, Fujita Health University, Dengakugakubo 1-98, Toyoake, Aichi 470-1192, Japan

... were made based on using the specialized software GENSCAN, http://genes.mit.edu/GENSCAN.html, and FGENESH, http://www.softberry.com/berry ...


New Phytologist
2016 DOI: 10.1111/nph.14110

Rye B chromosomes encode a functional Argonaute?like protein with in vitro slicer activities similar to its A chromosome paralog

Ma, W. et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben, Stadt Seeland, Germany Institute of Bioinformatics and Systems Biology/Munich Information Center for Protein Sequences, Helmholtz Center Munich, German Research Center for Environmental Health, Neuherberg, Germany National Bioinformatics Infrastructure Sweden, Department of Clinical and Experimental Medicine, Linkoping University, Linkoping, Sweden

... The gene structure with putative intronic and exonic regions was predicted by FGENESH (http://linux1.softberry.com/berry.phtml) based on the A-located ...


Fungal Genetics and Biology
2016, 87, 54-63 http://dx.doi.org/10.1016/j.fgb.2015.12.013

MAT–gene structure and mating behavior of Hymenoscyphus fraxineus and Hymenoscyphus albidus

Wey, T., Schlegel, M., Stroheker, S., Gross, A.
Forest Pathology and Dendrology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatsstrasse 16, 8092 Zurich, Switzerland

... The gene prediction tool FGENESH (http://linux1. softberry.com/berry.phtml) was used for the Botryotinia fuckeliana or Sclerotinia sclerotiorum- specific gene-finding parameters to identify genes on the additional sequence fragment. ...


Fish & Shellfish Immunology
2016, 56, 70-83. http://dx.doi.org/10.1016/j.fsi.2016.06.049

Molecular and functional characterization of Toll-like receptor (Tlr) 1 and Tlr2 in common carp (Cyprinus carpio)

Fink, I. R. et al.,
a Cell Biology and Immunology Group, Department of Animal Sciences, Wageningen University, PO Box 338, 6700 AH, Wageningen, The Netherlands b Department of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, 3584 CL, Utrecht, The Netherlands

... Exon-intron structure was studied by multiple alignments and open reading frame predictions (FGENESH at http://linux1.softberry.com/berry.phtml?topic=fgenesh&group ...


Chromosome Research
2016, 24(2), 197-216. DOI: 10.1007/s10577-015-9515-3

Highly distinct chromosomal structures in cowpea (Vigna unguiculata), as revealed by molecular cytogenetic analysis

Iwata-Otsubo, A., Lin, J. Y., Gill, N., Jackson, S. A.
Center for Applied Genetic TechnologiesUniversity of Georgia Department of BiologyUniversity of Pennsylvania

... 1998; Gordon et al. 1998). FGENESH (www.?softberry.?com/?) was used for de novo gene prediction. ...


Frontiers in plant science
2016, 7: 284. doi: 10.3389/fpls.2016.00284

Diverse evolutionary trajectories for small RNA biogenesis genes in the oomycete genus Phytophthora

Bollmann, S. R., Fang, Y., Press, C. M., Tyler, B. M., Grunwald, N. J.
1Horticultural Crop Research Unit, USDA-Agricultural Research Service, Corvallis, OR, USA 2Department of Botany and Plant Pathology and Center for Genome Biology and Biocomputing, Oregon State University, Corvallis, OR, USA

.. homologs were isolated and coding sequences were manually identified or confirmed using Genscan (Burge and Karlin, 1997) or FGENESH (linux1.softberry.com/berry ... in-frame fused with GFP by inserting into the blunt site Stu I in the plasmid pYF2-GFP (Fang and Tyler, 2016). ...


Frontiers in genetics
2016, 7: 38. doi: 10.3389/fgene.2016.00038

Microsomal omega-3 fatty acid desaturase genes in low linolenic acid soybean line RG10 and validation of major linolenic acid QTL

Reinprecht, Y., & Pauls, K. P.
Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada

... The gene structure was also analyzed with the FGenesh 2.6 (http://linux1.softberry.com; Salamov and Solovyev, 2000). ...


Front. Plant Sci
08 August 2016 7, 1140. | http://dx.doi.org/10.3389/fpls.2016.01140

Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54

Ray, S. et al.,
1National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi, India 2Chaudhary Sarwan Kumar Himachal Pradesh Agricultural University, Palampur, India

... The supercontigs obtained after assembling the sequence reads were used for gene prediction using FGENESH 8 taking Magnaporthe as reference database for gene prediction. ...


Developmental & Comparative Immunology
2016, 61, 208-224. http://dx.doi.org/10.1016/j.dci.2016.04.004

Evolution of IFN-? in tetrapod vertebrates and its functional characterization in green anole lizard (Anolis carolinensis)

Chen, S. N. et al.,
a State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China b University of the Chinese Academy of Sciences, Beijing 10049, China

... Putative transcripts were predicted from the lizard genome sequences using the FGENESH program (http://linux1.softberry.com/berry.phtml). ...


Current Biotica
9(4):306-312, 2016

Expression profiling of anthocyanin pathway genes in popular tomato cultivars of India

Aumreetam Dinabandhu and Bidya Bhushan Gupta
ICAR-National Research Center on Plant Biotechnology, Pusa Campus, New Delhi-110 012, India #Present address: Department of Biotechnology, Indian Institute of Technology, Roorkee – 247 667, Haridwar dt., Uttarakhand, India

... sequence of International Tomato Annotation Group release was used from http://solgenomics. net/ and anthocyanin genes were predicted by using BLAST- Basic Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and FGENESH (www.softberry.com) gene ...


Applied Biochemistry and Biotechnology
2016 doi:10.1007/s12010-016-2164-y

Cloning and Expression Analysis of Eight Upland Cotton Pentatricopeptide Repeat Family Genes

Han, Z. et al.,
Cotton Research Centre Shandong Academy of Agricultural Sciences; School of Biological Science and TechnologyUniversity of Jinan

... Potential genes of the retrieved bacterial artificial chromosome (BAC) sequences were predicted by a program FGENESH (http://www.softberry.com/), and the predicted proteins were used subsequently as input for BLASTP searches against the non- redundant GenBank protein ...


Functional & integrative genomics
July 2016, Volume 16, Issue 4, pp 429-439 doi:10.?1007/?s10142-016-0494-z

Structural organization of fatty acid desaturase loci in linseed lines with contrasting linolenic acid contents

Thambugala, D., Ragupathy, R., Cloutier, S.
1. Department of Plant Science, University of Manitoba, 66 Dafoe Rd, Winnipeg, MB, R3T 2N2, Canada 2. Ottawa Research and Development Centre, 960 Carling Ave, Ottawa, ON, K1A 0C6, Canada

.. Gene annotation. Gene prediction algorithm of FGENESH (http://?www.?softberry.?com/?) and the previously predicted ab initio gene sequences of the WGS sequence of CDC Bethune were further verified using FLAX GFF3 (Wang et al. ...


The Plant Journal
2016 DOI: 10.1111/tpj.13214

Rapid evolutionary dynamics in a 2.8?Mb chromosomal region containing multiple prolamin and resistance gene families in Aegilops tauschii

Dong, L. et al.,
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California Department of Plant Sciences, University of California, Davis, CA, USA

... In addition, FGENESH (http://www.softberry .com/nucleo.html), GeneMark, and GeneScan were used for gene prediction. ...


Journal of Bioscience and Bioengineering
2016 doi:10.1016/j.jbiosc.2016.05.003

Heterologous production of an acidic thermostable lipase with broad-range pH activity from thermophilic fungus Neosartorya fischeri P1

Sun, Q. et al.,
1 Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China 2 Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Bioengineering, Tianjin University of Science & Technology, Tianjin 300457, PR China

... strand of cDNA as template, the exon-intron boundaries were predicted using the online software GENSCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/berry ...


Scientific reports
2016, 6: 25107. doi: 10.1038/srep25107

Comprehensive analysis of the polygalacturonase and pectin methylesterase genes in Brassica rapa shed light on their different evolutionary patterns

Duan, W. et al.,
1State Key Laboratory of Crop Genetics and Germplasm Enhancement/Key Laboratory of Biology and Germplasm Enhancement of Horticultural Crops in East China, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China 2Center of Genomics and Computational Biology, College of Life Sciences, North China University of Science and Technology, Tangshan, Hebei 063000, China

... splicing errors, and missed or extra exons, manual reannotation was performed using the FGENESH program (http://linux1.softberry.com/berry ...


Applied and environmental microbiology
2016, 82(4), 1196-1204. doi: 10.1128/AEM.03168-15

A fivefold parallelized biosynthetic process secures chlorination of Armillaria mellea (honey mushroom) toxins

Wick, J. et al.,
aDepartment of Pharmaceutical Microbiology, Hans Knoll Institute, Friedrich-Schiller-Universitat Jena, Jena, Germany bDepartment of Biomolecular Chemistry, Leibniz Institute for Natural Product Research and Infection Biology-Hans Knoll Institute, Jena, Germany

... for 3 min. In silico sequence and phylogenetic analysis.To identify exon-intron junctions in silico, we used FGENESH (Softberry, Mount Kisco, NY) and Augustus (26) software as described previously (27). Primary sequences ...


The Plant Genome
2016 doi:10.3835/plantgenome2015.09.0084

Fine Mapping of Two Wheat Powdery Mildew Resistance Genes Located at the Pm1 Cluster

Liang, J. et al.,
a The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Centre, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China b current address, Crop Research Institute, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, Jiangsu, China

... Gene prediction was performed using the gene predictor program FGENESH (http://www.softberry.com) complemented with BLASTn search against dbEST ...


Frontiers in Plant Science
2016, 7: 967. doi: 10.3389/fpls.2016.00967

HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato

Li, J. et al.,
1Key Laboratory of Horticulture Science for Southern Mountainous Regions, Ministry of Education; College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China 2Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Wuhan, China

... Both SlHyPRP1 and SpHyPRP1 encoded 262 amino acids predicted by the FGENESH program (http://linux1.softberry.com/berry.phtml). ...


Theoretical and Applied Genetics
2016, 1-12. DOI: 10.1007/s00122-016-2740-0

The Solanum demissumR8 late blight resistance gene is an Sw-5 homologue that has been deployed worldwide in late blight resistant varieties

Vossen, J. H. et al.,
Wageningen UR Plant BreedingWageningen University and Research

... Gene structures were predicted using FGENESH 2.6(Softberry) and protein sequences were deduced by translation of ORF using the standard genetic code. ...


Plant, Cell & Environment
2016 DOI: 10.1111/pce.12779

Different cytokinin histidine kinase receptors regulate nodule initiation as well as later nodule developmental stages in Medicago truncatula

Boivin, S. et al.,

... Prediction of gene structures using FGENESH (http://linux1.softberry. com/) revealed that the MtCHK1/MtCRE1 transcript contains 11 predicted exons ...


G3: Genes| Genomes| Genetics
2016, 6(5), 1179-1189. doi: 10.1534/g3.115.026229

Sequence of the Gonium pectorale Mating Locus Reveals a Complex and Dynamic History of Changes in Volvocine Algal Mating Haplotypes

Hamaji, T. et al.,
*Donald Danforth Plant Science Center, St Louis, Missouri 63132 †Department of Biological Sciences, Graduate School of Science, University of Tokyo 113-0033, Japan ‡Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, Arizona 85721

... Gene models were generated using Fgenesh (Salamov and Solovyev 2000) (http://linux1.softberry. com/berry.phtml) with the “Chlamydomonas” option, and then manually edited based on similarity to C. reinhardtii (JGI V4 protein models: http://genome.jgi-psf.org/Chlre4 ... 2016). ...


Biotechnology for Biofuels
2016 9:147 DOI: 10.1186/s13068-016-0560-8

Engineering a highly active thermophilic ?-glucosidase to enhance its pH stability and saccharification performance

Xia, W. et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences College of Animal Science, Zhejiang University

... Genes, introns, exons and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...


PloS one
2016, 11(3), e0150988. DOI: 10.1371/journal.pone.0150988

Missed, not missing: Phylogenomic evidence for the existence of Avian FoxP3

Denyer, M. P., Pinheiro, D. Y., Garden, O. A., Shepherd, A. J.
Department of Clinical Sciences and Services, The Royal Veterinary College, London, United Kingdom, Institute of Structural and Molecular Biology and Department of Biological Sciences, Birkbeck, University of London, London, United Kingdom Institute of Structural and Molecular Biology and Department of Biological Sciences, Birkbeck, University of London, London, United Kingdom

... Gene prediction software such as Softberry FGENESH [41] still predicts that foxp3 is present in the inter-genic region between ppp1r3f and ccdc22 (S1 File). ...


Immunogenetics
2016, 68(1), 77-82. DOI: 10.1007/s00251-015-0885-7

Assembly and characterization of the MHC class I region of the Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis)

Ruan, R., Wan, X. L., Zheng, Y., Zheng, J. S., Wang, D.
1. Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China 2. University of Chinese Academy of Sciences, Beijing, 100039, China

... KP994094. First, Genscan (http://genes.mit.edu/GENSCAN.html) and Fgenesh (http://www.softberry.com/) (Burge and Karlin 1997; Salamov and Solovyev 2000) were used to predict genes pre- senting in the YFP MHC class I region. ...


Molecular Genetics and Genomics
2016, 291: 1137–1154. doi:10.1007/s00438-016-1169-0

Genome-wide analysis of CrRLK1L gene family in Gossypium and identification of candidate CrRLK1L genes related to fiber development

Niu, E. et al.,
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Hybrid Cotton R&D Engineering Research Center, Ministry of EducationNanjing Agricultural University

...he CrRLK1L sequences were obtained after being confirmed by the online FGENESH (http://www.softberry.com/berry. phtml; Solovyev et al. 2006) and SMART (http://smart. ...


Plant biotechnology journal
2016 DOI: 10.1111/pbi.12577

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat

Bonneau, J., Baumann, U., Beasley, J., Li, Y., Johnson, A. A.
School of BioSciences, The University of Melbourne, Melbourne, Vic., Australia Australian Centre for Plant Functional Genomics, The University of Adelaide, Adelaide, SA, Australia

... genes. Matching sequences from the IWGSC portal were annotated using the TriAnnot-v1.4 (http://wheat-urgi.versailles.inra.fr) and FGENESH (http://www.softberry.com/) pipelines ...


South African Journal of Botany
2016, 102, 142-152. doi:10.1016/j.sajb.2015.06.012

YUCCA type auxin biosynthesis genes encoding flavin monooxygenases in melon: Genome-wide identification and developmental expression analysis.

Zheng, L. et al.,
a Forestry and Fruit Research Institute, Shanghai Key Laboratory of Protected Horticultural Technology, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China b School of Life Sciences, Taizhou University, Taizhou, Zhejiang 317000, China

... Thereafter, HMM-based gene structure prediction was carried out using the FGENESH program (default values) at http://linux1.softberry.com/berry.phtml. ...


Journal of insect physiology
2016, 58(4), 570-579. doi:10.1016/j.jinsphys.2011.12.009

Localization of two Na+-or K+-H+ antiporters, AgNHA1 and AgNHA2, in Anopheles gambiae larval Malpighian tubules and the functional expression of AgNHA2 in yeast

Xiang, M. A., Linser, P. J., Price, D. A., & Harvey, W. R.
a Division of Nephrology and Hypertension, Department of Medicine, University of Florida-Jacksonville, Jacksonville, FL 32206, USA b Whitney Mosquito Biology Group, University of Florida, 9505 Ocean Shore Boulevard, St. Augustine, FL 32080, USA

... gambiae that were applied to FGENESH at the Softberry site (http://www.softberry.com/berry.phtml) identified a cDNA from a genomic region of ?30 kb; it included the originally predicted ...


Tree Genetics & Genomes
2016, 12: 2. DOI: 10.1007/s11295-015-0962-y

Homologs of the FB_MR5 fire blight resistance gene of Malus? robusta 5 are present in other Malus wild species accessions

Wohner, T et al.,
Julius Kuhn-Institut, Institute for Breeding Research on Fruit Crops, Medical Theoretical Center (MTZ), Experimental Center, Faculty of Medicine Carl Gustav CarusTechnical University Dresden

... Gene and protein predictions were made with FGENESH (www.?softberry.?com) using the organism-specific parameters for Solanum lycopersicum. ...


Theoretical and Applied Genetics
2016, 129(3), 507-516. DOI: 10.1007/s00122-015-2644-4

Fine mapping of a dominantly inherited powdery mildew resistance major-effect QTL, Pm1.1, in cucumber identifies a 41.1 kb region containing two tandemly arrayed cysteine-rich receptor-like protein kinase genes

Xu, X. et al.,
1. School of Horticulture and Plant Protection, Yangzhou University, Yangzhou, 225009, Jiangsu, China 2. USDA-ARS Vegetable Crops Research Unit, Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA

... al. 2012). Gene prediction and sequence annotation The genomic DNA region harboring the PMR locus was annotated with FGENESH (http://sunl.softberry.com/) and InterProScan (http://www.ebi.ac.uk/InterProScan). Genes ...


Theoretical and Applied Genetics
2016, 129(1), 53-64. DOI: 10.1007/s00122-015-2608-8

Map-based cloning reveals the complex organization of the BnRf locus and leads to the identification of BnRf b, a male sterility gene, in Brassica napus

Deng, Z. et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China 2. Institute of Crop Science, Anhui Academy of Agricultural Science, Hefei, 230031, China

.. Bioinformatics analysis The website-based software FGENSH (http://www.soft- berry.com) was used to predict putative ORFs from the candidate region. The genomic or coding sequences of predicted genes were submitted to NCBI (http://www. ...


Crop and Pasture Science
2016, 67(5), 541-552. doi: 10.1071/CP15165

NB-LRR gene family required for Rsc4-mediated resistance to Soybean mosaic virus

Li, N. et al.,
National Center for Soybean Improvement, National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Weigang 1, Nanjing 210095, P.R. China.

... The online program Fgenesh (www.softberry.com/) was used to predict open reading frames (ORFs). ...


Sci Rep.
2016; 6: 29072. doi: 10.1038/srep29072

Expansion of amphibian intronless interferons revises the paradigm for interferon evolution and functional diversity

Sang, Y. et al.,
Departments of Anatomy and Physiology, College of Veterinary Medicine, Kansas State University, Manhattan, USA 2Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, USA 3Arthropod-Borne Animal Diseases Research Unit, Center for Grain and Animal Health Research, Agricultural Research Service, United States Department of Agriculture, Manhattan, KS, USA

...Programs interactively used for gene prediction include GenomeScan (http://genes.mit.edu/genomescan.html) and FGENESH (http://www.softberry.com), and were further manually annotated for confirmation. ... ... Regulatory elements in the putative proximal promoters were examined against both human/animal TFD Database using program Nsite (Version 5.2013, at http://www.softberry.com)39. ...


Insect molecular biology
Volume 25, Issue 3 June 2016 Pages 191–201 DOI: 10.1111/imb.12210

The transformer genes in the fig wasp Ceratosolen solmsi provide new evidence for duplications independent of complementary sex determination

Jia, L. et al.,
Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan, China

... local BLAST searches (Altschul et al., 1990) using previously published protein sequences of Tra from closely related species and predicted gene structures with FGENESH1 in the SOFTBERRY software package (ht ...


Environmental and Experimental Botany
2016, 121, 121-131. doi:10.1016/j.envexpbot.2015.05.016

FTL2 expression preceding bud set corresponds with timing of bud set in Norway spruce under different light quality treatments

Opseth, L. et al.,
Department of Plant Sciences, Norwegian University of Life Sciences, P.O. Box 5003, N-1432 As, Norway

... 2.6. Phylogenetic analysis. The coding DNA sequences of the PaPHYs and PaCRYs were translated into protein using GENSCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://sun1.softberry.com/berry.phtml). ...


Fungal Biology
2016 doi:10.1016/j.funbio.2016.06.005

Cytochrome P450 complement (CYPome) of Candida oregonensis, a gut-associated yeast of bark beetle, Dendroctonus rhizophagus

Hernandez-Martinez, F., Briones-Roblero, C. I., Nelson, D. R., Rivera-Orduna, F. N., & Zuniga, G.
a Departamento de Zoologia, Escuela Nacional de Ciencias Biologicas, Instituto Politecnico Nacional, Prolongacion de Carpio y Plan de Ayala, Col. Sto. Tomas, Mexico D.F. CP 11340, Mexico b Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, 858 Madison Ave. Suite G01, Memphis, TN 38163, USA

... in both processes have been documented (DiGuistini et al., 2011, Adams et al., 2013, Lah et al., 2013 and Xu et al., 2016). ... based (HMM) gene structure prediction was performed using the Fgenesh program (Solovyev 2007) in the MolQuest package v 2.4.5.1135 (SoftBerry Inc. ...


Microbiological Research
2016, 192, 142-147. doi:10.1016/j.micres.2016.06.010

Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation

Goulin, E. H. et al.,
a Department of Genetics, Universidade Federal do Parana, P.O. BOX 19071, CEP: 81531-980 Curitiba, PR, Brazil b Fund for Citrus Protection, Fundecitrus, Av. Dr. Adhemar Pereira de Barros, 201, CEP: 14807-040 Araraquara, SP, Brazil

... in which the T-DNA insertion was located were selected for gene prediction using FGENESH software (http://www.softberry.com/berry ...


PloS one
2016, 11(1), e0147486. doi: 10.1371/journal.pone.0147486

Two Horizontally Transferred Xenobiotic Resistance Gene Clusters Associated with Detoxification of Benzoxazolinones by Fusarium Species

Glenn, A. E. et al.,
USDA, ARS, Richard B. Russell Research Center, Toxicology & Mycotoxin Research Unit, Athens, Georgia, United States of America University of Georgia, Department of Plant Pathology, Athens, Georgia, United States of America

... Manual annotation of cluster genes was done by comparison to F. verticillioides and other annotated species and by using FGENESH [29] through www.softberry.com. ...


PloS one
2016, 11(7), e0160197. doi: 10.1371/journal.pone.0160197

Identification of Novel Transcribed Regions in Zebrafish (Danio rerio) Using RNA-Sequencing

Wang, J., Vesterlund, L., Kere, J., Jiao, H.
Department of Biosciences and Nutrition, Science for Life Laboratory, Karolinska Institutet, Stockholm, Sweden Clinical Research Centre, Karolinska University Hospital, Huddinge, Sweden

... Besides using junction information to clarify hypothetical exon boundaries within clusters, we also used gene models provided by GENSCAN [16] and open reading frame (ORF) predicted using FGENESH software (http://www.softberry.com) to ...


Mycoscience
2016, 57(2), 136-143 doi:10.1016/j.myc.2015.12.003

Cloning and characterization of cuticle-degrading serine protease from nematode-trapping fungus Arthrobotrys musiformis

Tzean, Y. et al.,
a Department of Plant Pathology and Microbiology, College of Bio-Resources and Agriculture, National Taiwan University, Taipei 10617, Taiwan, ROC b Department of Energy, Plant Research Laboratory, Michigan State University, East Lansing, MI 48824-1312, USA

... The 5?UTR was predicted using Softberry FGENESH gene prediction software. ...


Theoretical and Applied Genetics
2016, 129(2), 305-316. DOI: 10.1007/s00122-015-2628-4

Identification and mapping of Tril, a homeodomain-leucine zipper gene involved in multicellular trichome initiation in Cucumis sativus

Wang, Y. L. et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, 800 Dongchuan Road, Minhang District, Shanghai, 200240, China 2. Hunan Vegetable Research Institute, Hunan Academy of Agriculture Sciences, Changsha, 410125, China

... The functions of candi- date genes were retrieved from the NCBI website (http:// archive-dtd.ncbi. nlm.nih.gov/). According to dicot plant (Arabidopsis)-based gene structure prediction (http:// linux1.softberry.com/), the Cucsa.045360 gene structure was identified in the tril mutant. ...


Genome biology and evolution
2016, 8(2), 302-316. doi: 10.1093/gbe/evv259

Retention, Molecular Evolution, and Expression Divergence of the Auxin/Indole Acetic Acid and Auxin Response Factor Gene Families in Brassica Rapa Shed Light on Their Evolution Patterns in Plants

Huang, Z. et al.,
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Germplasm Enhancement of Horticultural Crops in East China, College of Horticulture of Nanjing Agricultural University, Nanjing, P.R. China 2Center of Genomics and Computational Biology, College of Life Sciences, North China University of Science and Technology, Tangshan, Hebei, China

... Then, the FGENESH program (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group= programs&subgroup=gfind) was used to rectify incorrect start codon predictions, splicing errors, and missed or extra exons; manual reannotation was performed. ...


Genes & Genomics
2016, 38(2), 109-117. DOI: 10.1007/s13258-015-0356-4

Identification and evolutionary history of the DD41D transposons in insects

Zhang, H. H., Shen, Y. H., Xiong, X. M., Han, M. J., Zhang, X. G.
1. College of Pharmacy and Life Science, Jiujiang University, Jiujiang, 332000, China 2. State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, 400715, China

... Potential open reading frame (ORF) of rosa and Lsra transposons identified in this study was predicted using FGENESH (http://?linux1.?softberry.?com/?berry.?phtml), GENSCAN (http://?genes.?mit.?edu/?GENSCAN.?html) or getorf in EMBOSS-6.3.1 package (Rice et al. ...


Mycologia
2016, 15-200. doi: 10.3852/15-200

mrskn7, a putative response regulator gene of Monascus ruber M7, is involved in oxidative stress response, development and mycotoxin production

Shao, Y., Yang, S., Zhang, Z., Zhou, Y., Chen, F.
1 Huazhong Agricultural University, Wuhan, Hubei 3Hubei Academy of Agricultural Sciences, Wuhan, Hubei 4Huazhong Agricultural University, Wuhan, Hubei, 430070, China

... BLAST webserver (http://blast.ncbi.nlm.nih.Gov/Blast.cgi). The mrskn7 protein sequence was deduced using SoftBerry's FGENESH program (http://linuxl.softberry.com/berry. phtml). Homology analysis was subsequently performed ...


Plant Cell Reports
2016, 1-12. DOI: 10.1007/s00299-016-2008-9

Reduction of GIGANTEA

Kim, J. A. et al.,
1. Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural Development Administration, 370, Nongsaengmyeong-ro, Wansan-gu, Jeollabuk-do, Jeonju-si, 560-500, Korea 2. Department of Biological Sciences, Dartmouth College, Hanover, NH, 03755-3563, USA

.. A bacterial artificial chromosome (BAC) clone containing the ortholog of GI was identified (http://www.brassica-rapa.org), and the GI structure and sequence were predicted using the web-based gene prediction software FGENE-SH Arabidopsis (http://www.softberry.com/berry ...


Genetica
2016, 144(2), 229-241. DOI: 10.1007/s10709-016-9893-2

Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris

Deshmukh, R., Singh, V. K., Singh, B. D.
1. Faculty of Science, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India 2. Faculty of Science, Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India

... The Fgenesh (http://linux1.softberry.com/) and GENSCAN (http://genes.mit.edu/; Burge and Karlin 1997) online ser- vers were used to detect/confirm the Mlo gene structures and the positions of transcription start sites and polyA tails in the Mlo members from the two species. ...


Gene
2016, 585(2), 196-204. doi:10.1016/j.gene.2016.02.034

Identification and evolution of two insulin receptor genes involved in Tribolium castaneum development and reproduction

Sang, M., Li, C., Wu, W., Li, B.
Jiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China

... http://beetlebase.org) (Kim et al., 2010). The initial search results were further analyzed using the gene prediction software FGENESH (http://linux1.softberry.com/ berry.phtml). Based on the predicted sequences, we designed ...


PloS one
2016, 11(3), e0151323. http://dx.doi.org/10.1371/journal.pone.0151323

An Approach to Function Annotation for Proteins of Unknown Function (PUFs) in the Transcriptome of Indian Mulberry

Dhanyalakshmi, K. H. et al.,
Department of Crop Physiology, University of Agricultural Sciences, GKVK, Bengaluru, 560065, India National Centre for Biological Sciences, TIFR, GKVK campus, Bengaluru, 560065, India

... The gene prediction was carried out using available online tools like Softberry's HMM-based ab-initio gene structure prediction by FGENESH [15] with Populus trichocarpa as reference genome and AUGUSTUS (A. thaliana), a HMM-based eukaryotic gene prediction server [16 ...


Scientific reports
2016, 6: 25591. doi: 10.1038/srep25591

Directional Selection from Host Plants Is a Major Force Driving Host Specificity in Magnaporthe Species

Zhong, Z. et al.,
1Fujian-Taiwan Joint Center for Ecological Control of Crop Pests, Fujian Agriculture and Forestry University, Fuzhou, 350002, China 2Fujian University Key Laboratory for Functional Genomics of Plant Fungal Pathogens, Fujian Agriculture and Forestry University, Fuzhou, 350002, China

... Gene predictions was conducted through a combination of evidence-based prediction by Exonerate 58 (version 2.2.0) with M. oryzae 70-15 genes as reference and de novo prediction with Fgenesh from SoftBerry (http://linux1.softberry.com/berry.phtml) with Magnaporthe as ...


Genetics and molecular research: GMR
2016, 15(1). DOI http://dx.doi.org/10.4238/gmr.15017507

Regulation of bolting and identification of the ?-tubulin gene family in Brassica rapa L. ssp pekinensis

Zhang, Y. W. et al.,
1 College of Horticulture, Northeast Agricultural University, Harbin, China 2 Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Northeast Region), Ministry of Agriculture, Harbin, China

... Each TUA gene loci in A. thaliana was used to search all the TUA gene sequences of B. rapa present in BRAD. Each predicted B. rapa TUA gene sequence was confirmed using FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...


Brazilian journal of microbiology
2016, 47(2), 468-479. http://dx.doi.org/10.1016/j.bjm.2016.01.004

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism

Yao, L. et al.,
aKey Laboratory of Molecular and Cytogenetics and Genetic Breeding of Heilongjiang Province, Harbin Normal University, Harbin, PR China bDepartment of Life Science and Engineering, Harbin Institute of Technology, Harbin, PR China

... http://www.phrap.org/). The potential open reading frames (ORFs) of the two PKSs were scanned using FGENESH as the matrix (http://linux1.softberry.com) and compared with T. virens gene sequences. The conserved PKS ...


heoretical and Applied Genetics
2016, Volume 129, Issue 7 , pp 1247-1256 DOI: 10.1007/s00122-016-2700-8

Map-based cloning, identification and characterization of the w gene controlling white immature fruit color in cucumber (Cucumis sativus L.)

Liu, H. et al.,
1. College of Horticulture, Northwest A&F University, Yangling, Shaanxi, 712100, China

... Sequence analyses Gene prediction was performed using the online program FGENESH (http://linux1.softberry.com/berry.phtml) (Salamov and Solovyev 2000) and Cucumber Genome Browser (http://www.icugi.org/cgi-bin/ICuGI/index.cgi). ...


Biotechnology letters
2016, 38(1), 71-79. DOI: 10.1007/s10529-015-1943-9

Characterization of a farnesyl diphosphate synthase gene from Penicillium brevicompactum MUCL 19011

Sharifirad, A. et al.,
1. Department of Systems Biotechnology, Institute of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran

... www.?genomatix.?de/?cgi-bin/?eldorado/?main.?pl ). ORF features were predicted using the web-based software FGENESH (http://?linux1.?softberry.?com/?berry.? phtml). The PbFDS was subjected to multiple alignments ...


Heredity
116, 491-501 (June 2016) | doi:10.1038/hdy.2016.5

The cacao pathogen Moniliophthora roreri (Marasmiaceae) possesses biallelic A and B mating loci but reproduces clonally

Diaz-Valderrama, J. R., Aime, M. C.
Institute

... In addition, the genomic surrounding areas of receptors were explored to find linked potential B pheromone precursor sequences by manually identifying the conserved motifs (Riquelme et al., 2005) in small polypeptides detected by FGENESH (http://www.softberry.com/). ...


Frontiers in plant science
2016, 7: 244. doi: 10.3389/fpls.2016.00244

Functional characterization of novel chitinase genes present in the sheath blight resistance QTL: qSBR11-1 in rice line Tetep

Richa, K. et al.,
1 ICAR-National Research Centre on Plant Biotechnology, New Delhi, India 2 Department of Bioscience and Biotechnology, Banasthali Vidyapith, Vanasthali, India 3 School of Agriculture and Food Sciences, The University of Queensland, Brisbane, QLD, Australia

... Computational analysis of the genes. Full length nucleotide sequence of 11 defense response genes was retrieved from the rice genome database (www.gramene.org). FGENESH gene prediction software (www.softberry.com) was used to predict the candidate gene structures. ...


PloS one
2016, 11(5), e0156199. http://dx.doi.org/10.1371/journal.pone.0156199

Dimerization and Transactivation Domains as Candidates for Functional Modulation and Diversity of Sox9

Geraldo, M. T., Valente, G. T., Nakajima, R. T., Martins, C.
Integrative Genomics Laboratory, Department of Morphology, Institute of Biosciences, Sao Paulo State University–UNESP, Botucatu, SP, 18618–000, Brazil Systems Biology and Genomics Laboratory, Department of Bioprocess and Biotechnology, Agronomical Science Faculty, Sao Paulo State University–UNESP, Botucatu, SP, 18610–307, Brazil

... Elmer). Finally, a prediction of introns, exons and amino acid sequences were performed using the online program Softberry FGENESH (http://www.softberry.com/). Phylogenetic analyses: HMG box, SoxE and Sox9. Three phylogenetic ...


Journal of Plant Biochemistry and Biotechnology
2016, 1-9. DOI: 10.1007/s13562-016-0362-x

Candidate gene prediction and expression profiling of near isogenic lines (NILs) carrying stay-green QTLs in rabi sorghum

Chaudhari, G. N., Fakrudin, B.
1. Institute of Agri-Biotechnology, University of Agricultural Sciences, Dharwad, 580005, India 2. Department of Biotechnology and Crop Improvement, UHS Campus, GKVK Post, Bengaluru, 560 065, India

... The retrieved QTL regions were surveyed for the presence of putative candidate genes using algorithms such as FGENESH (http://?linux1.?softberry.?com), GENSCAN (http://?genes.?mit.? edu/?GENSCAN.?html) and GENMARK (http://?exn.?gatech.?edu/?eukhmm.?cgi ...


Angewandte Chemie
2016, 128(2), 674-678. DOI: 10.1002/ange.201509345

Production of New Cladosporin Analogues by Reconstitution of the Polyketide Synthases Responsible for the Biosynthesis of this Antimalarial Agent

Cochrane, R. V. et al.,
Department of Chemistry, University of Alberta, Edmonton, Alberta, T6G 2G2 (Canada) Department of Chemical and Biomolecular Engineering and Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095 (USA)

... Spliced gene sequences contained within this gene cluster were identified using the hidden Markov model (HMM) based software FGENESH (Softberry),23 and the resulting intron-less sequences were analyzed individually by BLAST (NCBI; Figure 1). Figure 1. Figure 1. ...


Journal of plant research
2016, 129(3), 499-512. DOI: 10.1007/s10265-016-0797-0

Characterization of triterpenoid profiles and triterpene synthase expression in the leaves of eight Vitis vinifera cultivars grown in the Upper Rhine Valley

Pensec, F. et al.,
1. Laboratoire Vigne Biotechnologies et Environnement EA 3391, Universite de Haute Alsace, 33 rue de Herrlisheim, 68000, Colmar, France 2. Department of Plant Biochemistry, Faculty of Biology, University of Warsaw, ul. Miecznikowa 1, 02-096, Warsaw, Poland

... The gene named VvTTPS3 was first characterized as two different genes (GSVIVT01029481001 and GSVIVT01029482001), but the study of these sequences using the FGENESH function of Softberry (http://linux1.softberry.com/berry.phtml) indi- cated that the two sequences ...


Theoretical and Applied Genetics
2016, 1-9. DOI: 10.1007/s00122-016-2722-2

Fine mapping of the dialytic gene that controls multicellular trichome formation and stamen development in tomato

Chang, J. et al.,
1. Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... 1987; Lincoln et al. 1992). Gene prediction The predicted genes in the target region were downloaded from SGN (ftp://sgn.cornell.edu). These genes were further analyzed with FGENESH (http://linux1.softberry.com/) and GENESCAN (http://genes.mit.edu/). ...


Journal of experimental botany
2016, erw187. doi: 10.1093/jxb/erw187

WAX INDUCER1 (HvWIN1) transcription factor regulates free fatty acid biosynthetic genes to reinforce cuticle to resist Fusarium head blight in barley spikelets

Kumar, A. et al.,
1 Plant Science Department, McGill University, Sainte-Anne-de-Bellevue, QC H9X3V9, Canada 2 Centre de Recherche sur les Grains Inc., 740, chemin Trudeau, Saint-Mathieu-de-Beloeil, QC J3G0E2, Canada

... The contigs were downloaded and genes were predicted using the SoftBerry FGENESH program (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). RNA extraction, cDNA synthesis and quantitative real-time PCR analysis. ...


Chromosoma
2016, 1-11 DOI 10.1007/s00412-016-0601-x

The repetitive DNA element BncDNA, enriched in the B chromosome of the cichlid fish Astatotilapia latifasciata, transcribes a potentially noncoding RNA

Ramos E. et al.,
1. Department of Morphology, Institute of Biosciences, Sao Paulo State University, 18618-689, Botucatu, SP, Brazil 2. Allied Health Sciences Department and Institute for Systems Genomics, University of Connecticut, 06269, Storrs, CT, USA

... janelia.org; Finn et al. 2011), pfam (www.pfam.xfam.org; Finn et al. 2014) and UniProt (http://www.uniprot.org/blast/; The UniProt Consortium 2015); in addition, gene predictions were performed using FGENESH at softberry (http://www. softberry.com; Solovyev et al. 2006). ...


Euphytica
2016, Volume 209, Issue 3, pp 725-737 DOI 10.1007/s10681-016-1666-6

Identification and validation of novel alleles of rice blast resistant gene Pi54, and analysis of their nucleotide diversity in landraces and wild Oryza species

Ramkumar, G. et al.,
Crop Improvement Section, Indian Institute of Rice Research

... default settings. Gene structure (length of open reading frame (ORF) and number of exons/introns, etc. and protein sequences were derived using online tool, softberry-FGENESH (http://?linux1.?softberry.?com). Numbers of ...


Theoretical and Applied Genetics
2016, 1-16. DOI 10.1007/s00122-016-2723-1

Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense)

Liu, L. et al.,
1. Department of Plant Science and Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea 2. Department of Agronomy and Horticultural Science, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan

... Gene coding regions of the tomato scaffold were predicted by FGENESH+ (http://linux1.softberry. com). ... repeatmasker.org) and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were predicted with FGENESH (http://linux1.softberry.com) and BLASTX (https://blast. ...


Ecotoxicology and environmental safety
2016, 124, 363-368. doi:10.1016/j.ecoenv.2015.11.008

Functional and transcript analysis of a novel metal transporter gene EpNramp from a dark septate endophyte (Exophiala pisciphila)

Wei, Y. F. et al.,
a Key Laboratory of Conservation and Utilization for Bioresources and Key Laboratory of Microbial Diversity in Southwest China, Ministry of Education, Yunnan University, Kunming, 650091 Yunnan, PR China b Kunming Police Dog Base of the Ministry of Public Security, Kunming, 650204 Yunnan, PR China

... different fungi. ORF was also predicted using both ORF Finder (http://www.ncbi.nlm. nih.gov/gorf/orfig.cgi) and SoftBerry-FGENESH (http://linux1.softberry.com/berry.phtml? topic=fgenesh&group=programs&;subgroup=gfind). Then ...


Fish & shellfish immunology
2016, 49, 154-162. doi:10.1016/j.fsi.2015.12.009

Genome-wide identification of Hsp70 genes in channel catfish and their regulated expression after bacterial infection

Song, L. et al.,
a Marine Science and Engineering College, Qingdao Agricultural University, Qingdao, 266109, China b Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Program of Cell and Molecular Biosciences, Auburn University, Auburn, AL 36849, USA

... database using TBLASTN program. The retrieved genome scaffolds were then predicted by FGENESH in SoftBerry (http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind). The amino acid ...


PloS one
2016, 11(2), e0148422. http://dx.doi.org/10.1371/journal.pone.0148422

A new glabrous gene (csgl3) identified in trichome development in cucumber (Cucumis sativus L.).

Cui, J. Y. et al.,
Institute

... The FGENESH program (Softberry, Inc., Mount Kisco, NY, USA) was used on the 19.6 kb genomic DNA region in scafflold000002 of the 9930 draft genome delimited by dCAPs-19 and dCAPs-21.... ... Candidate genes prediction. Potential candidate genes in the target genomic region were identified using Softberry (http://linux1.softberry.com/all.htm) and the Cucumber Genome Database (http://www.icugi.org/cgi-bin/ICuGI/index.cgi). ...


Applied biochemistry and biotechnology
2016, 1-28. DOI 10.1007/s12010-016-2114-8

The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding

Ayadi, M. et al.,
1. Laboratory of Extremophile Plants. Center of Biotechnology of Borj-Cedria (CBBC), BP 901, Hammam-lif, 2050, Tunisia 2. Laboratory of Molecular and Cellular Screening Processes, Center of Biotechnology of Sfax, University of Sfax, Sidi Mansour Road, P.O. Box 1177, 3018, Sfax, Tunisia

... net/clementine). All gene structures (exon-intron organization) were predicted by FGENESH Softberry (http://linux1.softberry.com/berry.phtml) [36]. Multiple Sequence Alignment, Structural and Phylogenetic Analysis To gain ...


Fish & shellfish immunology
2016, 49, 110-121. doi:10.1016/j.fsi.2015.12.022

Septin genes in channel catfish (Ictalurus punctatus) and their involvement in disease defense responses

Fu, Q. et al.,
a State Key Laboratory of Estuarine and Coastal Research, East China Normal University, Shanghai, 200062, China b The Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL, 36849, USA

... with a cutoff E-value of 1e ?10 . Fgenesh program of Molquest software (Softberry Int.) was used to predict the genes from retrieved genomic scaffold sequences [56]. The simple modular architecture research tool (SMART http ...


Acta Physiologiae Plantarum
2016, 38(6), 1-14. DOI 10.1007/s11738-016-2152-4

The plasma membrane proton pump gene family in cucumber

Wdowikowska, A., Klobus, G.
1. Department of Plant Molecular Physiology, Institute of Experimental Biology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland

... sequences of new genes, promoter sequences and 5? untranslated region (5? UTR) as well as encoded amino acid sequences were predicted and analyzed using the FGENESH program (hidden Markov model (HMM)-based gene prediction program; softberry.com) with ...


Journal of General Plant Pathology
2016, 82(3), 121-131. DOI 10.1007/s10327-016-0656-9

The global regulator LaeA controls biosynthesis of host-specific toxins, pathogenicity and development of Alternaria alternata pathotypes

Takao, K. et al.,
1. The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan 2. Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan

... 2004) as a query. Softberry FGENESH (http://?linux1.?softberry.?com/?berry.? phtml) was then used to predict the amino acid sequence of the LaeA homolog in the tomato pathotype of A. alternata. The conserved domain of ...


Journal of General Plant Pathology
2016, Volume 82, Issue 2 , pp 82-88 DOI 10.1007/s10327-016-0647-x

Functional characterization of putative G protein-coupled receptors in the tomato pathotype of Alternaria alternata

Takao, K., Akagi, Y., Tsuge, T., Kodama, M.
1. The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan 2. Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan

... al. 2006; Xue et al. 2008) as queries. Softberry FGENESH (http://?linux1.?softberry.? com/?berry.?phtml) was then used to predict the amino acid sequences of the GPCR homologs in the A. alternata tomato pathotype. The ...


FGENESH 2015

Biotechnology and Bioengineering
2015 DOI 10.1002/bit.25864

Engineering Rhodosporidium toruloides for increased lipid production

Zhang et al.,
1: Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America. 2: Department of Bioengineering, University of California, Berkeley, California, United States of America.

... Genome annotation was performed using an automated software pipeline FGENESH++ (http://www.softberry.com) version 3.1.1. Genes were first predicted ab initio using FGENESH... Gene prediction parameters were obtained from Softberry and were based on Puccinia spp. ...


Insect biochemistry and molecular biology
2015, 65, 1-9. doi:10.1016/j.ibmb.2015.07.009

Alternatively spliced orcokinin isoforms and their functions in Tribolium castaneum

Jiang, H., Kim, H. G., Park, Y
a Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 40071, People's Republic of China b Department of Entomology, Kansas State University, Manhattan, KS 66506, United States

... Kim et al., 2010). A manual OK-A prediction was performed in the region near TC005944 and was assisted by the FGENESH program ( Solovyev et al., 2006) from the Softberry website (http://www.softberry.com). To confirm the ...


Journal of applied genetics
2015, 1-12. DOI: 10.1007/s13353-015-0271-z

Structural characteristics of ScBx genes controlling the biosynthesis of hydroxamic acids in rye (Secale cereale L.)

Bakera et al.,
1. Department of Plant Genetics, Breeding and Biotechnology, Warsaw University of Life Sciences, 159 Nowoursynowska Str, 02-776, Warsaw, Poland 2. Plant Breeding and Acclimatization Institute (IHAR) - National Research Institute, Radzikow, 05-870, Blonie, Poland

... Bioinformatic analyses were performed by means of the pro- grams listed below using default settings except for SoftBerry/ FGENESH when monocot plant specific gene-finding param- eters and Blastn when the selection of nucleotide collection (in Bother databases^ section ...


Physiology and Molecular Biology of Plants
2015, 21(2), 301-304. DOI: 10.1007/s12298-015-0284-

Nucleotide variation and identification of novel blast resistance alleles of Pib by allele mining strategy

Ramkumar, G., Madhav, M. S., Devi, S. R., Prasad, M. S., Babu, V. R
1. Crop Improvement Section, Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, India

... In that analysis, standard error was calculated by bootstrap value with 1000 replicates. Phylogenic tree was constructed with MEGA - Neighbor- Joining (NJ) method. Gene structure was annotated using on- line tool softberry- FGENESH (http://linux1.softberry.com). ...


IUBMB Life
2015, Volume 68, Issue 2, pages 122–135, February 2016 DOI: 10.1002/iub.1464

Identification of differentially expressed three novel transcript variants of mouse ARNT gene

Ishqi, H. M., Ur Rehman, S., Sarwar, T., Husain, M. A., Tabish, M.
Institute

... finding tools. Gene finding tools used in our study were HMM gene (http://www.cbs. dtu.dk/services/HMMgene/), Genebuilder (http://www.itba.mi.cnr.it/webgene/) and FGENESH (http://linux1.softberry.com/berry.phtml). "Fex" available ...


Journal of basic microbiology
2015, 55(5), 591-600. DOI: 10.1002/jobm.201300814

Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia lunata

Fan, L et al.,
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China

... After predicting online on the softberry website (http://linux1.softberry.com/berry.phtml? topic=fgenesh&group=programs&subgroup=gfind) and using PCR for confirmation, we cloned a 710 bp cDNA fragment containing the T-DNA insertion site. ...


Theoretical and Applied Genetics
2015, 128(10), 2099-2111. DOI: 10.1007/s00122-015-2570-5

Fine mapping of powdery mildew resistance genes PmTb7A. 1 and PmTb7A. 2 in Triticum boeoticum (Boiss.) using the shotgun sequence assembly of chromosome 7AL

Chhuneja, P et al.,
1. School of Agricultural Biotechnology, Punjab Agricultural University, Ludhiana, 141 004, India 2. Institute of Plant Biology, University of Zurich, Zurich, Switzerland

... softberry.com/berry.phtml?topic=fgenesh&group=progra ms&subgroup=gfind). ... The Prot_Map (http://linux1.soft- berry.com/berry.phtml?topic=prot_map&group=program s&subgroup=xmap) was used to align protein sequences with their corresponding nucleotide sequences. ...


Biotechnology letters
2015, 37(4), 907-919 DOI: 10.1007/s10529-014-1733-9

GhDRIN1, a novel drought-induced gene of upland cotton (Gossypium hirsutum L.) confers abiotic and biotic stress tolerance in transgenic tobacco

Dhandapani, G. et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India 2. Department of Plant Science, Bharathidasan University, Tiruchirappalli, 620024, Tamil Nadu, India

... Invitrogen). The ORF was identified by the FGENESH analysis using softberry software (www.?softberry.?com). ... sequenced. The ORF of the gene was identified by FGENESH of softberry online software using aligned sequence. ...


Plant Science
2015, Volume 234, May 2015, Pages 50–59, doi:10.1016/j.plantsci.2015.02.005

Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress

Jakubowska, D., Janicka-Russak, M., Kabala, K., Migocka, M., Reda, M.
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Kanonia Street 6/8, 50-328 Wroclaw, Poland

... homologs of genes encoding NADPH oxidase. Identified sequences were then analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www.softberry.com). ClustalW was used to perform the ...


Molecular Genetics and Genomics
2015, 290(2), 443-460. DOI: 10.1007/s00438-014-0927-0

Molecular evolution and functional divergence of X-intrinsic protein genes in plants

Venkatesh, J., Yu, J. W., Gaston, D., Park, S. W.
1. Department of Molecular Biotechnology, Konkuk University, 1, Hwayang-dong, Gwangjin-gu, Seoul, Republic of Korea 2. Department of Pathology, Dalhousie University, Halifax, NS, Canada

... GmXIP1;1, GmXIP1;3, LuXIP2;2, RcXIP1;1, RcXIP2;1, RcXIP2;2 and SlXIP1;6), gene structures were predicted using FGENESH softberry tool (http://linux1.softberry. com/berry.phtml) due to uncertainty in the original gene models. ...


Marine genomics
Volume 24, Part 2, December 2015, Pages 147–157 doi:10.1016/j.margen.2015.03.010

Discovery of germline-related genes in Cephalochordate amphioxus: A genome wide survey using genome annotation and transcriptome data

Yue, J. X., Li, K. L., Yu, J. K.
a Ecology and Evolutionary Biology, Department of BioSciences, Rice University, 6100 Main Street, Houston, TX 77005, USA b Institute of Cellular and Organismic Biology, Academia Sinica, 128 Academia Road, Section 2, Nankang, Taipei, 11529, Taiwan

... We carried out the re-annotation using Softberry's FGENESH program (http://www. softberry.com/berry.phtml?topic=fgenesh) ( Salamov and Solovyev, 2000) with B. floridae specific gene discovery parameters provided by Softberry. ...


Journal of Applied Microbiology
2015 DOI: 10.1111/jam.13036

Occidiofungin is an Important Component Responsible for the Antifungal Activity of Burkholderia pyrrocinia Strain Lyc2

Wang, X. Q. et al.,
Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai'an, Shandong, China Collaborative Innovation Centre for Annually High Yield and High Efficiency Production of Wheat and Corn, Shandong Agricultural University, Tai'an, Shandong, China

... Biosciences, Carlsbad, CA) and Geneious R8 (Biomatters Ltd.). Open reading frames (ORFs) and genes were predicted by the Softberry FGENESH program (Salamov and Solovyev ... prediction was accomplished using the web-based software BRROM in the Softberry Page 9. ...


Applied biochemistry and biotechnology
2015, 177(1), 207-216. DOI: 10.1007/s12010-015-1738-4

Expression of Finger Millet EcDehydrin7 in Transgenic Tobacco Confers Tolerance to Drought Stress

Singh et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India 2. Institute of Biotechnology, Acharya N.G. Ranga Agricultural University, Hyderabad, 500030, India

... USA). Full-length ORF was obtained with the help of gene finding online tool FGENESH (softberry.?com). ... sequenced. The coding region of the gene was identified by FGENESH of softberry online software using aligned sequence. ...


Molecular biology reports
2015, 42(7), 1163-1174. doi:10.?1007/?s11033-015-3853-2

Genome-wide identification and expression profiling of the late embryogenesis abundant genes in potato with emphasis on dehydrins

Charfeddine, S., Saidi, M. N., Charfeddine, M., & Gargouri-Bouzid, R.
Unite Enzymes et Bioconversion, Ecole Nationale d’Ingenieurs de Sfax; Centre de Biotechnologie de Sfax

.. Proteins without any appropriate motif were re-predicted and corrected using Fgenesh software (http://?linux1.?softberry.?com/?berry.?phtml) using dicotyledon plant models. Proteins with no reliable prediction were removed. ...


Molecular medicine reports
2015, 11(4), 3069-3077. DOI: 10.3892/mmr.2014.3054

DHA-1 plasmid-mediated AmpC ?-lactamase expression and regulation of Klebsiella pnuemoniae isolates

Luan, Y. et al.,
Department of Medicine Laboratory, Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150086, P.R. China, Medicine Laboratory, Department of Urology Surgery, Daqing Oilfield General Hospital, Daqing, Heilongjiang 163001, P.R. China

... form pT-AmpD, whose sequence was also detected. The site of the AmpD gene promoter was predicted by Softberry Fgenesh (http://www.softberry.com) for sequence analysis. The AmpDP PCR procedure was performed with ...


Gene
2015, 556(2), 106-112. doi:10.1016/j.gene.2014.11.035

Molecular cloning, characterisation and mRNA expression of the ryanodine receptor from the peach-potato aphid, Myzus persicae

Troczka, B. J. et al.,
a Biological Chemistry and Crop Protection Department, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK b Institute of Molecular & Experimental Medicine, Cardiff University School of Medicine, Wales Heart Research Institute, Heath Park, Cardiff CF14 4XN, UK

... The intron/exon boundaries were determined using Spidey (http://www.ncbi.nlm.nih.gov/spidey/) and Softberry FGENESH (http://linux1.softberry.com/all.htm) software and by manual sequence analysis using Geneious v5.5 (Biomatters Ltd). 3. Results and discussion. 3.1. ...


Transgenic research
2015, 24(5), 847-858. DOI: 10.1007/s11248-015-9878-4

Identification of candidate MLO powdery mildew susceptibility genes in cultivated Solanaceae and functional characterization of tobacco NtMLO1

Appiano, M. et al.,
1. Laboratory of Plant Breeding, Wageningen University, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands 2. Department of Plant, Soil and Food Science, Section of Genetics and Plant Breeding, University of Bari Aldo Moro, Via Amendola 165/A, 70126, Bari, Italy

... The number of transmembrane domains was predicted using the online software TMHMM (http://?www.?cbs.?dtu.?dk/?services/?TMHMM/?). The putative number of introns was obtained using the online service FGENESH of Softberry (http://?www.?softberry.?com/?). ...


Annals of Forest Science
2015, 72(8), 1043-1052. DOI: 10.1007/s13595-015-0502-9

Molecular marker associated with a deleterious recessive anomaly in Eucalyptus grandis seedlings

Fuchs, M. C. et al.,
1. Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista (UNESP), Distrito de Rubiao Jr s/n, Botucatu, SP, 18618-970, Brazil 2. Departamento de Biologia, Campus Sorocaba, Universidade Federal de Sao Carlos (UFSCar), Rod. Joao Leme dos Santos, Km 110, Sorocaba, SP, 18052-780, Brazil

... 1997 ). The identified ESTs with high identity were translated by ExPASy translate tool (http://?expasy.?org) (Gasteiger et al. 2003 ) and analyzed using FGENESH (Softberry, http://?www.?softberry.?com) to predict the protein. ...


Current Biotica
2015, 8(4), 351-358.

A comprehensive computational analysis of cis-regulatory elements for anthocyanin biosynthesis genes in tomato (Solanum lycopersicum L.)

Dinabandhu, A.
ICAR- National Research Center on Plant Biotechnology, Pusa Campus, New Delhi-110012

... of International Tomato Annotation Group release 2.4 version was used from http://solgenomics. net/ and anthocyanin genes were predicted by using BLAST- Basic Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and FGENESH (www.softberry.com) gene ...


FGENESH 2014

International Biodeterioration & Biodegradation, 93, 186-194.
2014, 93, 186-194. DOI: 10.1016/j.ibiod.2014.06.001

Purification and characterization of a thermotolerant laccase isoform in Trametes trogii strain and its potential in dye decolorization

Yan J. et al.,
a Biotechnology Research Center of Life Science and Technology College, Kunming University of Science and Technology, Kunming Yunnan 650500, PR China b College of Life Science, the Southwest Forest University, Kunming Yunnan 650224, PR China

... The gene structure and amino acid sequences of full laccase were predicted and analyzed with Soft Berry-FGENSH/HMM-based gene structure prediction (http://linux1.softberry.com/ berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...


Tree Genetics & Genomes
2014, 10(2), 251-260. DOI: 10.1007/s11295-013-0678-9

Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

Schouten H. J. et al.,
1. Plant Breeding, Wageningen University and Research Centre, P.O. Box 386, 6700 AJ, Wageningen, The Netherlands 2. Inova Fruit, P.O. Box 222, 4190 CE, Geldermalsen, The Netherlands

... 2010b) was copied from the NCBI database (accession number GU295057.1). The Vr2-A, Vr2-B, and Vr2-C amino acid sequences in GMAL 2473 were predicted by means of the publicly available software FGENESH from SoftBerry. ...


PloS one
2014, 9(4), e93560. DOI: 10.1371/journal.pone.0093560

Whole Genome and Global Gene Expression Analyses of the Model Mushroom Flammulina velutipes Reveal a High Capacity for Lignocellulose Degradation

Park Y. J. et al.,
Department of Biomedical Chemistry, Konkuk University, Chung-Ju, Republic of Korea; Macrogen Inc., Seoul, Republic of Korea

... Gene identification was carried out using several methods, including ab initio gene structure prediction (Fgenesh; http://www.softberry.com), a homology-based approach (Fgenesh+; http://www.softberry.com), and transcriptome-based gene identification (Cufflinks; http://cufflinks ..


Cellular signalling
2014, 26(6), 1155-1165. DOI: 10.1016/j.cellsig.2014.02.003

Mature miR-183, negatively regulated by transcription factor GATA3, promotes 3T3-L1 adipogenesis through inhibition of the canonical Wnt/b -catenin signaling pathway by targeting LRP6

Chen C. et al.,
a Key Laboratory of Swine Genetics and Breeding of Agricultural Ministry and Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China

... BDGP (http://www.fruitfly.org/seq_tools/promoter.html) and SoftBerry (http://linux1.softberry.com/ berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) computer programs were utilized to analyze miR-183 gene structure, including TSS, CDS, and polyA signal. ...


Euphytica
2014, 196(3), 341-348. DOI: 10.1007/s10681-013-1037-5

Fine mapping of the uniform immature fruit color gene u in cucumber (Cucumis sativus L.)

Yang X et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, Dongchuan Road, Minhang District, Shanghai, 200240, China 2. Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, Chenshan Botanical Garden, Shanghai, 201602, China

... (Voorrips 2002 ). Gene prediction in the target genomic DNA regions was performed using the program FGENESH (Salamov and Solovyev 2000 ) (http://?linux1.?softberry.? com/?), and the results were checked manually. Results. ...


Molecular Breeding
2014, 1-13. DOI: 10.1007/s11032-014-0088-1

Fine genetic mapping of a locus controlling short internode length in melon (Cucumis melo L.)

Hwang J. et al.,
1. Department of Horticultural Bioscience, Pusan National University, Miryang, 627-706, Republic of Korea 2. Gyeongnam Agricultural Research and Extension Services, Jinju, 663-985, Republic of Korea

... market type cucumber inbred line “9930” (Li et al. 2011b ) were determined using FGENESH software (Softberry Inc., Mount Kisco NY, USA; http://?sunl.?softberry.? com/?). Primer pairs were designed to amplify these exon ...


Fungal biology
2014, 118(2), 228-241. DOI: 10.1016/j.funbio.2013.12.001

The Podosphaera fusca TUB2 gene, a molecular “Swiss Army knife” with multiple applications in powdery mildew research

Vela-Corcia, D., Bellon-Gomez, D., Lopez-Ruiz, F., Tores, J. A., & Perez-Garcia, A.
a Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” - Universidad de Malaga - Consejo Superior de Investigaciones Cientificas (IHSM-UMA-CSIC), Departamento de Microbiologia, Universidad de Malaga, Bulevar Louis Pasteur 31 (Campus Universitario de Teatinos), 29071 Malaga, Spain b Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” - Universidad de Malaga - Consejo Superior de Investigaciones Cientificas (IHSM-UMA-CSIC), Estacion Experimental “La Mayora”, 29750 Algarrobo-Costa, Malaga, Spain

... Potential open reading frames (ORFs), introns, and exons were predicted using FGENESH software from SoftBerry (http://linux1.softberry.com/berry.phtml). Amino acid alignments were performed with the CLC Main Workbench (Aarhus). ...


Gene
2014, 534(2), 204-217. DOI: 10.1016/j.gene.2013.10.058

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes

Noh J. Y. et al.,
a Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea b Department of Life Science and Biotechnology, College of Natural Sciences, Soonchunhyang University, Asan City 336-745 Republic of Korea

... sequencing method (see above). The fosmid library sequence information was used for predicting TmapoLp-III gene architecture using FGENESH 2.6 software from Softberry (http://linux1.softberry.com/berry.phtml/). The sequence of ...


Developmental & Comparative Immunology
2014, 46(2), 208-221. DOI: 10.1016/j.dci.2014.04.009

Gene structure, cDNA characterization and RNAi-based functional analysis of a myeloid differentiation factor 88 homolog in Tenebrio molitor larvae exposed to Staphylococcus aureus infection

Patnaik B. B. et al.,
a Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea b Department of Life Science and Biotechnology, College of Natural Sciences, Soonchunhyang University, Asan City 336-745, Republic of Korea

... sequencing method (see above). 2.4. Sequence analysis. The fosmid clone corresponding to TmMyD88 was analyzed using the FGENESH 2.6 program at Softberry (http://linux1.softberry.com/berry.phtml/). The 5?-flanking ...


The ScientificWorld Journal
Volume 2014, Article ID 619746, 7 pages DOI: /10.1155/2014/619746

Genetic diversity analysis of Hypsizygus marmoreus with target region amplification polymorphism.

Qiu, C., Yan, W., Deng, W., Song, B., Li, T.
1 Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Open Laboratory of Applied Microbiology, State Key Laboratory of Applied Microbiology South China, Guangdong Institute of Microbiology, Guangzhou 510070, China 2Department of Biology, Chengdu Normal University, Chengdu 611130, China

... introns of sequence analyses were predicted by web-based program FGENESH [37-39] (http://linux1.softberry.com/berry.phtml) Page 6. ... function proteins based on BLAST prediction and open reading frame (ORF) analysis by web-based SoftBerry (Supplementary files 2). ...


Gene
Volume 546, Issue 2, 10 August 2014, Pages 250–256 DOI: 10.1016/j.gene.2014.06.001

Nucleotide diversity of Pita, a major blast resistance gene and identification of its minimal promoter.

Ramkumar G. et al.,
a Biotechnology, Crop Improvement, DRR-ICAR, Hyderabad-30, India b Plant Pathology, DRR-ICAR, Hyderabad-30, India

... other default settings. Gene structure (length of open reading frame (ORF), number of exons/introns, etc.) and protein sequences were predicted using online tool softberry — FGENESH (http://linux1.softberry.com). Number of ...


Fungal biology
2014, 118(5), 453-461. DOI: 10.1016/j.funbio.2014.03.003

Molecular cloning and functional analysis of a H< sup>+-dependent phosphate transporter gene from the ectomycorrhizal fungus Boletus edulis in southwest China

Wang J. et al.,
Laboratory of Conservation and Utilization for Bioresources, Key Laboratory of Microbial Diversity in Southwest China, Ministry of Education, Yunnan University, Kunming, Yunnan Province, PR China

... Bioinformatic analysis. The open reading frame (ORF) was predicted using the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi) and the SoftBerry-FGENESH database (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...


Crop Science
2014, 54(3), 873-881. DOI: 10.2135/cropsci2013.09.0598

Fine Mapping of the Maize Cross-Incompatibility Locus Gametophytic Factor 1 (ga1) Using a Homogeneous Population.

Liu, X et al.,
2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia 1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA

... The maize gene set (www.maizesequence.org) and website-based software FGENSH (www.softberry.com) was applied to predict and filter the putative genes from the mapping interval. RESULTS. The Homogeneous Population Mapping Approach for Ga1-S Allele. ...


Applied microbiology and biotechnology
2014, 98(1), 285-296. DOI: 10.1007/s00253-013-5289-8

MpigE, a gene involved in pigment biosynthesis in Monascus ruber M7

Liu Q et al.,
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China 3. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China

... Amino acid sequence encoded by MpigE was predicted using SoftBerry's FGENESH program (http://linux1.softberry. com/berry.phtml), and the MpigE functional regions were analyzed using the Pfam 27.0 program (http://pfam.sanger.ac. uk/). ...


Gene
2014 DOI: 10.1016/j.gene.2014.01.008

The homoeologous genes encoding chalcone-flavanone isomerase in Triticum aestivum L.: structural characterization and expression in different parts of wheat plant

Shoeva, O. Y., Khlestkina, E. K., Berges, H., & Salina, E. A.
a Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia b Novosibirsk State University, 630090, Russia c INRA-CNRGV, Toulouse, 31326, France

... Gene annotation was performed by FGENESH program (Softberry Inc., linux1.softberry.com/berry.phtml) and confirmed by comparison of genomic nucleotide sequence with available ESTs. MEGA v5.1 software (Tamura et al. ...


Applied microbiology and biotechnology
2014,Volume 98, Issue 11, pp 4987-4994. DOI: 10.1007/s00253-014-5509-x

A promiscuous prenyltransferase from Aspergillus oryzae catalyses C-prenylations of hydroxynaphthalenes in the presence of different prenyl donors

Pockrandt, D., Sack, C., Kosiol, T., & Li, S. M.
1. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany

... Computer-assisted sequence analysis The software FGENESH (Softberry, Inc; http://www. softberry.com/berry.phtml) was used for prediction of exon and intron sequences. Alignments of amino acid sequences were carried out by using the program BLAST (http://blast. ...


Marine genomics
2014, 13, 1-9. DOI: 10.1016/j.margen.2013.10.004

Presence of two tumor necrosis factor ( tnf)-? homologs on different chromosomes of zebrafish ( Danio rerio) and medaka ( Oryzias latipes)

Kinoshita, S., Biswas, G., Kono, T., Hikima, J., Sakai, M.
a Faculty of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan b Interdisciplinary Graduate School of Agriculture and Engineering, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan c Interdisciplinary Research Organization, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan

... For medaka tnf-n, the nucleic acid sequence was retrieved from medaka chromosome 16 (25694643-25698981) (Ensembl release 72) and amino acid (aa) sequence, exons and introns were predicted using FGENESH in SoftBerry (http://linux1.softberry.com/berry.phtml). ...


Physiologia plantarum
, 150(1), 32-45. DOI: 10.1111/ppl.12064

Transcriptional regulation of the V?ATPase subunit c and V?PPase isoforms in Cucumis sativus under heavy metal stress

Kabala K. et al.,
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland

... cucumber sequences were then analyzed using gene finding programs identifying full-length cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/ eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...


Journal of basic microbiology
28 APR 2014 DOI: 10.1002/jobm.201300814

Fan, L., Fu, K., Yu, C., Li, Y., Li, Y., & Chen, J. (2014). Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia lunata

Fan L. et al.,
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China

... After predicting online on the softberry website (http://linux1.softberry.com/berry.phtml? topic=fgenesh&group=programs&subgroup=gfind) and using PCR for confirmation, we cloned a 710 bp cDNA fragment containing the T-DNA insertion site. ...


Plant Molecular Biology Reporter
2014, 1-21 DOI: 10.1007/s11105-014-0729-x

A Gene Encoding Cold-Circadian Rhythm-RNA Binding-Like Protein (CCR-Like) from Upland Cotton (Gossypium hirsutum L.) Confers Tolerance to Abiotic Stresses in Transgenic Tobacco

Dhandapani G. et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India 2. Department of Plant Science, Bharathidasan University, Tiruchirappalli, Tamil Nadu, India

... The amplified cDNA was cloned in pGEM T-Easy vector and sequenced. The full- length cDNA sequence and coding sequence (CDS) were identified by the FGENESH analysis of softberry software (www.softberry.com/) and the sequence has been submitted to the GenBank. ...


Journal of experimental botany
2014, eru041. DOI: 10.1093/jxb/eru041

Sixteen cytosolic glutamine synthetase genes identified in the Brassica napus L. genome are differentially regulated depending on nitrogen regimes and leaf senescence.

Orsel M. et al.,
1 INRA, UMR 1349 Institut de Genetique, Environnement et Protection des Plantes, INRA, Agrocampus Ouest, Universite de Rennes 1, F-35653 Le Rheu, France 2 INRA, UMR 1345 Institut de Recherche en Horticulture et Semences, F-49071 Beaucouze, France

...The deduced mRNA sequences (Supplementary Data File S5), obtained using FGENESH software available on the SoftBerry website (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group =programs&subgroup=gfind), showed very a high similarity with the contig sequences (Table 4) and allowed the gene structures to be deduced (Fig. 2). ...


Mycobiology
2014, 42(1), 34-40. DOI:10.5941/MYCO.2014.42.1.34

Three New Non-reducing Polyketide Synthase Genes from the Lichen-Forming Fungus Usnea longissima

Wang, Y., Wang, J., Cheong, Y. H., Hur, J. S.
1 Laboratory of Forest Plant Cultivation and Utilization, Yunnan Academy of Forestry, Kunming 650-204, China. 2 Korean Lichen Research Institute, Sunchon National University, Suncheon 540-742, Korea.

... Ltd. (Seoul, Korea). The potential open reading frame (ORF) was scanned with FGENESH [22] using Aspergillus as the matrix (http://linux1.softberry.com). The putative function of these ORFs was determined using a basic local alignment search tool (BLAST). ...


Molecular Breeding
2014, 33(4), 953-959. DOI:10.1007/s11032-013-0009-8

Intron loss in the chalcone-flavanone isomerase gene of rye

Khlestkina E. K., Shoeva O. Y.
1. Institute of Cytology and Genetics SB RAS, Lavrentjeva Ave. 10, 630090, Novosibirsk, Russia 2. Novosibirsk State University, Novosibirsk, Russia

... Gene structure was determined by FGENESH software (http://?linux1.?softberry.?com/?berry.? phtml, Solovyev 2007 ) and confirmed by comparison of nucleotide sequence with the rye expressed sequence tag BE705313 (http://?www.?ncbi.?nlm.?nih.?gov/?Database/?). ...


Food chemistry
2014, 148, 381-387 DOI: 10.1016/j.foodchem.2013.10.062

Two xylose-tolerant GH43 bifunctional ?-xylosidase/?-arabinosidases and one GH11 xylanase from Humicola insolens and their synergy in the degradation of xylan

Yang X. et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China b Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... deduce the amino acid sequences, respectively. The online software FGENESH (http://linux1.softberry.com/berry.phtml) was used to predict the transcription initiation sites, introns and exons. SignalP4.0 server (http://www.cbs ...


Acta Biochimica Polonica
2014, 61(1), 19-22. on-line at: www.actabp.p

Conversion of a diversity arrays technology marker differentiating wild and cultivated carrots to a co-dominant cleaved amplified polymorphic site marker

Macko-Podgorni A. et al.,
1 Institute of Plant Biology and Biotechnology, University of Agriculture Krakow, Krakow, Poland; 2 Department of Horticulture, University of Wisconsin-Madison, Madison, USA; 3 USDA-Agricultural Research Service, Vegetable Crops Research Unit, University of Wisconsin, Madison, USA

... reported by Iorizzo et al. (2012) with blastn on a local BLAST server. The identified con- tig was searched for presence of coding regions using FGENESH (http://linux1.softberry.com/berry.phtml). The sequence was searched for ...


Molecular biology reports
July 2014, Volume 41, Issue 7, pp 4305-4312 DOI:10.1007/s11033-014-3301-8

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.)

Patade V. Y. et al.,
1. Defence Institute of Bio-Energy Research, Haldwani-263 139, Nainital, Uttarakhand, India

... commercially (Eurofins, India). The sequence was analyzed for homology using Blast program [ 22 ]. The gene structure was predicted using FGENESH 2.6 tool (http://?linux1.?softberry.?com/?berry.?phtml). The Motif scanning ...


Nature
2014, 511(7508), E7-E9. DOI:10.1038/nature13446

TH2 and Treg candidate genes in elephant shark

Dijkstra, J. M.
Institute for Comprehensive Medical Science, Fujita Health University, Dengaku-gakubo 1-98, 470-1192 Toyoake, Aichi, Japan

... 2, the loop between ?-helices A and B; exon 3, ?-helices B and C; exon 4, ?-helix D. Genes without messenger RNA reports were predicted from genomic DNA sequences using GENSCAN (http://genes.mit.edu/GENSCAN.html) or FGENESH (http://linux1.softberry.com/berry ...


Plant Breeding
Volume 133, Issue 4, pages 470–479, August 2014 DOI:10.1111/pbr.12190

Genetic and functional analysis of tocopherol biosynthesis pathway genes from rapeseed (Brassica napus L.)

Fritsche S. et al.,
1 Plant Breeding Institute, Christian-Albrechts University of Kiel, Kiel, Germany 2 National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, China

... Institute 2012). Sequence comparisons were performed with the basic local alignment search tool (BLAST). Intron–exon structures were predicted with the bioinformatic tool FGENESH (SoftBerry FGENESH 2007). The NCBI ...


Plant molecular biology
2014, 84(1-2), 95-110 DOI:10.1007/s11103-013-0121-5

Association of jacalin-related lectins with wheat responses to stresses revealed by transcriptional profiling

Song M. et al.,
1. Crop Genomics and Bioinformatics Center and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, People’s Republic of China 2. Guizhou Rapeseed Institute, Guizhou Academy of Agricultural Sciences, 270-0061, Baiyun Road, Guiyang, 550008, People’s Republic of China

... overlapped regions. Gene prediction was then performed using the gene-finding program FGENESH (http://?www.?softberry.?com/?), and the coding DNA sequences were verified by alignment with the homologous ESTs. Domain ...


DNA Research
2014, dsu016 DOI:10.1093/dnares/dsu016

Evolutionary History of Trihelix Family and Their Functional Diversification

Qin Y. et al.,
1 State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, 61 Daizong Street, Tai'an, Shandong 271018, People's Republic of China 2 Division of Biotechnology, College of Life Sciences and Biotechnology, Korea University, Seoul 136-713, Republic of Korea

... a cut-off value of e ?10 . As for confirmation of the predicted genes, manual correction was performed using the online web server FGENESH (http://linux1.softberry.com/ berry.phtml). 28 The confirmed sequences were further ...


Gene
2014, 544(1), 83-92 DOI:10.1016/j.gene.2014.04.046

Genome-wide analysis of terpene synthases in soybean: functional characterization of GmTPS3

Liu J. et al.,
a National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Weigang 1, Nanjing 210095, China b Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, National Engineering Research Center of Edible Fungi, Shanghai 201403, China

... soybean genome sequence assembly using TBLASTN. The gene prediction program FGENESH (http://www.softberry.com) was used to predict the open reading frames of putative TPS genes. Protein sequences deduced from the ...


Frontiers in Plant Science | Plant Genetics and Genomics
2014, 5, 339. DOI:10.3389/fpls.2014.00339

Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris)

Jackson, S.
1 Center forAppliedGeneticTechnologies,UniversityofGeorgia,Athens,GA,USA 2 US DepartmentofEnergyJointGenomeInstitute,WalnutCreek,CA,USA

... carry an extra ORF coding envelope-like proteins, the internal regions of 65 Ty1-copia and 78 Ty3-gypsy families were annotated using FGENESH (http://linux1.softberry.com) and ... (http://linux1.softberry.com) and GENSCAN (http://genes.mit.edu/GENSCAN.html) programs. ...


Plant Molecular Biology Reporter
2014, 32(2), 476-486. DOI: 10.1007/s11105-013-0666-0

Molecular Cloning and Characterization of a Novel Polygalacturonase Gene, BcMF24, Involved in Pollen Development of Brassica campestris ssp. chinensis

Yu Y. et al.,
1. Laboratory of Cell and Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China

... Full CDS sequences were analyzed by FGENESH (http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind), and the molecular characteristic of the deduced protein was viewed on the ExPASy (http://web.expasy.org/compute_pi/). ...


Middle-East Journal of Scientific Research
2014, 20(3), 391-395. DOI:10.5829/idosi.mejsr.2014.20.03.11465

An Integrated Approach to Functional Genomics: Construction of a Novel Reporter Genomic Library for Osmium baselicum Plant.

Shah, G. C., Gupta, V., Khanuja, S. P. S.
1 Rajiv Gandhi College Satna M.P. India 2 Entral Institute of Medicinal and Aromatic Plant Lucknow U.P. India

... a new family, the oxidatively stable proteases previously p a r a m e t e r s thought to be present only in bacteria. Phylogenetic http:linux1.softberry.coberry.phtml?topic=fgenesh&grp= studies showed that many gene duplications and loss ograms&sub group=gfind. ...


Applied microbiology and biotechnology
2014, 98(11), 5019-5028. DOI:10.1007/s00253-014-5533-x

A novel bifunctional pectinase from Penicillium oxalicum SX6 with separate pectin methylesterase and polygalacturonase catalytic domains

Tu T. et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China

... as Lu and Moriyama (2004) described. Transcription initiation sites, intron, and exon were predicted using the online software FGENESH (http://linux1.softberry. com/berry.phtml/). Nucleotide and deduced amino acid sequence ...


Journal of industrial microbiology & biotechnology
2014, 41 (7), 1071-1083. DOI:10.1007/s10295-014-1453-0

A new acidophilic endo-b-1, 4-xylanase from Penicillium oxalicum: cloning, purification, and insights into the influence of metal ions on xylanase activity

Liao H. et al.,
1. Jiangsu Provincial Key Lab for Organic Solid Waste Utilization, Nanjing Agricultural University, Nanjing, 210095, China 2. Institute of Bast Fiber Crops and Center of Southern Economic Crops, Chinese Academy of Agricultural Sciences, Changsha, China

... Putative signal peptides were predicted using signalP (http://www.cbs.dtu.dk/services/ signalP/). The exon–intron structure of the full-length gene was predicted using the online software fgenesh (http://linux1.softberry.com/ berry.phtml). ...


Crop and Pasture Science
2014, 65(1), 38-45. DOI:10.1071/CP13140

Isolation and characterisation of cytosolic glutamine synthetase (GSe) genes and association with grain protein content in durum wheat

Gadaleta, A. et al.,
A Department of Soil, Plant and Food Sciences, Section of Genetics and Plant Breeding, University of Bari ‘Aldo Moro’, Via G. Amendola 165/A – 70126 Bari, Italy.

... Genes prediction was conducted with the FGENESH program (http://linux1.softberry.com/berry. phtml?topic=fgenes handgroup=programsandsubgroup=gfind). Consensus exon/ introns boundaries were confirmed using grass expressed sequence tag sequences aligned to the ...


ChemBioChem
2014, 15(1), 108-116. DOI:10.1002/cbic.201300610

AstPT Catalyses both Reverse N1?and Regular C2 Prenylation of a Methylated Bisindolyl Benzoquinone

Tarcz S. et al.,
Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie und Biotechnologie, Deutschhausstrasse 17A, 35037 Marburg (Germany)

... Computer-assisted sequence analysis: The software packages DNASIS (version 2.1; Hitachi Software Engineering, San Bruno, CA, USA) and FGENESH (Softberry, Inc; http://www.softberry. com/berry.phtml) were used for intron prediction and sequence analysis, respectively. ...


Molecular biology reports
2014, 1-12. DOI:10.1007/s11033-014-3360-x

GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.)

Cai C. et al.,
1. State Key Laboratory of Crop Genetics & Germplasm Enhancement, Hybrid Cotton R & D Engineering Research Center, Ministry of Education, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China

... Gene prediction was performed using the Fgenesh program in MolQuest software v1.3.1 (http://?linux1.?softberry.?com/?berry.?phtml), and predicted genes and their GO (Gene Ontology) categories were annotated with the Blast2GO program ([ 18 ], http://?www.?blast2go ...


PloS one
2014, 9(1), e87723. DOI:10.1371/journal.pone.0087723

Citrus sinensis Annotation Project (CAP): A Comprehensive Database for Sweet Orange Genome

Wang, J. et al.,
Center for Bioinformatics, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China, School of Science, Huazhong Agricultural University, Wuhan, P.R. China

... 8, detailed information includes the final gene model, RNA-seq and RNA-PET data from different tissues, ESTs from sweet orange and other citrus species, and four ab initio gene prediction tools, ie, Genscan [17], GeneID [18], FgeneSH (http://linux1.softberry.com/berry.phtml ...


Genome biology and evolution
2014, evu112 DOI: 10.1093/gbe/evu112

Recurrent horizontal transfers of Chapaev transposons in diverse invertebrate and vertebrate animals

Zhang, H. H., Feschotte, C., Han, M. J., Zhang, Z.
1School of Life Sciences, Chongqing University, Chongqing 400044, China 2 College of Life Sciences, Jiujiang University, Jiujiang 332000, China

... Sequence analysis Potential open reading frame (ORF) of Chapaev elements used in this study was predicted using FGENESH (http://linux1.softberry.com/berry.phtml), GENSCAN (http://genes.mit.edu/GENSCAN.html) or getorf in EMBOSS-6.3.1 package (Rice et al. 2000) ...


Molecular Genetics and Genomics
April 2014. DOI:10.1007/s00438-014-0848-y

High-resolution genetic mapping of rice bacterial blight resistance gene Xa23

Wang C. et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI) Institute of Crop Science, Chinese Academy of Agriculture Sciences (CAAS), Beijing, 100081, People’s Republic of China 2. Liaocheng University, Liaocheng, 252059, Shandong Province, People’s Republic of China

... Based on the targeted region of Xa23 locus, genomic sequence of nipponbare between the markers lj138 and a83B4 was downloaded from nCBI (http://www.ncb i.nlm.nih.gov) and analyzed using the online software FGeneSH (http://linux1.softberry.com/). ...


FGENESH 2013

Applied Microbiology and Biotechnology
October 2013 DOI: 10.1007/s00253-013-5289-8

MpigE, a gene involved in pigment biosynthesis in Monascus ruber M7

Liu, et al.,
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China 3. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China

... Amino acid sequence encoded by MpigE was predicted using SoftBerry's FGENESH program (http://linux1.softberry. com/berry.phtml), and the MpigE functional regions were analyzed using the Pfam 27.0 program (http://pfam.sanger.ac. uk/). ...


New Phytologist
200: 820–833. doi: 10.1111/nph.12396

Plant Defensin type 1 (PDF1): protein promiscuity and expression variation within the Arabidopsis genus shed light on zinc tolerance acquisition in Arabidopsis halleri.

Shahzad et al.,
1Biochimie et Physiologie Moleculaire des Plantes, Unite Mixte de Recherche Montpellier, SupAgro/CNRS/INRA/Universite Montpellier II, Montpellier Cedex 1, France 2Montpellier SupAgro, UMR AGAP, Montpellier, France

... Genes were predicted using the FGENESH program (Salamov & Solovyev, 2000) under the SOFTBERRY software (www.softberry.com) and were annotated based on BLAST similarity searches (Altschul et al., 1990). The presence ...


Cell Stress and Chaperones
Volume 18, Issue 3 , pp 321-331 DOI:10.1007/s12192-012-0384-9

Functional relevance of J-protein family of rice (Oryza sativa)

Neelam K Sarkar, Upasna Thapar, Preeti Kundnani, Priyankar Panwar, Anil Grover
1. Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, 110021, India

... FGENESH analysis of genomic sequence of Os03g12236 at softberry (www.softberry. com/) revealed presence of one gene having 10 exons coding for 462 amino acid protein. The amino acid sequence deduced from softberry ...


Phytopathology
November 2013, Volume 103, Number 11 Pages 1162-1168 http://dx.doi.org/10.1094/PHYTO-02-13-0044-R

Fine Mapping and Identification of Blast Resistance Gene Pi-hk1 in a Broad-Spectrum Resistant japonica Rice Landrace

Wu et al.,
State Key Laboratory of Crop Genetics & Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China. Y. Wu and Y. Bao contributed equally to this work.

... (http://genes.mit.edu/GENSCAN.html) and softberry (http://linux1.softberry.com/berry.phtml). The predicted introns about 200-500bp were ... Page 7 of 28 Page 8. 8 FGENESH (http://linux1. softberry.com/) and RiceGAAS (http://rgp.dna.affrc.go.jp) software (32). ...


Biotechnology Letters
Volume 35, Issue 9 , pp 1425-1432 DOI:10.1007/s10529-013-1219-1

Deletion of pigR gene in Monascus ruber leads to loss of pigment production

Nana Xie, Qingpei Liu, Fusheng Chen
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei, China 2. State Key Laboratory of Agricultural Microbiology, Wuhan, 430070, Hubei, China

... agitation. Three replicates of each sample were carried out. Sequence analysis. Amino acid sequence encoded by pigR was predicted using the SoftBerry's FGENESH program (http://linux1.softberry.com/berry.phtml). Homology ...


Heredity
(2013) 111, 57–65; doi:10.1038/hdy.2013.19; published online 3 April 2013

The discovery of Foxl2 paralogs in chondrichthyan, coelacanth and tetrapod genomes reveals an ancient duplication in vertebrates

M T Geraldo 1, G T Valente 1, A SK Braz 2 and C Martins 1
1Integrative Genomics Laboratory, Department of Morphology, Institute of Biosciences, Sao Paulo State University–UNESP, Botucatu, Sao Paulo, Brazil 2Laboratory of Computational Biology and Bioinformatics, Center of Natural and Human Sciences, Federal University of ABC–UFABC, Santo Andre, Sao Paulo, Brazil

... The sequences acquired were inserted into the online program Softberry FGENESH (http://www.softberry.com/) using T. rubripes as the reference genome to recover the whole gene transcriptional region and confirm the identification of genes in these syntenic regions ...


Microbiological Research
Volume 168, Issue 6, 19 July 2013, Pages 340–350 DOI: 10.1016/j.micres.2013.01.005

Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis

Cai et al.,
a Environment and Plant Protection College, Hainan University, Danzhou, Hainan 571737, China b Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences (CATAS), Danzhou, Hainan 571737, China

... Sixteen T-DNA integration sites of transformants impaired in pathogenicity were identified, and in most cases T-DNA integrated into a predicted ORF of putative genes based on gene structure prediction by FGENESH program (Softberry Inc., Mount Kisco, NY, USA, http://linux1 ...


Cell Biology International
(2013) 37: 687–693. doi: 10.1002/cbin.10080

Computational prediction and characterisation of ubiquitously expressed new splice variant of Prkaca gene in mouse.

Banday, A. R., Azim, S., Hussain, M. A., Nehar, S. and Tabish, M.
1Faculty of Life Sciences, Department of Biochemistry, A.M. University, Aligarh, Uttar Pradesh, India 2P.G. Department of Zoology, Ranchi University, Ranchi, Jharkhand, India

.. were used at HMM gene (http://www.cbs.dtu.dk/services/HMMgene) (Lukashin and Borodovsky, 1998), Genescan (http://genes.mit.edu/GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/ software/GeneSplicer/) (Pertea et al., 2001), FGENESH (http://www.softberry.com/berry ...


Nucl. Acids Res.
(1 January 2013) 41 (D1): D1192-D1198. doi: 10.1093/nar/gks1090

OrysPSSP: a comparative Platform for Small Secreted Proteins from rice and other plants

Pan et al.,
Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, 2Shanghai Center for Bioinformation Technology, Shanghai 200235 and 3Tarim University, Alar, Xinjiang 843300, China

... Constructing the starting dataset of small peptides (25–250 aa in length) by combining data from whole-genome screening and from gene modeling using Augustus (v2.5.5) and FGENESH (Softberry, http://www.softberry.com) (34). ...


Trends in Bioinformatics
2013, Vol. 6 Issue 3, p62-90. 29p.

In-silico Study of Transcription Factor Binding Elements of Human PAX Gene Family Members

Rashmi et al.,

... For study of cis-acting elements-4000 upstream regions were retrieved using NCBI. Cis-acting elements analysis were done using fgenesh tool of softberry server (http://linuX1 .softberry.com/berry.phtml; Solovyev and Salamov, 1997). ...


Genes & Genomics
Volume 35, Issue 2 , pp 159-166 DOI:10.1007/s13258-013-0075-7

Nucleotide diversity of the upstream region of the putative MADS-box gene controlling soybean maturity

Jungmin Ha, Puji Lestari, Suk-Ha Lee
1. Department of Plant Science and Research Institute for Agriculture and Life Science, Seoul National University, Seoul, 151-921, Korea 2. Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development, Jl. Tentara Pelajar No. 3A, Bogor, 16111, Indonesia

... BLAST algorithm. Any putative genes were also investigated with the FGENESH software (http://linux1.softberry.com/berry.phtml) using the dicot plant option (Arabidopsis). Primer design and PCR amplification. To amplify the ...


Physiologia Plantarum
Volume 150, Issue 1, pages 32–45, January 2014 DOI:10.1111/ppl.12064

Transcriptional regulation of the V-ATPase subunit c and V-PPase isoforms in Cucumis sativus under heavy metal stress

Katarzyna Kabala*, Malgorzata Janicka-Russak, Malgorzata Reda, Magdalena Migocka
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland

.. cucumber sequences were then analyzed using gene finding programs identifying full-length cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/ eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...


Russian Journal of Plant Physiology
Volume 60, Issue 5 , pp 713-719 DOI:10.1134/S102144371305004X

Cloning and characterization of ethylene-insensitive 2 (EIN2) gene from Cucumis melo

F. Gao, J. Hao, Y. Yao, X. Wang, A. Hasi
1. College of Life Sciences, Inner Mongolia University, Hohhot, 010021, P.R. China 2. Inner Mongolia Key Laboratory of Herbage and Endemic Crop Biotechnology, Hohhot, 010021, P.R. China

... tigs that contain the genomic DNA sequence of the putative CsEIN2. (3) The gene prediction program Softberry of FGENESH (http://linux1.soft berry.com/berry.phtml) was used to predict multiple (alternative splice) variants of potential CsEIN2 genes in the cucumber genome ...


European Journal of Plant Pathology
Volume 137, Issue 1 , pp 55-65 DOI:10.1007/s10658-013-0216-5

Mining of rice blast resistance gene Pi54 shows effect of single nucleotide polymorphisms on phenotypic expression of the alleles

Kumari et al.,
1. National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, Room No 39, LBS Centre, Pusa Campus, New Delhi, 110012, India 2. Division of Crop Improvement, Indian Institute of Pulses Research, Kanpur, 208 024, Uttar Pradesh, India

... Eur J Plant Pathol Page 3. using Primer 3 software (www.softberry.com). The ... Eur J Plant Pathol Page 4. performed to predict gene structure and ORF region using FGENESH software trained for monocot (www.softberry.com). The ...


Phil. Trans. R. Soc. B
19 September 2013 vol. 368 no. 1626 20130047 DOI:10.1098/rstb.2013.0047

Functional endogenous viral elements in the genome of the parasitoid wasp Cotesia congregata: insights into the evolutionary dynamics of bracoviruses

Bezier et al.,
1Institut de Recherche sur la Biologie de l'Insecte, CNRS UMR 7261, Universite Francois Rabelais, Parc de Grandmont, 37200 Tours, France 2Commissariat a l'Energie Atomique, Genoscope (Centre National de Sequencage), 2 rue Gaston Cremieux, CP 5706, 91057 Evry Cedex, France

... For both Cotesia spp., gene predictions were performed using a combination of FGENESH and FGENESH+ software from the SoftBerry platform with the Apis mellifera training set (http://linux1.softberry.com/all.htm) and from the EMBL-EBI platform using Wise2 algorithms (http ...


Theoretical and Applied Genetics
Volume 126, Issue 1 , pp 219-229 DOI:10.1007/s00122-012-1975-7

Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.)

Huang et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Science and Technology, Agricultural College, Guangxi University, Nanning, 530005, China 2. Rice Research Institute, Plant Protection Institute and Guangxi Rice Genetic Improvement and Biotechnology Lab, Guangxi Academy of Agricultural Sciences, Nanning, 530007, China

... The putative open reading frame (ORF) in the target region was predicted by the online software GENESCAN and FGENESH of Softberry (www.softberry.com/berry.phtml) with monocot plants as the model organism. Host selection behavior ...


Microbiology
October 2013 vol. 159 no. Pt 10 2169-2179 DOI:10.1099/mic.0.069542-0

CdpC2PT, a reverse prenyltransferase from Neosartorya fischeri with a distinct substrate preference from known C2-prenyltransferases

Kathrin Mundt 1,2 and Shu-Ming Li 1,2
1Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037 Marburg, Germany 2Zentrum fur Synthetische Mikrobiologie, Philipps-Universitat Marburg, 35032 Marburg, Germany

... al., 1988). Computer-assisted sequence analysis. For intron prediction and sequence analysis, fgenesh (http://linux1.softberry.com) and dnasis (v. 2.1; Hitachi Software Engineering) were used, respectively. Sequence identities ...


Molecular Genetics and Genomics
Volume 288, Issue 3-4 , pp 111-129 DOI:10.1007/s00438-013-0733-0

Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato

Zejun Huang, Jason Van Houten, Geoffrey Gonzalez, Han Xiao, Esther van der Knaap
1. Department of Horticulture and Crop Science, The Ohio State University/OARDC, 217A Williams Hall, 1680 Madison Avenue, Wooster, OH, 44691, USA

... solgenomics.net). We identified nine genes that were not in database ITAG Release 2.3 but appear to have protein coding potential based on annotation by FGENESH (http://linux1.softberry.com/berry.phtml). Initial evidence ...


Euphytica
December 2013 DOI:10.1007/s10681-013-1037-5

Fine mapping of the uniform immature fruit color gene u in cucumber (Cucumis sativus L.)

Yang et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, Dongchuan Road, Minhang District, Shanghai, 200240, China 2. Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, Chenshan Botanical Garden, Shanghai, 201602, China

... (Voorrips 2002 ). Gene prediction in the target genomic DNA regions was performed using the program FGENESH (Salamov and Solovyev 2000 ) (http://linux1.softberry. com/), and the results were checked manually. Results. ...


Plant and Soil
Volume 364, Issue 1-2 , pp 245-260 DOI:10.1007/s11104-012-1345-x

The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber

M. Migocka, A. Warzybok, G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland

... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was determined using FGENESH or FGENESH+ programs available on softberry.com ...


Tree Genetics & Genomes
November 2013 DOI:10.1007/s11295-013-0678-9

Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

Schouten et al.,
1. Plant Breeding, Wageningen University and Research Centre, P.O. Box 386, 6700 AJ, Wageningen, The Netherlands 2. Inova Fruit, P.O. Box 222, 4190 CE, Geldermalsen, The Netherlands 3. Plant Pathology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatstrasse 2, 8092, Zurich, Switzerland

... 2010b) was copied from the NCBI database (accession number GU295057.1). The Vr2-A, Vr2-B, and Vr2-C amino acid sequences in GMAL 2473 were predicted by means of the publicly available software FGENESH from SoftBerry. ...


Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 941-949 DOI:10.1007/s12010-012-0048-3

Molecular Cloning and Expression of a Novel b-Glucosidase Gene from Phialophora sp. G5

Xuejun Li et al.,
1. Key Laboratory of Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China 2. Beijing Challenge Bio-Technology Co., Ltd., Beijing, 100081, People’s Republic of China

... designed on the assembled sequence. Sequence Analysis The introns, exons, and transcription initiation sites were analyzed by FGENESH (http:// www.softberry.com/ berry.phtml/). Amino acid and nucleotide sequence alignments ...


Immunogenetics
Volume 65, Issue 7 , pp 531-541 DOI:10.1007/s00251-013-0692-y

IgH loci of American alligator and saltwater crocodile shed light on IgA evolution

Susana Magadan-Mompo, Christian Sanchez-Espinel, Francisco Gambon-Deza
1. Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo, 36210, Pontevedra, Spain 3. Oceanographic Center of Vigo, Spanish Institute of Oceanography (IEO), Subida a Radio Faro 50, 36390, Vigo, Pontevedra, Spain

... Exons coding for the CH immunoglobulin domains were identified by aligning genomic and predicted amino acid sequences with previously published reptile immunoglobu- lin sequences. Limits were deduced using the FGENESH (www.softberry.com) (Solovyev et al. ...


Applied Microbiology and Biotechnology
Volume 97, Issue 4 , pp 1649-1660 DOI:10.1007/s00253-012-4130-0

Identification of a brevianamide F reverse prenyltransferase BrePT from Aspergillus versicolor with a broad substrate specificity towards tryptophan-containing cyclic dipeptides

Suqin Yin, Xia Yu, Qing Wang, Xiao-Qing Liu, Shu-Ming Li
1. College of Life Sciences, Capital Normal University, No.105 Xisanhuan Beilu, Beijing, 100048, China 2. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany

... Computer-assisted sequence analysis FGENESH (Softberry, Inc.) and the DNASIS software pack- age (version 2.1: Hitachi Software Engineering, San Bruno, CA) were used for intron prediction and sequence analysis, respectively. ...


PloS one
July 09, 2013DOI: 10.1371/journal.pone.0068260

A Superfamily of DNA Transposons Targeting Multicopy Small RNA Genes

Kenji K. Kojima, Jerzy Jurka
Genetic Information Research Institute, Mountain View, California, United States of America

... copies. Exon-intron boundaries were predicted with the aid of SoftBerry FGENESH: (http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup= gf?ind) and GENEID (http://genome.crg.es/geneid.html). ...


International Journal of Genomics and Proteomics
Volume 4, Issue 1, 2013, pp.-64-71 Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=BPJ0000227

MOLECULAR MODELING OF ?-AMYLASE FROM GERMINATED SOYBEAN (Glycine max) AND ITS FUNCTIONAL DIVERSITY

KUMARI A. 1, SINGH V.K. 2 AND KAYASTHA A.M. 1
1School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi-221 005, UP, India. 2Centre for Bioinformatics, School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi-221 005, UP, India.

... It showed similarity with Glycine max strain Wil- liams 82 clone GM_WBb0115J10 (AC235387.1). Full length gene prediction was done for obtained strain using Fgenesh (http:// sun1.softberry.com/berry.phtml) and -1000 upstream region was retrieved for promoter study ...


Food Chemistry
Volume 141, Issue 3, 1 December 2013, Pages 2974–2981 DOI:10.1016/j.foodchem.2013.05.132

High-yield production of a low-temperature-active polygalacturonase for papaya juice clarification

Tao Tu et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China b Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... Multiple alignments of protein sequences were performed using the ClustalW program (http://www.ebi.ac.uk/clustalW/). Transcription initiation sites, intron, and exon were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml/). ...


Immunogenetics
Volume 65, Issue 5 , pp 387-396 DOI:10.1007/s00251-013-0678-9

Immunoglobulin light chains in medaka (Oryzias latipes)

Susana Magadan-Mompo, Anastasia M. Zimmerman, Christian Sanchez-Espinel, Francisco Gambon-Deza
1. Virologie et Immunologie Moleculaires, Institut National de la Recherche Agronomique (INRA), Domaine de Vilvert, 78352, Jouy-en-Josas, France 2. Department of Biology, College of Charleston, 66 George Street, Charleston, SC, 29424, USA

... 2009; Zimmerman et al. 2008; Bao et al. 2010). Boundaries of exons were deduced using the software packages FGENESH (www.softberry.com) (Solovyev et al. 2006) and Augustus (http://augustus.gobics.de/submission) (Stanke et al. ...


Mol Biol Rep.
2013 Mar;40(3):2645-62. doi: 10.1007/s11033-012-2351-z. Epub 2012 Dec 15.

Genome-wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa).

Genome-wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa). et al.,
CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, People's Republic of China.

... Local blast was performed using Arabid- opsis CDPK and its closely related kinase proteins as queries for the identification of genes from Populus. Manual reanno- tation was also performed using online web server FGENESH (http://linux1.softberry.com/berry.phtml). ...


Process Biochemistry
Volume 48, Issue 12, December 2013, Pages 1879–1885 DOI:10.1016/j.procbio.2013.08.020

A novel thermophilic xylanase from Achaetomium sp. Xz-8 with high catalytic efficiency and application potentials in the brewing and other industries

Zhao et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China b College of Life Science, Capital Normal University, Beijing 100048, PR China

... Genes, introns, exons and transcription initiation site were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted using SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/). ...


Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0666-0

Molecular Cloning and Characterization of a Novel Polygalacturonase Gene, BcMF24, Involved in Pollen Development of Brassica campestris ssp. chinensis

Youjian Yu, Meiling Lv, Ying Liang, Xingpeng Xiong, Jiashu Cao
1. Laboratory of Cell and Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China

... Full CDS sequences were analyzed by FGENESH (http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind), and the molecular characteristic of the deduced protein was viewed on the ExPASy (http://web.expasy.org/compute_pi/). ...


J. Agric. Food Chem.,
2013, 61 (28), pp 6880–6889DOI: 10.1021/jf4001296

Two Family 11 Xylanases from Achaetomium sp. Xz-8 with High Catalytic Efficiency and Application Potentials in the Brewing Industry

Zhao et al.,
† Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China ‡ College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China

... Genes, introns, exons, and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted using SignalP 4.0 Server (http://www.cbs.dtu.dk/services/SignalP/). ...


Applied Microbiology and Biotechnology
Volume 97, Issue 18 , pp 8121-8128 DOI:10.1007/s00253-012-4656-1

A family 5 b-mannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features

Lu et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No.12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China 2. College of Biotechnology, Tianjin University of Science and Technology, Tianjin, 3000457, People’s Republic of China

... nih.gov/gorf/gorf/gorf.html). The sequence assembly was per- formed using the Vector NTI Advance 10.0 software (Invitrogen). Genes, introns, exons, and transcription initia- tion sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...


Mycorrhiza
Volume 23, Issue 7 , pp 573-584 DOI:10.1007/s00572-013-0498-7

The reduced mycorrhizal colonisation (rmc) mutation of tomato disrupts five gene sequences including the CYCLOPS/IPD3 homologue

Larkan et al.,
1. School of Plant Biology M090, The University of Western Australia, 35 Stirling Highway, Crawley, Perth, Western Australia, 6009, Australia 2. Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, Saskatchewan, S7N0X2, Canada 3. Donald Danforth Plant Science Centre, 975 N Warson Rd, St Louis, MO, 63132, USA

... Page 6. Genes within this sequence were predicted using FGENESH software (softberry.com). ... FGENESH gene prediction software (softberry.com) was used to annotate the region and to determine whether any match to known mycorrhiza-regulating genes could be identified. ...


Eukaryotic Cell
September 2013 vol. 12 no. 9 1214-1224 DOI:10.1128/EC.00159-13

Unraveling the Molecular Basis of Temperature-Dependent Genetic Regulation in Penicillium marneffei

Yang et al.,
Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, USAa Department of Microbiology, University of Hong Kong, Hong Kongb Center for Clinical Laboratory, Zhujiang Hospital, Southern Medical University, Guangzhou, People's Republic of China

... Genes with a false discovery rate (FDR) of <0.05 as reported by all three packages were considered to be differentially expressed. Gene prediction and identification of orthologs.Ab initio gene predictions were performed using FGENESH (SoftBerry, Mount Kisco, NY). ...


Crop and Pasture Science
DOI:10.1071/CP13140

Isolation and characterisation of cytosolic glutamine synthetase (GSe) genes and association with grain protein content in durum wheat

Gadaleta et al.,
A Department of Soil, Plant and Food Sciences, Section of Genetics and Plant Breeding, University of Bari ‘Aldo Moro’, Via G. Amendola 165/A – 70126 Bari, Italy.

... Genes prediction was conducted with the FGENESH program (http://linux1.softberry.com/berry. phtml?topic=fgenes handgroup=programsandsubgroup=gfind). Consensus exon/ introns boundaries were confirmed using grass expressed sequence tag sequences aligned to the ...


Appl. Environ. Microbiol.
March 2013 vol. 79 no. 6 2038-2047 DOI:10.1128/AEM.03334-12

Characterization of the Biosynthetic Genes for 10,11-Dehydrocurvularin, a Heat Shock Response-Modulating Anticancer Fungal Polyketide from Aspergillus terreus

Xu et al.,
aNatural Products Center, School of Natural Resources and the Environment, College of Agriculture and Life Sciences, The University of Arizona, Tucson, Arizona, USA bInstitut fur Chemie, Technische Universitat Berlin, Berlin, Germany

... earlier (17). Hidden Markov model (HMM)-based gene models were built with FGENESH (Softberry) with additional exon/intron boundary refinements in SPLICEVIEW (http://zeus2.itb.cnr.it/?webgene/wwwspliceview.html). The ...


IJEB
Vol.51(12) [December 2013] pp. 1130-1136

Molecular cloning and mRNA expression profile of Sucrose Transporter Gene BnSUT1C from Brassica napus L.

Li et al.,

... suite (Windows version 5.0.2; DNASTAR, Madison, Wis.). The complete open reading frame (ORF) was identified with program FGENESH (http://www.softberry.com/berry. phtml). Primers were designed in the predicted 5' and ...


Advanced BioTech
Volume:12 Issue:11 May 10, 2013

Isolation and in silico Depiction of Novel R2-R3 MYB Transcription Factors from Sugarcane

Pranali A. Kulkarni1, Prabu G.R. and Rachayya M. Devarumath
1. Molecular Biology & Genetic Engineering Division, Vasantdada Sugar Institute, Manjari (Bk.), Tal. Haveli, Pune-412307, Maharashtra, India. 2. Department of Biotechnology, University of Pune, Pune-411005, Maharashtra, India. 3. Department of Biotechnology, School of Life Sciences, Karpagam University, Pollachi Coimbatore – 641021, Tamil Nadu, India.

... The nucleotide sequences of SbMYB18 and SoMYB18 were processed for deducing the exon and intron pattern online using fGENESH Hidden Markov Model (HMM) based gene structure prediction tool (www.softberry.com/berry.phtml). ...


Plant Molecular Biology Reporter
Volume 31, Issue 6 , pp 1249-1260 DOI:10.1007/s11105-013-0585-0

Structure, Evolution, and Expression of the b-Galactosidase Gene Family in Brassica campestris ssp. chinensis

Jinlong Liu, Minghui Gao, Meiling Lv, Jiashu Cao
1. Laboratory of Cell & Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China

... Each of the BGAL gene loci in Arabidopsis was used to obtain all possible BGAL genes in B. campestris from BRAD (Table 1). Each predicted BGAL gene sequence in B. campestris was confirmed by FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...


PloS one
May 28, 2013DOI: 10.1371/journal.pone.0064432

Adaptive Selection on Bracovirus Genomes Drives the Specialization of Cotesia Parasitoid Wasps

Jancek et al.,
Institut de Recherches sur la Biologie de l’Insecte, UMR 7261 CNRS, Universite Francois-Rabelais, UFR Sciences et Techniques, Parc Grandmont, Tours, France aboratoire Evolution, Genomes et Speciation, CNRS UPR9034, IRD UR 072 and Universite Paris Sud, Gif sur Yvette, France, Unite de Recherche UMR 1272, Physiologie de l’Insecte, Signalisation et Communication, INRA, Versailles, France

... Gene predictions on CskBV newly sequenced contigs and BACs and on CsmBV BACs were made with SoftBerry's FGENESH de novo prediction tool [37] and FGENESH+ using the honeybee (Apis mellifera L.) training set and were manually corrected by comparison with ...


Molecular Immunology
Volume 56, Issue 4, 31 December 2013, Pages 745–756 DOI:10.1016/j.molimm.2013.07.012

Accessory molecules for Toll-like receptors in Teleost fish. Identification of TLR4 interactor with leucine-rich repeats (TRIL)

Danilo Pietretti a, Herman P. Spaink b, Alberto Falco a, Maria Forlenza a, Geert F. Wiegertjes a,
a Cell Biology and Immunology Group, Wageningen Institute of Animal Sciences, Wageningen University, PO Box 338, 6700 AH Wageningen, The Netherlands b Institute of Biology, Leiden University, Einsteinweg 55, 2333 CC Leiden, The Netherlands

... al., 2012). Genomic information was then used to predict nucleotide and protein sequences using FGENESH version 2.5 (www.softberry.com). Table 1. Accessory molecules present in teleost fish species. Accessory molecules ...


Theoretical and Applied Genetics
October 2013 DOI:10.1007/s00122-013-2205-7

A putative candidate for the recessive gall midge resistance gene gm3 in rice identified and validated

Sama et al.,
1. Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, Andhra Pradesh, India 2. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, 502324, Andhra Pradesh, India

... The down- loaded sequences were then analyzed using the software package FGeneSH (http://www.softberry.com) for open reading frames (OrFs) and annotated using BlAST-P utility (http://www.ncbi.nlm.nih.gov) to identify the puta- tive function of each gene present in the ...


Plant Cell Reports
November 2013, DOI:10.1007/s00299-013-1535-x

Transcriptional regulation of early embryo development in the model legume Medicago truncatula

Sergey Kurdyukov, Youhong Song, Michael B. Sheahan, Ray J. Rose
1. Australian Research Council Centre of Excellence for Integrative Legume Research, School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW, 2308, Australia 2. Kolling Institute of Medical Research, Kolling Building, Royal North Shore Hospital, St Leonards, NSW, 2065, Australia

... The corresponding gene loci and protein sequences were obtained from the Mt3.5 genome release (http://www.medicagohapmap.org), or where unavailable, they were predicted directly using FGENESH (http://www.softberry.com). ...


J Hered
(2013) 104 (1): 134-139. doi: 10.1093/jhered/ess075

Localization of a New Gene for Bitterness in Cucumber

Zhang et al.,
From the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 10081 China (Zhang, Miao, Sun, Wang, Huang, and Gu); and the Department of Horticultural Science, North Carolina State University, Raleigh, NC 27695-7609 (Wehner).

... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and verified by FGENESH (http://sunl.softberry.com/) (Salamov and Solovyev 2000), GENESCAN (http://genes.mit.edu/GENSCAN.html) (Burge and Karlin 1997), TwinScan (http://mblab ...


Arthropod-Plant Interactions
Volume 7, Issue 4 , pp 389-402 DOI:10.1007/s11829-013-9253-4

Hessian fly larval attack triggers elevated expression of disease resistance dirigent-like protein-encoding gene, HfrDrd, in resistant wheat

Subhashree Subramanyam, Cheng Zheng, John T. Shukle, Christie E. Williams
1. Department of Agronomy, Purdue University, West Lafayette, IN, 47907, USA 2. Novartis Pharmaceuticals Corporation, East Hanover, NJ, 07936, USA

... subcellular localization of HFRDRD proteins. Structural analysis of the genomic sequence was performed using the FGENESH program (http://linux1.softberry.com/berry.phtml). Phylogenetic analysis. In order to explore the evolutionary ...


Microbial Pathogenesis
Volume 64, November 2013, Pages 6–17 DOI:10.1016/j.micpath.2013.06.001

Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis

Liu et al.,
a The Key Lab of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan 430070, Hubei, PR China b School of Environmental Sciences, University of Guelph, Guelph, ON N1G 2W1, Canada c Department of Biology, University of Saskatchewan, Saskatoon S7N 5E2, Canada

... algorithm of the Basic Local Alignment Search Tool [25] hosted by the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov), and open reading frames were further analyzed using the gene prediction program FGENESH (Softberry Inc., Mount Kisco ...


Planta
Volume 238, Issue 2 , pp 293-305 DOI:10.1007/s00425-013-1891-3

Analysis of nucleotide diversity among alleles of the major bacterial blight resistance gene Xa27 in cultivars of rice (Oryza sativa) and its wild relatives

Bimolata et al.,
1. Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Prof. C. R. Rao Road, Gachibowli, Hyderabad, 500046, India 2. Crop Improvement Section, Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, India

... Based on the sequences obtained from the genotypes under study, the coding regions and the UTR regions of the new alleles were predicted through the software utility, FGENESH (http://www.softberry.com) (Salamov and Solovyer 2000 ). ...


G3
March 1, 2013 vol. 3 no. 3 563-572 DOI:10.1534/g3.113.005587

Fine-Mapping and Identification of a Candidate Gene Underlying the d2 Dwarfing Phenotype in Pearl Millet, Cenchrus americanus (L.) Morrone

Parvathaneni et al.,
*Institute of Plant Breeding, Genetics and Genomics, University of Georgia, Athens, Georgia 30602 †Department of Crop and Soil Sciences, University of Georgia, Athens, Georgia 30602

... respectively. The sequence of BAC 293B22 has been deposited in GenBank under accession number KC463796. Gene prediction was performed using FGENESH with the monocot training set (www.softberry.com). Repetitive ...


Theoretical and Applied Genetics
Volume 126, Issue 10 , pp 2643-2653 DOI:10.1007/s00122-013-2162-1

Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato

Zhang et al.,
1. The Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Zhongguancunnandajie 12, Beijing, 100081, People’s Republic of China 2. Wageningen UR Plant Breeding, Wageningen University and Research Center, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands

... MapQTl 4.0 (Van Ooijen and Maliepaard 1996) was used to perform the QTl analysis. Gene prediction and sequence analysis The online program FGeneSH was used to pre- dict open reading frames (OrFs) in the target region (http://linux1.softberry.com/). ...


PloS one
September 24, 2013DOI: 10.1371/journal.pone.0075544

Dynamic Evolution of Rht-1 Homologous Regions in Grass Genomes

Wu et al.,
Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, the National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, the Chinese Academy of Agricultural Sciences, Beijing, China Plant Germplasm and Genomics Center, Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany, the Chinese Academy of Sciences, Kunming, China

... Repeats/ gene_annotation.pdf). Here, gene predictions were performed mainly by using the program FGENESH with training sets of the monocots including maize, rice, wheat and barley (http://www.softberry.com). In addition ...


Heredity
110, 570-577 (June 2013) | doi:10.1038/hdy.2013.2

Diversity and abundance of the abnormal chromosome 10 meiotic drive complex in Zea mays

Kanizay et al.,

... Masked contigs were then mapped with BLAST to the non-redundant nucleotide and protein databases at NCBI with an e-value cutoff of 10 ?5 (Supplementary Table 2). Gene models were identified using FGenesH (SOFTBERRY) and Augustus (http://bioinf.uni-greifswald.de ...


BMC Genomics.
2013; 14: 169. DOI:10.1186/1471-2164-14-169

Transcriptome analysis of pigeon milk production – role of cornification and triglyceride synthesis genes

Gillespie et al.,
Australian Animal Health Laboratory, CSIRO Animal, Food and Health Sciences, 5 Portarlington Road, Geelong, Victoria, Australia 2School of Life and Environmental Sciences, Deakin University, Pigdons Road, Geelong, Victoria 3216, Australia

...The scaffolds of interest were then submitted to a Hidden Markov Model gene prediction program (FGENESH, Softberry; http://linux1.softberry.com/berry.phtml) using parameters for chicken (aves) to identify predicted full-length gene sequences. Where scaffolds were too large to be processed by FGENESH, the region of the scaffold with the BLAST match was submitted....


Molecular Biology Reports
Volume 40, Issue 2 , pp 1385-1396 DOI:10.1007/s11033-012-2182-y

Characterization of the NADP-malic enzymes in the woody plant Populus trichocarpa

Yu et al.,
1. State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, 26 Hexing Road, Harbin, 150040, China

... We performed the PtNADP-ME4 gene structure (exons and introns) prediction using the FGENESH program on the SoftBerry server (http://www.soflberry.corn/berry.phtml), and present new predicted PtNADP-ME4 gene sequences (Table S1). ...


Front Plant Sci.
2013; 4: 318. DOI:10.3389/fpls.2013.00318

A comparison of the molecular organization of genomic regions associated with resistance to common bacterial blight in two Phaseolus vulgaris genotypes

Perry et al.,
1Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada 2Department of Biological Sciences, University of Windsor, Windsor, ON, Canada

...The sequence data was examined for open reading frames using FGENESH (http://www.softberry.org), with the Medicago gene model....


New Phytologist
197: 595–605. doi: 10.1111/nph.12043

The Brassica napus blackleg resistance gene LepR3 encodes a receptor-like protein triggered by the Leptosphaeria maculans effector AVRLM1.

Larkan et al.,
1Saskatoon Research Centre, Agriculture and Agri-Food Canada, Saskatoon, SK, Canada 2School of Plant Biology, University of Western Australia, Crawley, WA, Australia 3The UWA Institute of Agriculture, University of Western Australia, Crawley, WA, Australia

... Identification, cloning and transformation of candidate gene. A B. rapa BAC spanning the LepR3 interval was annotated for gene content using fgenesh software (www.softberry. com) trained to 'Dicot plants (Arabidopsis)' to predict gene content. ...


Theoretical and Applied Genetics
Volume 126, Issue 8 , pp 2187-2196 DOI:10.1007/s00122-013-2128-3

Fine mapping of the pleiotropic locus B for black spine and orange mature fruit color in cucumber identifies a 50 kb region containing a R2R3-MYB transcription factor

Yuhong Li, Changlong Wen, Yiqun Weng
1. Horticulture College, Northwest A&F University, Yangling, 712100, China 2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA

... with preceding fragment. Gene prediction in target genomic DNA regions was performed with the computer program FGENESH (Salamov and Solovyev 2000) (http://sunl.softberry.com/) and checked manually. Candidate gene ...


The Plant Cell
July 2013 vol. 25 no. 7 2536-2544 DOI:10.?1105/?tpc.?113.?111856

Formation and Expression of Pseudogenes on the B Chromosome of Rye

Ali Mohammad Banaei-Moghaddam, Karla Meier, Raheleh Karimi-Ashtiyani and Andreas Houben 1
Leibniz Institute of Plant Genetics and Crop Plant Research, 06466 Gatersleben, Germany

... Therefore, the genomic sequences of all fragments were BLASTed against the rye EST database (Haseneyer et al., 2011) and analyzed using FGENESH software (http://linux1.softberry.com/berry.phtml) (see Supplemental Figure 1 online). ...


Front Plant Sci.
2013; 4: 258. DOI:10.3389/fpls.2013.00258

Investigating the beneficial traits of Trichoderma hamatum GD12 for sustainable agriculture—insights from genomics

Studholme et al.,
1Biosciences, Molecular Plant Pathology, College of Life and Environmental Sciences, University of Exeter, Exeter, UK 2Plant Biology and Crop Science, Rothamsted Research, Harpenden, UK Edited by: Corne M. J. Pieterse, Utrecht University, Netherlands

... (1991). Bioinformatics methods. We used Velvet version 1.1.04 (Zerbino and Birney, 2008) for de novo assembly of genome sequence. For ab initio gene prediction we used FgenesH (http://linux1.softberry.com/berry.phtml?topic=fgenesh). ...


Plant Science
Volume 210, September 2013, Pages 241–249 DOI:10.1016/j.plantsci.2013.06.003

Mutation of OsDET1 increases chlorophyll content in rice

Huang et al.,
a Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, 174 Shazheng Street, Shapingba District, Chongqing 400030, China b Institute of Rice, Chongqing Academy of Agricultural Sciences, Chongqing, China

... mapped to a 87-kb DNA region (Fig. 1a). Eight annotated candidate genes were located in the DNA region using the program FGENESH 2.2 (www.softberry.com). Further amplification of the relevant DNA fragments and sequence ...


G3
January 1, 2013 vol. 3 no. 1 41-63 doi: 10.1534/g3.112.004044

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Manning et al.,
*Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331 †Department of Forest Sciences, University of British Columbia, Vancouver, British Columbia, Canada, V6T 1Z4 ‡Carbone/Ferguson Laboratories, Division of Neuroscience, Oregon National Primate Research Center (ONPRC), Beaverton, Oregon 97006

...Protein-encoding genes were annotated using a combination of manual curation, EST alignments, and ab initio gene predictions made by FGENESH, FGENESH+ (http://linux1.softberry.com) and GENEID (http://genome.crg.es/software/geneid). ...


Physiological and Molecular Plant Pathology
Volume 84, October 2013, Pages 76–85 DOI:10.1016/j.pmpp.2013.07.007

Foatf1, a bZIP transcription factor of Fusarium oxysporum f. sp. cubense, is involved in pathogenesis by regulating the oxidative stress responses of Cavendish banana (Musa spp.)

Xingzhu Qi b, Lijia Guo a, c, Laying Yang a, c, Junsheng Huang a, c,
a Institute of Environment and Plant Protection, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China b College of Agriculture Hainan University, Haikou 570228, China c Key Laboratory of Monitoring and Control of Tropical Agricultural and Forest Invasive Alien Pests, Ministry of Agriculture, Haikou 571101, China

... The protein-encoding gene sequence was submitted to a gene-finding program (FGENESH A, Softberry Inc.) to perform automated annotation and obtain the putative mRNA sequence of Foatf1. The PCR primers were designed based on the putative mRNA sequence of Foatf1. ...


PloS one
December 16, 2013DOI: 10.1371/journal.pone.0082353

Mating Type Locus of Chinese Black Truffles Reveals Heterothallism and the Presence of Cryptic Species within the T. indicum Species Complex

Beatrice Belfiori, Claudia Riccioni, Francesco Paolocci, Andrea Rubini
Institute of Biosciences and BioResources - Perugia Division, National Research Council, Perugia, Italy

... www.geneious.com). Gene prediction analyses were performed using FGENESH (http://linux1.softberry.com/berry.phtml). RNA Isolation and Reverse-transcription Polymerase Chain Reaction Analysis. Total RNA was isolated ...


Plant Disease
February 2013, Volume 97, Number 2 Pages 245-251 http://dx.doi.org/10.1094/PDIS-11-11-0941-RE

Chromosomal Mapping and QTL Analysis of Resistance to Downy Mildew in Cucumis sativus

S. P. Zhang et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China;

... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and veriWed by FGENESH (http://linuxl.softberry.com/) (40), GENESCAN (http://genes.mit.edu/ GENSCAN.html) (4), TwinScan (http:// mblab.wustl.edu/software/download/) (24), and then ...


Phytopathology
June 2013, Volume 103, Number 6 Pages 594-599 http://dx.doi.org/10.1094/PHYTO-10-12-0260-R

Functional Analysis of Pid3-A4, an Ortholog of Rice Blast Resistance Gene Pid3 Revealed by Allele Mining in Common Wild Rice

Qiming Lv et al.,
Rice Research Institute, Sichuan Agricultural University, Chengdu 611130, China

... 9-bp deletion, in addition to many SNPs, compared with that of Pid3. According to the computer program FGENESH (http://www.softberry.com), the two genes should have predicted promoter regions beginning 900-bp from their respective start codons, ...


BMC Plant Biology
2013, 13:162 doi:10.1186/1471-2229-13-162

Combined linkage and association mapping reveals candidates for Scmv1, a major locus involved in resistance to sugarcane mosaic virus (SCMV) in maize

Tao et al.,
1 National Maize Improvement Center, China Agricultural University, 2 West Yuanmingyuan Road, Beijing 100193, People’s Republic of China 2 Department of Agronomy, Iowa State University, 1204 Agronomy Hall, Ames, Iowa 50011, USA 3 Research Center Flakkebjerg, University of Aarhus, 4200, Slagelse, Denmark

... We used Fgenesh software (http://linux1.softberry.com/berry.phtml, version 2.6) to predict ten putative genes from the masked sequence, including seven genes with putative functions, two hypothetical genes, and one gene without significant similarity to known genes (Figure 3C ...


J Hered
(2013) 104 (2): 273-286. doi: 10.1093/jhered/ess102

Identification and Characterization of a Homologue to the Arabidopsis INDEHISCENT Gene in Common Bean

Tania Gioia, Giuseppina Logozzo, James Kami, Pierluigi Spagnoletti Zeuli and Paul Gepts
From the Scuola di Scienze Agrarie, Forestali, Alimentari ed Ambientali, Universita degli Studi della Basilicata, Viale dell’Ateneo Lucano 10, 85100 Potenza, Italy (Gioia, Logozzo, Spagnoletti Zeuli); and the Department of Plant Sciences/MS1, University of California, 1 Shields Avenue, Davis, CA 95616–8780 (Kami and Gepts).

... with AtIND. Gene structure was predicted using the software FGENESH (http://linux1.softberry.com/berry.phtml), whereas the search for ORFs was performed using ORF finder (http://www.ncbi.nlm.nih.gov/projects/gorf/). To identify ...


J. Exp. Bot.
(2013) 64 (2): 651-663. doi: 10.1093/jxb/ers363

Identification of differentially methylated regions during vernalization revealed a role for RNA methyltransferases in bolting

Hebrard et al.,
1 Universite d’Orleans, UFR/Faculte des Sciences, UPRES EA 1207 Laboratoire de Biologie des Ligneux et des Grandes Cultures, INRA USC1328 ARCHE, rue de Chartres, BP6759, 45067 Orleans cedex 2, France 2 SESVanderHave N.V./S.A., Soldatenplein Z2 nr15, Industriepark, B-3300 Tienen, Belgium

... The identification of potential transposable elements (TEs) in the RLGS genomic sequences was realized by the identification of potential coding sequences (FGENESH on http://linux1. softberry.com/berry.phtml) followed by BLASTP analysis and the search of dispersed ...


Ann Bot
(2013) 111 (2): 305-315. doi: 10.1093/aob/mcs260

A triallelic genetic male sterility locus in Brassica napus: an integrative strategy for its physical mapping and possible local chromosome evolution around it

Lu et al.,
1National Key Laboratory of Crop Genetic Improvement, Key Laboratory of Rapeseed Genetic Improvement (Ministry of Agriculture), Huazhong Agricultural University, Wuhan 430070, China 2Dandong Academy of Agricultural Sciences, Fengcheng 118109, P.R. China

... Polymerase (Finnzymes Oy, Espoo, Finland). The website-based software FGENSH (http://www.softberry.com) was employed to predict the putative open reading frames (ORFs) located in the target region. The Plant Repeat Databases ...


Molecular Genetics and Genomics
December 2013 DOI:10.1007/s00438-013-0795-z

A systematic exploration of high-temperature stress-responsive genes in potato using large-scale yeast functional screening

Baniekal Hiremath Gangadhar, Jae Woong Yu, Kappachery Sajeesh, Se Won Park
1. Department of Molecular Biotechnology, Konkuk University, Seoul, 143701, South-Korea

... FGeneSH (http://linux1.softberry.com/berry.phtml?topic=fgenesh &group=programs&subgroup= gfind) was used for those sequences for which we could not able to find possible OrF using GenSCan (Burge and Karlin 1998; Salamov and Solovyev 2000). ...


Crop Science
27 Nov. 2013; doi: 10.2135/cropsci2013.09.0598

Fine Mapping of the Cross-incompatibility Locus Gametophytic Factor 1 (ga1) Using a Homogeneous Maize Population 2

Liu et al.,
1 State Key Laboratory of Crop Biology, Shandong Agricultural University, Daizong Street 61, Taian, Shandong, 271018, CHINA 2 College of Life Science, Shandong University, Shanda South Street 27, Jinan, 250100, CHINA

... polyacrylamide gel and visualized with ethidium bromide staining. The maize gene 18 set (www.maizeequence.org) and website-based software FGENSH 19 (http://www.softberry.com) was applied to predict and filter the putative genes from 20 the mapping interval. 21 22 ...


Appl. Environ. Microbiol.
June 2013 vol. 79 no. 12 3770-3778 DOI:10.1128/AEM.03833-12

Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

Aylward et al.,
Department of Bacteriology, University of Wisconsin—Madison, Madison, Wisconsin, USAa Department of Energy Great Lakes Bioenergy Research Center, University of Wisconsin—Madison, Madison, Wisconsin, USAb

... Amino acid sequences for the nucleotide sequences of these CAZyme genes were obtained using a combination of 6-frame translation, the software program FGENESH (Softberry), and BLASTX (27) against the NCBI NR database (44). ...


New Phytologist
197: 416–430. doi: 10.1111/nph.12026

Methylome of DNase I sensitive chromatin in Populus trichocarpa shoot apical meristematic cells: a simplified approach revealing characteristics of gene-body DNA methylation in open chromatin state.

Lafon-Placette et al.,
1Universite d'Orleans, Faculte des Sciences, Laboratoire de Biologie des Ligneux et des Grandes Cultures (LBLGC), Orleans, France 2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), Orleans, France

... Identification of transposase was performed using Fgenesh software (http://linux1.softberry.com/ berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) and confirmed by TBlastX analysis (e-value < 10 ?30 ) on a flowering plant transcripts database. ...


Genetics
September 1, 2013 vol. 195 no. 1 263-273 DOI:10.1534/genetics.113.152330

Cloning and Characterization of a Critical Regulator for Preharvest Sprouting in Wheat

Liu et al.,
*Department of Agronomy, Kansas State University, Manhattan, Kansas 66506 †Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506 ‡Faculty of Science, Genomics and Biotechnology Section, Department of Biological Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia

... Bobwhite as control. Bioinformatics and statistical analysis. Genomic sequences from the three BACs covering the Qphs.pseru-3AS region were annotated using FGENESH (http://linux1.softberry.com/berry.phtml). The promoter ...


New Phytologist
200: 675–690. doi: 10.1111/nph.12414

A metabolic gene cluster in Lotus japonicus discloses novel enzyme functions and products in triterpene biosynthesis

Krokida et al.,
1Department of Biochemistry and Biotechnology, University of Thessaly, Larisa, Greece 2Department of Metabolic Biology, John Innes Centre, Norwich, UK 3Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan, Merida, Yucatan, Mexico

... A region of c. 300 kb flanking each side of the OSC genes was screened and analysed using FGENESH gene prediction software (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group= programs&subgroup=gfind) and GeneScanwebserver (Burge & Karlin, 1998). ...


BMC Genomics
2013, 14:683 doi:10.1186/1471-2164-14-683

A draft Musa balbisiana genome sequence for molecular genetics in polyploid, inter- and intra-specific Musa hybrids

Davey et al.,
1 Laboratory of Fruit Breeding and Biotechnology, Division of Crop Biotechnics, Department of Biosystems, Katholieke Universiteit Leuven, Willem de Croylaan 42, box 2427B-3001, Heverlee, Leuven, Belgium 2 Centre for Research in Biotechnology for Agriculture and Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur 50603, Malaysia

... B-genome annotation. Ab initio gene prediction was carried out using the FGENESH software, available online from http://linux1.softberry.com/all.htm webcite and using the default parameters and the 'monocot model plant' parameters. ...


Acta Physiologiae Plantarum
Volume 35, Issue 2 , pp 483-500 DOI:10.1007/s11738-012-1091-y

Analysis of the expression, subcellular and tissue localisation of phosphoglucan, water dikinase (PWD/GWD3) in Solanum tuberosum L.: a bioinformatics approach for the comparative analysis of two ?-glucan, water dikinases (GWDs) from Solanum tuberosum L.

Orzechowski et al.,
1. Department of Biochemistry, Faculty of Agriculture and Biology, Warsaw University of Life Sciences, SGGW, Nowoursynowska 159, 02-776, Warsaw, Poland 2. Department of Biometrics and Bioinformatics, Faculty of Agriculture and Biology, Warsaw University of Life Sciences, SGGW, Nowoursynowska 159, 02-776, Warsaw, Poland

... Identification of the coding region, open reading frames and the translation of the StGWD3 nucleotide sequence was based on the FGENESH gene structure prediction based on the Hidden Markov Model (HMM) constructed for Nicotiana tabacum (Solanaceae) genome (http://?linux1.?softberry.?com/?berry.?phtml). ...


Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 28-41 DOI:10.1007/s11105-013-0597-9

Genome-Wide Identification, Classification, Expression Profiling, and SSR Marker Development of the MADS-Box Gene Family in Citrus

Hou et al.,
1. Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan, 430070, China

... pseudogenes or incorrect annotations because of the lack of a start or stop codon in the open reading frame, and manual reannotation was performed to correct and reannotate the putative MADS-box using an online web server FGENESH (http://linux1.softberry.com/ berry.phtml ...


Planta
Volume 237, Issue 1 , pp 279-292 DOI:10.1007/s00425-012-1756-1

Young Leaf Chlorosis 1, a chloroplast-localized gene required for chlorophyll and lutein accumulation during early leaf development in rice

Zhou et al.,
1. National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing, 210095, China 2. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... P0027G10. Within this region, five ORFs were predicted using the program FGENESH 2.2 (http://www. softberry.com) (Fig. 2b). To determine the mutation site, all five cDNA sequences were separately isolated from young leaves. ...


Fungal Diversity
May 2013, Volume 60, Issue 1, pp 161-170, DOI:10.1007/s13225-013-0228-7

Getting to the bottom of Taxol biosynthesis by fungi

Uwe Heinig, Susanne Scholz, Stefan Jennewein
1. Fraunhofer Institut fur Molekularbiologie und Angewandte Okologie, Forckenbeckstrasse 6, 52074, Aachen, Germany

... Sequence analysis Sequences were analyzed using CLC Combined Workbench v3.6.1, Lasergene 7 Package, NCBI Blast and CloneManager Professional Suite 8. FGENESH was use for ORF and protein prediction (http://linux1.softberry.com/). ...


Journal of Plant Interactions
Volume 8, Issue 1, 2013 pages 34-44 DOI:10.1080/17429145.2012.721523

Positive selection pressure on rice blast resistance allele Piz-t makes it divergent in Indian land races

Thakur et al.,
a National Research Centre on Plant Biotechnology , IARI , New Delhi , 110012 , India b Deparment of Biotechnology , Himachal Pradesh University , Shimla , 171005 , India

... BioEdit Software version 7.0.9.0 (www.mbio.ncsu.edu). Gene coding regions were predicted with FGENESH (www.softberry.com) using the Piz-t sequence as reference. The functional domain(s) which play an important role ...


Scientia Horticulturae
Volume 164, 17 December 2013, Pages 323–332 DOI:10.1016/j.scienta.2013.09.040

Transcriptional profile of differentially expressed genes related to abortive flower buds under short light period stress in petunia

Yue et al.,
Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Sciences, Huazhong Agricultural University, No. 1, Shizishan Street, Hongshan District, Wuhan 430070, Hubei Province, China

... 2.7. Sequence and bioinformatics analysis of Phms2. Through EST blast analysis in the genome database of petunia, we successfully predicted the full-length open reading frame (ORF) of Phms2 using the FGENESH tool (http://www.softberry.com). ...


Front Plant Sci.
2013; 4: 317. DOI:10.3389/fpls.2013.00317

In silico comparison of genomic regions containing genes coding for enzymes and transcription factors for the phenylpropanoid pathway in Phaseolus vulgaris L. and Glycine max L. Merr

Reinprecht et al.,
1Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada 2Department of Plant Sciences, North Dakota State University, Fargo, ND, USA Edited by: Georgina Hernandez, Universidad Nacional Autonoma de Mexico, Mexico Reviewed by: Alejandra A. Covarrubias, Universidad Nacional Autonoma de Mexico, Mexico; Steven B. Cannon, United States Department of Agriculture, USA

... The consensus sequence was analyzed for the presence of coding regions with GENSCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/) using Medicago truncatula and Arabidopsis, respectively as the model organisms. ...


ACS Chem. Biol.
2013, 8 (4), pp 741–748 DOI: 10.1021/cb3006787

Complexity Generation in Fungal Peptidyl Alkaloid Biosynthesis: A Two-Enzyme Pathway to the Hexacyclic MDR Export Pump Inhibitor Ardeemin

Stuart W. Haynes †, Xue Gao ‡, Yi Tang *‡§, and Christopher T. Walsh *†
† Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, Massachusetts 02115, United States ‡Department of Chemical and Biomolecular Engineering and §Department of Chemistry and Biochemistry, University of California Los Angeles, 420 Westwood Plaza, Los Angeles, California 90095, United States

... Contigs containing candidate clusters were examined using eukaryotic gene predictor FGENESH (Softberry), and predicted proteins surrounding the candidate Ant-activating NRPS were examined by repeated BLAST search. ...


Theoretical and Applied Genetics
Volume 126, Issue 7 , pp 1825-1838 DOI:10.1007/s00122-013-2095-8

Fine mapping and identification of candidate genes controlling the resistance to southern root-knot nematode in PI 96354

Anh-Tung Pham, Kaitlin McNally, Hussein Abdel-Haleem, H. Roger Boerma, Zenglu Li
1. Center for Applied Genetic Technologies and Department of Crop and Soil Sciences, University of Georgia, Athens, GA, 30602, USA 2. Institute for Plant Biology, University of Zurich, Zurich, Switzerland 3. Georgia Seed Development Commission, Athens, GA, 30605, USA

... genes. In addition to using soybase's gene model, we also used the programs Fgenesh (http://linux1.softberry.com) and Expasy (http://web.expasy.org/cgi-bin/ translate/dna_aa) to predict gene structure and protein sequence. ...


Int. J. Mol. Sci.
2013, 14(7), 13559-13576; doi:10.3390/ijms140713559

First Insights into the Large Genome of Epimedium sagittatum (Sieb. et Zucc) Maxim, a Chinese Traditional Medicinal Plant

Liu et al.,
1 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China 2 University of Chinese Academy of Sciences, Beijing 100039, China

... protein database (NR) [72]. Secondly, ab initio gene prediction was performed on the ENS dataset using the FGENESH feature (Dicot plants-Arabidopsis) of the MolQuest software package (softberry) [73]. Thirdly, a local BLAST ...


J. Integr. Plant Biol.
(2013) 55(7):643–653. DOI:10.1111/jipb.12068

Genome-wide analysis of the Sus gene family in cotton.

Zou et al.,
State Key Laboratory of Cotton Biology, Institute of Cotton Research, the Chinese Academy of Agricultural Sciences, Anyang, China

... DNA sequences or were predicted online using FGENESH (http://linux1.softberry.com/berry. phtml?topic=fgenesh&group=programs &subgroup=gfind). Predicted conserved domains were screened by SMART (http://smart.embl-heidelberg.de/) and ...


Experimental & Molecular Medicine
(2013) 45, e31; doi:10.1038/emm.2013.59

A known expressed sequence tag, BM742401, is a potent lincRNA inhibiting cancer metastasis

Park et al.,
1Medical Genomics Research Center, KRIBB, Daejeon, Republic of Korea 2Department of Functional Genomics, University of Science and Technology, Daejeon, Republic of Korea 3Department of General Surgery, College of Medicine, Chungnam National University, Daejeon, Republic of Korea

... indicating that our putative lincRNAs are not protein-coding genes: first, when we predicted open reading frames of our putative lincRNAs using gene prediction programs, such as GeneScan (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/), we ...


PloS one
February 01, 2013DOI: 10.1371/journal.pone.0055185

Genomic and Secretomic Analyses Reveal Unique Features of the Lignocellulolytic Enzyme System of Penicillium decumbens

Liu et al.,
State Key Laboratory of Microbial Technology, Shandong University, Jinan, Shandong, China Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China

... Gene Finding and Annotation. Gene models were predicted independently with a set of gene finders including Augustus [58], GeneMark-ES [59], GeneId [60] and SoftBerry eukaryotic gene finding suite (Fgenesh and Fgenesh+) [61]. ...


Journal of Integrative Plant Biology
Volume DOI:10.1111/jipb.12150

Auxin biosynthesis by the YUCCA6 flavin monooxygenase gene in woodland strawberry (Fragaria vesca)

Liu et al.,
1Forestry and Fruit Tree Research Institute, Shanghai Key Laboratory of Protected Horticultural Technology, Shanghai Academy of Agricultural Sciences (SAAS), Shanghai, China 2Shanghai Key Laboratory of Agricultural Genetics and Breeding, Institute of Biotechnology, SAAS, Shanghai, China 3Departamento de Biologia Moleculary Bioquimica, Universidad de Malaga, Malaga, Spain

... genes (Cheng et al. 2006) as query sequences. Hereafter, HMM-based gene structure prediction was carried out using the FGENESH program (default values) at http://linux1.softberry.com/berry.phtml. To confirm these candidates ...


BMC Genomics
2013, 14:60 doi:10.1186/1471-2164-14-60

Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

Fellers et al.,
1 USDA-ARS, Hard Winter Wheat Genetics Research Unit, Department of Plant Pathology, Manhattan, KS, 66506, USA 2 Agriculture & Agri-Food Canada, Pacific Agri-Food Research Centre, Summerland, BC, V0H 1Z0, Canada

... Louis, MO. BAC clones were cultured, subcloned, shot gun sequenced, and assembled (Washington University Genome Center, St. Louis, MO). Gene calls were made using FGENESH with gene models specific to Puccinia (http://linux1.softberry.com/berry.phtml webcite;). ...


BMC plant biology
(2013). 13(1), 89. DOI:10.1186/1471-2229-13-89

Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in the conifer picea abies reveals extensive conservation as well as dynamic patterns.

Hedman, H., Zhu, T., von Arnold, S., & Sohlberg, J. J.
Department of Plant Biology and Forest Genetics, Uppsala BioCenter, Swedish University of Agricultural Sciences and Linnean Center for Plant Biology, PO-Box 7080, Uppsala, SE, 75007, Sweden

... Gene predictions were performed with FGENESH (http://linux1.softberry.com/berry.phtml) trained with dicot plants (Arabidopsis thaliana). Primer sequences are listed in Additional file 5. Gene and cDNA accessions are listed in Additional file 6. Phylogenetic analysis ...


ChemBioChem.
(2013). Volume 15, Issue 2, pages 284–292, January 24, 2014 DOI:10.1002/cbic.201300626

Identification of the First Diphenyl Ether Gene Cluster for Pestheic Acid Biosynthesis in Plant Endophyte Pestalotiopsis fici

Xu et al.,
1State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101 (China) 2Beijing Institute of Pharmacology & Toxicology, 27 Taiping Road, Haidian District, Beijing 100850 (China)

... the accession number KC145148. The ORFs were predicted from the sequence by using the GENSCAN Web Server at MIT (http://genes.mit.edu/GENSCAN.html) and FGENESH (Softberry). The deduced proteins of corresponding ...


BMC plant biology
(2013). 13(1), 126. DOI:10.1186/1471-2229-13-126

Molecular cloning and characterisation of SlAGO family in tomato

Xian et al.,
Genetic Engineering Research Center, School of Life Sciences, Chongqing University, Chongqing 400044, People’s Republic of China

... After searching for AGO genes, bioinformatics tools, such as FGENESH (http://linux1.softberry. com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) was used to analyze and predict those unknown SlAGOs, and BLASTX of NCBI (http://blast.ncbi.nlm.nih.gov/Blast ...


BMC genomics
(2013). 14(1), 1-11. DOI:

Haplotype analysis of sucrose synthase gene family in three Saccharum species

Zhang, J., Arro, J., Chen, Y., & Ming, R.
(1)College of Life Sciences, Fujian Normal University, Fuzhou, 350108, China (2)Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA

... For genomic sequences that had not previously been annotated, we supplemented the above methods with the use of Genscan (http://?genes.?mit.?edu/?GENSCAN.?html)[43] and FGENESH (http://?linux1.?softberry.?com/?berry.?phtml) gene prediction software....


International journal of molecular sciences
(2013). 14(11), 22462-22482. DOI:10.3390/ijms141122462

Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

Tindwa et al.,
1 Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Korea 2 National Research Laboratory of Defense Proteins, College of Pharmacy, Pusan National University, Jangjeon Dong, Kumjeong Ku, Busan 609-735, Korea

... 1.0, NetOGlyc, NetPhos 2.0 and NetPhosK 1.0 server respectively (Technical University of Denmark, Lyngby, Denmark). The potential coding region was predicted using FGENESH (Softberry, Inc., Mount Kisco, NY, USA) [44]. ...


BMC microbiology
(2013). 13(1), 165. DOI:10.1186/1471-2180-13-165

Conservation of the genes for HC-toxin biosynthesis in Alternaria jesenskae

Wight, W. D., Labuda, R., & Walton, J. D.
1 Department of Energy Plant Research Laboratory, Michigan State University, 612 Wilson Road, Room 210, East Lansing, MI 48824, USA 2 Romer Labs Division Holding GmbH, Technopark 1, Tulln 3430, Austria

... Page 14. (http://www.ebi.ac.uk/Tools/msa/clustalw2/), and SPIDEY (NCBI). Assembly of predicted protein sequences was performed using DNASTAR Lasergene software with assistance from FGENESH (www.softberry.com) with Alternaria as the training model. ...


BMC genomics
(2013). 14(1), 335. DOI:10.1186/1471-2164-14-335

Frequent loss of lineages and deficient duplications accounted for low copy number of disease resistance genes in Cucurbitaceae

Lin, X., Zhang, Y., Kuang, H., & Chen, J.
Key Laboratory of Horticulture Biology, Ministry of Education, and Department of Vegetable Crops, College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan 430070, P.R. China

... 3,110 protein sequences with ATP binding domain and 6,979 protein sequences with LRR domain from NCBI was used to verify the potential NBS- LRR or LRR-LRK encoding genes [3]. All identified sequences were annotated using FGENESH [www.softberry.com] and ...


BMC genomics
(2013). 14(1), 109. DOI:

Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops

Wan, H., Yuan, W., Bo, K., Shen, J., Pang, X., & Chen, J.
State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China

...the upstream and downstream of BLAST hits, were annotated using the FGENESH...


PloS one
(2013). 8(4), e62288. DOI:10.1371/journal.pone.0062288

Genome-Wide Expression Analysis of Soybean MADS Genes Showing Potential Function in the Seed Development

Fan et al.,
MOA Key Lab of Soybean Biology (Beijing), National Key Facility of Crop Gene Resource and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China College of Life Sciences, Henan Agricultural University, Zhengzhou, Henan, China

... The fragment genes were predicted the whole CDS by FGENESH (http://linux1.softberry.com/berry.phtml) or blasting the NCBI Ref-RNA database (Table S1)....


Mobile DNA
(2013). 4(1), 12.

Homologues of bacterial TnpB_IS605 are widespread in diverse eukaryotic transposable elements

Bao, W., & Jurka, J.
Genetic Information Research Institute, 1925 Landings Drive, Mountain View, CA 94043, USA

... The TE-encoded multiple-exon genes were predicted by FGENESH program (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind), ...


BMC genomics
(2013). 14(1), 79. DOI:10.1186/1471-2164-14-79

Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics

Ksiazkiewicz et al.,
1 Institute of Plant Genetics, Polish Academy of Sciences, Strzeszynska 34, 60-479, Poznan, Poland 2 Laboratory of Computational Genomics, Institute of Molecular Biology and Biotechnology, Adam Mickiewicz University, Umultowska 89, 61-614, Poznan, Poland

...BAC sequences with masked repetitive regions were subjected to FGENESH [42,43]in silico gene prediction followed by BLAST against the EST, nr, and Swiss-Prot [44] c...


FGENESH 2012

Nature Genetics
2012 44, 1060–1065. doi:10.1038/ng.2372

Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses.

O'Connell et al.,
Department of Plant Microbe Interactions, Max Planck Institute for Plant Breeding Research, Cologne, Germany. Centro Hispano-Luso de Investigaciones Agrarias, Departamento de Microbiologia y Genetica, Universidad de Salamanca, Villamayor, Spain.

...Gene structures were predicted using the Broad Institute automated gene-calling pipeline35 based on a combination of gene models predicted by the programs FGENESH (Softberry Inc., USA), GENEID36, GeneMark37, SNAP38 and Augustus39 together with EST-based and manually curated gene models. GENEID, FGENESH, SNAP and Augustus were trained using a set of high-confidence EST-based gene models generated by clustering Blat-aligned species-specific ESTs....


J. Exp. Bot.
(2012) 63 (1): 203-214. doi: 10.1093/jxb/err264

Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress

Lichao Zhang, Guangyao Zhao, Jizeng Jia, Xu Liu and Xiuying Kong *
The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China

... Only the sequences that shared >95% matches were considered redundant. The open reading frames (ORFs) were predicted using FGENESH (http://www.softberry.com) and were translated into amino acid sequences. Finally ...


Applied Microbiology and Biotechnology
June 2012 DOI 10.1007/s00253-012-4130-0

Identification of a brevianamide F reverse prenyltransferase BrePT from Aspergillus versicolor with a broad substrate specificity towards tryptophan-containing cyclic dipeptides

Suqin Yin, Xia Yu, Qing Wang, Xiao-Qing Liu, Shu-Ming Li
1. College of Life Sciences, Capital Normal University, No.105 Xisanhuan Beilu, Beijing, 100048, China 2. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany

... Computer-assisted sequence analysis FGENESH (Softberry, Inc.) and the DNASIS software pack- age (version 2.1: Hitachi Software Engineering, San Bruno, CA) were used for intron prediction and sequence analysis, respectively. ...


Journal of Industrial Microbiology & Biotechnology
June 2012, Volume 39, Issue 6, pp 869-876 DOI: 10.1007/s10295-012-1087-z

High-level expression of a novel Penicillium endo-1,3(4)-b-d-glucanase with high specific activity in Pichia pastoris

Chen et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China

... respectively. The cod- ing region was predicted online using the FGENESH program (http://linux1.softberry.com/berry.phtml/). SignalP 4.0 web server (http://www.cbs.dtu. dk/services/SignalP/) was used to predict the signal peptide. ...


Immunogenetics
DOI: 10.1007/s00251-012-0672-7

Immunoglobulin genes of the turtles

Susana Magadan-Mompo, Christian Sanchez-Espinel & Francisco Gambon-Deza
Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain Shared Unit of Immunology, Vigo University Hospital Complex (Hospital Meixoeiro), University of Vigo, Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As Lagoas-Marcosende, Vigo 36310, Pontevedra, Spain

... Identification of the exons coding for the constant heavy (CH) domains was performed using the software FGENESH (www.softberry.com) (Solovyev et al. 2006; Yao et al. ...


Advances in Environment, Computational Chemistry and Bioscience
ISBN: 978-1-61804-147-0

In silico study of non-coding, coding transcription region and domain interaction for chromosomal translocation sequences

PRAVEEN KUNAR KORLA 1, SHAN-CHIH LEE 2 , JIM SHEU 3, JACK CHENG 3, KA-LOK NG 1
1 Department of Biomedical Informatics,Asia University, Taichung,TAIWAN 41354 2 School of Medical Imaging and Radiological Sciences, Chung Shan Medical University, Taichung, TAIWAN 40201

... The URL addresses for these web based tools are;Fgenesh (http://linux1.softberry.com/berry. phtml), Genemark (http://exon.gatech.edu/eukhmm.cgi), Genscan (http://immunax.dfci.harvard. edu/Tools/genscan.ht ml) and Webgene (http://zeus2.itb.cnr.it/~webgene/genebuilder.html ...


Cereal Research Communications
Volume 40, Number 3/September 2012 pp. 362-372 DOI: 10.1556/CRC.40.2012.3.5

Molecular mapping of quantitative trait loci for flag leaf length and other agronomic traits in rice (Oryza sativa)

Sonah et al.,
1 National Research Centre on Plant Biotechnology New Delhi 110012 India 2 Directorate of Rice Research Hyderabad AP India

... sativa subsp. japonica cv. Nipponbare (http://rice.plantbiology.msu.edu/) was used for gene prediction. FGENESH gene prediction software (www.softberry.com) was used to predict genes in this sequence. Predicted genes ...


Animal Science Journal
Volume 83, Issue 5, pages 386–393, May 2012 DOI: 10.1111/j.1740-0929.2011.00975.x

Predictive mutational bioinformatic analysis of variation in the skin and wool associated corneodesmosin (CDSN) gene in sheep

SUBRAMANIAM et al.,
1 Western Australian Biomedical Research Institute (WABRI) & Centre for Health Innovation Research Institute (CHIRI), School of Biomedical Sciences, Curtin University, Perth 2 School of Biological Sciences, Murdoch University, Murdoch, Australia

... Gene prediction tools such as GENSCAN (Burge & Karlin 1997), FGENESH (http://www.softberry.com), HMM gene (http://www.cbs.dtu.dk/services/HMMgene/), Augus- tas (Stanke et al. 2006) and GeneMark (Lomsadze et al. ...


Mol Biol Evol
(2012) 29 (2): 861-871. doi: 10.1093/molbev/msr261 First published online: October 14, 2011

Dynamic Gene Copy Number Variation in Collinear Regions of Grass Genomes

Jian-Hong Xu 1,†, Jeffrey L. Bennetzen 2 and Joachim Messing 1
1 Waksman Institute of Microbiology, Rutgers, The State University of New Jersey 2 Department of Genetics, University of Georgia

... About 100 kb–1 Mb chromosomal regions of alpha setarin gene loci were annotated by Fgenesh software (http://linux1.softberry.com/berry.phtml) for gene models, and repeats sequences were masked by Repeatmasker (http://www.repeatmasker.org/). ...


Archives of Insect Biochemistry and Physiology
Volume 79, Issue 2, pages 87–103, February 2012 DOI: 10.1002/arch.21014

ANNOTATION AND EVOLUTION OF THE ANTIOXIDANT GENES IN THE SILKWORM, Bombyx mori

Gui-Qin Shi 1, Quan-You Yu 1, Ze Zhang 1,2
1The Institute of Agricultural and Life Sciences, Chongqing University, Chongqing, China 2The Key Sericultural Laboratory of the Agricultural Ministry of China, Southwest University, Chongqing, China

... If some genome sequences showed even weak sequence similarity to any query sequences, their flanking regions (1 kb or more long) were manually extracted, and then put them into Softberry database to predict new genes using FGENESH program. ...


Journal of Microbiological Methods
Volume 91, Issue 3, December 2012, Pages 412–419 DOI: 10.1016/j.mimet.2012.09.014

Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei

Kum-Kang So et al.,
a Institute for Molecular Biology and Genetics, Chonbuk National University, Jeonju, Chonbuk 561-756, Republic of Korea b Department of Bio-Environmental Chemistry, Wonkwang University, Iksan, Chonbuk 570-749, Republic of Korea

... The structures of putative PKS genes and proteins were determined using FGENESH (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) and INTERPROSCAN (http://www.ebi.ac.uk/Tools/pfa/iprscan/), respectively. ...


Fungal Genetics and Biology
Volume 49, Issue 12, December 2012, Pages 977–986 DOI: 10.1016/j.fgb.2012.08.008

Reproductive mode and life cycle of the ash dieback pathogen Hymenoscyphus pseudoalbidus

A. Gross a, P.L. Zaffarano a, A. Duo a, C.R. Grunig b,
a Forest Pathology and Dendrology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatsstrasse 16, 8092 Zurich, Switzerland b Microsynth AG, Schutzenstrasse 15, 9436 Balgach, Switzerland

... Initial sequence analysis was conducted with the basic local alignment search tool (BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi) and refined by the gene structure prediction program FGENESH (http://linux1.softberry.com/berry.phtml) using the matrices of Sclerotinia ...


Applied Microbiology and Biotechnology
August 2012, Volume 95, Issue 4, pp 947-955 DOI: 10.1007/s00253-011-3807-0

A novel thermoacidophilic and thermostable endo-b-1,4-glucanase from Phialophora sp. G5: its thermostability influenced by a distinct b-sheet and the carbohydrate-binding module

Zhao et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China

... ncbi.nlm.nih.gov/BLAST/), respectively. Introns, exons, and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted using SignalP (http://www. cbs.dtu.dk/services/SignalP/). ...


The FASEB Journal
Published online before print September 20, 2012 DOI: 10.1096/fj.12-219444

Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female

Dottorini et al.,
*Department of Experimental Medicine and †Department of Industrial Engineering, University of Perugia, Perugia, Italy; ‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK;

... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted using FGENESH-C, FGENESH (http://linux1.softberry.com/), Wise2 (http:// www.ebi.ac.uk/), and Genescan (http://genes.mit.edu/ GENSCAN.html). Mosquito rearing and mating analysis ...


Journal of Zhejiang University SCIENCE B
June 2012, Volume 13, Issue 6, pp 452-464 DOI: 10.1631/jzus.B1100338

Genomic organization and sequence dynamics of the AvrPiz-t locus in Magnaporthe oryzae

Ping Li, Bin Bai, Hong-yan Zhang, Heng Zhou, Bo Zhou
1. State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China 2. Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, China

... The Page 3. Li et al. / J Zhejiang Univ-Sci B (Biomed & Biotechnol) 2012 13(6):452-464 454 BAC sequence was annotated by using gene predic- tion program and homology search. The Fgenesh program (http://www.softberry.com) was used for gene prediction. ...


Journal of Bioscience and Bioengineering
Volume 113, Issue 6, June 2012, Pages 710–714 DOI: 10.1016/j.jbiosc.2012.02.005,

Cloning, over-expression and characterization of an alkali-tolerant endo-b-1,4-mannanase from Penicillium freii F63

Wang et al.,
1 Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China 2 Engineering Research Centre for the Protection and Utilization of Bioresource in Southern China, College of Life Science, South-Central University for Nationalities, Wuhan 430074, PR China

... The online software FGENESH (http://linux1.softberry.com/berry.phtml) was used to predict introns, exons and transcription initiation sites of the DNA sequence. The signal peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...


New Phytologist
Volume 193, Issue 4, pages 1049–1063, March 2012 DOI: 10.1111/j.1469-8137.2011.04006.x

Tracing the origin and evolutionary history of plant nucleotide-binding site–leucine-rich repeat (NBS-LRR) genes

Jia-Xing Yue 1,2, Blake C. Meyers 3, Jian-Qun Chen 1, Dacheng Tian 1, Sihai Yang 1
1 State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, China 2 Department of Ecology and Evolutionary Biology, Rice University, Houston, TX 77005, USA

... In addition, the nucleotide sequences of these two genes, together with their 5? and 3? flanking regions (each 5000 bp, respectively), were used for re-annotation with FGENESH (http://linux1.softberry.com/berry.phtml) and the domain architecture of the resulting predicted ...


PLoS ONE 7
(7): e40564. doi:10.1371/journal.pone.0040564

Identification of a Polyketide Synthase Required for Alternariol (AOH) and Alternariol-9-Methyl Ether (AME) Formation in Alternaria alternata

Saha et al.,
Department of Microbiology, Karlsruhe Institute of Technology (KIT) - South Campus, Institute for Applied Biosciences, Karlsruhe, Germany Department of Food Chemistry, Karlsruhe Institute of Technology (KIT) - South Campus, Institute for Applied Biosciences, Karlsruhe, Germany

... A. alternata. Intron-exon borders were predicted using FGENESH (softberry.com) trained on A. brassicicola gene models but have not yet been verified experimentally due to the rather large nature of PKS genes. Among these ...


Gene
Volume 500, Issue 1, 25 May 2012, Pages 73–79 DOI: 10.1016/j.gene.2012.02.051

Two novel N-terminal coding exons of Prkar1b gene of mouse: Identified using a novel approach of in silico and molecular biology techniques

Abdul Rouf Banday, Shafquat Azim, Sayeed Ur Rehman, Mohammad Tabish
Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, U.P. 202002, India

... and Borodovsky, 1998) and is available at http://www.cbs.dtu.dk/services/HMMgene, Genescan (http://genes.mit.edu/GENSCAN.html), GeneSplicer available at http://cbcb.umd.edu/software/ GeneSplicer/ (Pertea et al., 2001), and FGENESH (http://www.softberry.com/berry.phtml ...


Developmental & Comparative Immunology
Volume 38, Issue 1, September 2012, Pages 1–9 DOI: 10.1016/j.dci.2012.03.001

Snakes antibodies

Francisco Gambon-Deza a, Christian Sanchez-Espinel b, Serafin Mirete-Bachiller a, Susana Magadan-Mompo c
a Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain b Shared Unit of Immunology, University of Vigo – Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As Lagoas-Marcosende, Vigo 36310, Pontevedra, Spain

... previously published reptile immunoglobulin mRNAs. Limits were deduced following instructions in the software FGENESH (http://www.softberry.com) and Augustus (http://www.augustus.gobics.de/submission). In Additional File A ...


Bioresource Technology
Volume 130, February 2013, Pages 161–167 DOI: 10.1016/j.biortech.2012.12.067

Characterization of three novel thermophilic xylanases from Humicola insolens Y1 with application potentials in the brewing industry

Yanlong Du et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China b College of Biological Science and Engineering, Bei Fang University of Nationalities, Yinchuan 750021, PR China

... The sequence assembly was performed using the Vector NTI Advance 10.0 software (Invitrogen). Genes, introns, exons and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...


Molecular Plant Pathology
Volume 13, Issue 9, pages 1089–1100, December 2012 DOI: 10.1111/j.1364-3703.2012.00818.x

Degradation of aromatic compounds through the b-ketoadipate pathway is required for pathogenicity of the tomato wilt pathogen Fusarium oxysporum f. sp. lycopersici

Caroline B. Michielse 1,†,*, Linda Reijnen 1,‡, Chantal Olivain 2, Claude Alabouvette 2, Martijn Rep 1
1Plant Pathology, Swammerdam Institute for Life Sciences, University of Amsterdam, Amsterdam, the Netherlands 2UMR 1229 INRA, Universite de Bourgogne Microbiologie du Sol et de l'Environnement, Dijon, France

... 1996). The annotated FOXG_17757 gene lacks a 5' and 3' end. In this article, we suggest a new gene model based on fgenesh and augustus gene prediction software (http://www.softberry.com, http://augustus.gobics.de/). This ...


Theoretical and Applied Genetics
May 2012, Volume 124, Issue 7, pp 1173-1182 DOI: 10.1007/s00122-011-1777-3

Localization of high level of sequence conservation and divergence regions in cotton

Wang et al.,
1. National Key Laboratory of Crop Genetics and Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China

... hmm (Brudno et al. 2003), GENSCAN (Lomsadze et al. 2005) and FGENESH (http://linux1.soft- berry.com). The predicted genes were confirmed using BLASTN queries against the cotton EST database. To annotate genes, predicted ...


Genes & genomics
2012, vol. 34, no4, pp. 379-390

The NPR1 family of transcription cofactors in papaya: insights into its structure, phylogeny and expression

Santy et al.,
(1) Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan (CICY), C. 43, No. 130, Col. Chuburna de Hidalgo, Merida, Yucatan, Mexico

... Page 3. Genes & Genomics 1997). The open reading frames (ORFs) in the papaya DNA contigs harboring NPR1 homologues were predicted by the FGENESH program with the A. thaliana genome set as refer- ence (http://linux1.softberry.com/berry.phtml). ...


Applied Microbiology and Biotechnology
November 2012, Volume 96, Issue 4, pp 951-962 DOI: 10.1007/s00253-012-3873-y

Expression and characterization of a novel metagenome-derived cellulase Exo2b and its application to improve cellulase activity in Trichoderma reesei

Geng et al.,
1. Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Fenglin Rd 300, Shanghai, 200032, China 2. Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China

... The resulting reads were assembled using Newbler version 2.0 (http://www.454.com). ORFs in the assembled sequences were predicted by FGENESB (Softberry, Goteborg, Sweden) and a BLASTX search performed against the NR database to access annotation information. ...


ChemBioChem
Volume 13, Issue 17, pages 2583–2592, November 26, 2012 DOI: 10.1002/cbic.201200523

Identification of the Verruculogen Prenyltransferase FtmPT3 by a Combination of Chemical, Bioinformatic and Biochemical Approaches

Kathrin Mundt 1, Beate Wollinsky 1, Prof. Dr. Han-Li Ruan 2, Assoc. Prof. Dr. Tianjiao Zhu 3, Prof. Dr. Shu-Ming Li1
1Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie und Biotechnologie, Deutschhausstrasse 17A, 35037 Marburg (Germany) 2Huazhong University of Science and Technology, Faculty of Pharmacy, Tongji Medical College and Hubei Key Laboratory of Natural Medicinal Chemistry and Resource Evaluation, Hongkong Road 13, 430030, Wuhan (China)

... Computer-assisted sequence analysis: The DNASIS software package (version 2.1; Hitachi Software Engineering, San Bruno, CA) and FGENESH (Softberry, Inc.; http://www.softberry.com/ berry.phtml) were used for intron prediction and sequence analysis, respectively. ...


Molecular Genetics and Genomics
May 2012, Volume 287, Issue 5, pp 373-388 DOI: 10.1007/s00438-012-0682-z

Comparative mapping, genomic structure, and expression analysis of eight pseudo-response regulator genes in Brassica rapa

Jin A. Kim et al.,
1. Department of Agricultural Bio-resources, National Academy of Agricultural Science, Rural Development Administration, 224 Suinro Gwonseon-gu, Suwon, Gyeonggi-do, 441-707, Republic of Korea 2. National Instrumentation Center for Environmental Management, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-742, Republic of Korea

... gov/BLAST/) were used when needed. Gene annotation was achieved using the Web-based gene-prediction program FGENESH Arabid- opsis (http://www.softberry. com/berry.phtml). A phylogenetic tree was constructed using ...


FEBS Journal
Volume 279, Issue 4, pages 572–585, February 2012 DOI: 10.1111/j.1742-4658.2011.08446.x

Identification and expression analysis of three novel splice variants of protein kinase A catalytic b subunit gene in the mouse using combinatorial in silico and molecular biology approaches

Abdul R. Banday, Shafquat Azim, Mohammad Tabish
Department of Biochemistry, Faculty of Life Sciences, AM University, Aligarh, India

... The FGENESH tool (http://www.softberry.ru/berry.phtml) was used for defining the structural features of gene under study. The ... sequence motifs/rules [53,54]. FEX tool (http://www.softberry.ru/berry.phtml) was used for validation of new ...


Theoretical and Applied Genetics
August 2012, Volume 125, Issue 4, pp 715-729 DOI: 10.1007/s00122-012-1863-1

Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic and low linolenic acid contents

Qingyong Yang et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China

... The nonredundant sequences resulted from the hits were then collected and compared with known FAD2 and FAD3 genes in Arabidopsis . The program FGENESH (HMM-based gene structure prediction tool) was used for gene prediction (http:// www.softberry.com/). ...


Molecular Biology Reports
April 2012, Volume 39, Issue 4, pp 3375-3383 DOI: 10.1007/s11033-011-1108-4

Differentially expressed three non-coding alternate exons at 5? UTR of regulatory type I beta subunit gene of mouse

Abdul Rouf Banday, Shafquat Azim, Mohammad Tabish
1. Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, UP, 202002, India

... Gene/ Exon finding tools were used at HMMgene (http://www.cbs. dtu.dk/services/HMMgene), Genescan (http://genes.mit.edu/ GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/software/ GeneSplicer/), FGENESH (http://www.softberry.com/berry. phtml). ...


Canadian Journal of Microbiology
2012, 58(7): 815-827, DOI: 10.1139/w2012-054

Gene cloning, molecular modeling, and phylogenetics of serine protease P32 and serine carboxypeptidase SCP1 from nematophagous fungi Pochonia rubescens and Pochonia chlamydosporia

Eduardo Larriba, a,c Jose Martin-Nieto, b,c Luis Vicente Lopez-Llorca a,c
aDepartment of Marine Sciences and Applied Biology, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain. bDepartment of Physiology, Genetics and Microbiology, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain.

... lyon1.fr/cap3.php. Gene prediction was made using FGENESH/HMM based on Neurospora genes (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group= programs&subgroup =gfind). Pairwise alignments were carried ...


PNAS
August 7, 2012 vol. 109 no. 32 E2155-E2164 DOI: 10.1073/pnas.1117982109

Positional cloning and characterization reveal the molecular basis for soybean maturity locus E1 that regulates photoperiodic flowering

Zhengjun Xia et al.,
aNortheast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin 150081, China; bSoybean Applied Genomics Research Unit, National Institute of Agrobiological Sciences, Tsukuba 305-8602, Japan;

... 2 B and C). A single intron-free gene (AB552962, 525 bp, 174 aa) was consistently identified by GenScan (45), GeneMark (46), FGENESH (http://linux1.softberry.com/berry.phtml), and RiceGAAS (44) for the dominant E1 genotype (Misuzudaizu and Harosoy-E1), and was ...


Comparative and Functional Genomics
Volume 2012 (2012), Article ID 914843, 14 pages doi:10.1155/2012/914843

In Silico Identification and Comparative Genomics of Candidate Genes Involved in Biosynthesis and Accumulation of Seed Oil in Plants

Arti Sharma and Rajinder Singh Chauhan
Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan 173 215, India

... Rapa, and soybean sequences were further annotated for gene models (open reading frames, including the 5?UTRs and 3?UTRs) using gene prediction algorithms of FGenesH (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) [43– ...


Genetics
August 17, 2012 genetics.112.144436 DOI:10.1534/genetics.112.144436

High Throughput Discovery of Mutations in tef Semi-dwarfing Genes by Next Generation Sequencing Analysis

Qihui Zhu et al.,
1 University of Georgia; 2 Purdue University

... The complete clone sequences were submitted to GenBank (Accession numbers: JN672669-JN672670). The fosmid sequences were initially annotated by FGENESH (http://www.softberry.com) and GENESCAN (Buger and Karlin 1997). Putative proteins ...


Theoretical and Applied Genetics
November 2012, Volume 125, Issue 7, pp 1525-1537 DOI: 10.1007/s00122-012-1931-6

Development of candidate gene markers associated to common bacterial blight resistance in common bean

Chun Shi et al.,
1. Greenhouse and Processing Crops Research Centre, Agriculture and Agri-Food Canada, Harrow, ON, N0R 1G0, Canada 2. Department of Plant Agriculture, University of Guelph, Crop Science Building, Guelph, ON, N1G 2W1, Canada

... for Bio- technology Information (NCBI) database. Gene predictions were based on ab initio method by FGENESH software using Medicago gene model (http://www. softberry.com). Sequences were subjected to BlastN similarity ...


Mol Genet Genomics.
2012 Oct;287(10):765-84. Epub 2012 Aug 24.

Auxin response factor gene family in Brassica rapa: genomic organization, divergence, expression, and evolution

Mun JH et al.,
Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural Development Administration, 150 Suin-ro, Gwonseon-gu, Suwon 441-707, Korea

... Since the draft B. rapa genome did not provide information on the 50- and 30-UTR regions of the gene models, we used in-house trained FGENESH (www. softberry.com) to predict the 50- and 30-UTR regions of the BrARF genes. ...


PLoS ONE
7(9): e45307. doi:10.1371/journal.pone.0045307

Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene Families in the Poaceae.

Cockram et al.,
1 John Bingham Laboratory, National Institute of Agricultural Botany, Huntington Road, Cambridge, United Kingdom, 2 Leibniz Institute for Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany, 3 Leibniz Institute for Age Research, Fritz Lipmann Institute (FLI), Jena, Germany, 4 Department of Computational and Systems Biology, John Innes Centre, Norwich, United Kingdom

... helmholtz-muenchen.de/plant/triticeae/) or fl-cDNAs [40]. De novo gene predictions and reassessments were conducted using FGENESH (http://www.softberry.com/) using 'monocot' as the basis of gene prediction. Homology ...


PLoS ONE
7(9): e45307. doi:10.1371/journal.pone.0045307

Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene Families in the Poaceae

Cockram et al.,
John Bingham Laboratory, National Institute of Agricultural Botany, Huntington Road, Cambridge, United Kingdom Leibniz Institute for Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany

...De novo gene predictions and reassessments were conducted using FGENESH (http://www.softberry.com/) using ‘monocot’ as the basis of gene prediction. ...


African Journal of Biotechnology
Vol. 11(77), pp. 14123-14131, 25 September, 2012 DOI: 10.5897/AJB12.778

Molecular cloning and characterization of an acyl-ACP thioesterase gene (AhFatB1) from allotetraploid peanut (Arachis hypogaea L.)

Wen Qigen, Lei Yong, Huang Jiaquan, Jiang Huifang and Liao Boshou
Oil Crop Research, Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture, P. R. China.

... The theoretical molecular weight and isoelectric point of deduced polypeptide were predicted using the ProtParam program (http://www.expasy.ch/tools/protparam.html), and Exon-Intron analysis was made with the FGENESH program (http://linux1.softberry.com/). ...


Molecular Genetics and Genomics
March 2012, Volume 287, Issue 3 , pp 189-203 DOI: 10.1007/s00438-011-0671-7

Transcriptome analysis of rin mutant fruit and in silico analysis of promoters of differentially regulated genes provides insight into LeMADS-RIN-regulated ethylene-dependent as well as ethylene-independent aspects of ripening in tomato

Rahul Kumar, Manoj K. Sharma, Sanjay Kapoor, Akhilesh K. Tyagi, Arun K. Sharma
1. Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, 110021, India 2. Department of Plant Pathology, University of California, Davis, CA, 95616, USA

... Gene structure of these BAC sequences was predicted using FGENESH (http://linux1. softberry.com/berry.phtml?topic=fgenesh& group=programs&subgroup=gfind) and 2 kb sequences upstream to predicted open reading frames were extrac- ted. ...


Molecular Biology Reports
Volume 40, Issue 2 , pp 1385-1396 DOI: 10.1007/s11033-012-2182-y

Characterization of the NADP-malic enzymes in the woody plant Populus trichocarpa

Yu et al.,
1. State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, 26 Hexing Road, Harbin, 150040, China

... We performed the PtNADP-ME4 gene structure (exons and introns) prediction using the FGENESH program on the SoftBerry server (http://www.soflberry.corn/berry.phtml), and present new predicted PtNADP-ME4 gene sequences (Table S1). ...


Plant Disease
February 2013, Volume 97, Number 2 Pages 245-251 http://dx.doi.org/10.1094/PDIS-11-11-0941-RE

Chromosomal Mapping and QTL Analysis of Resistance to Downy Mildew in Cucumis sativus

Zhang et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China; College of Agriculture, Guizhou University, Guiyang 550025, China

... Only matches with an identity of ? 95% were retained. Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and veriWed by FGENESH (http://sunl.softberry. com/) (40), GENESCAN (http://genes.mit.edu/GENSCAN.html) (4), TwinScan ...


PLoS ONE
7(12): e53401. doi:10.1371/journal.pone.0053401

A Novel Family of Terminal-Repeat Retrotransposon in Miniature (TRIM) in the Genome of the Red Harvester Ant, Pogonomyrmex barbatus

Yihong Zhou, Sara Helms Cahan
Department of Biology, University of Vermont, Burlington, Vermont, United States of America

... assembly. Elements along with their flanking sequences were submitted to FGENESH program (Softberry, Inc., http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind) for gene prediction. ...


J Hered
(2012) doi: 10.1093/jhered/ess102

Identification and Characterization of a Homologue to the Arabidopsis INDEHISCENT Gene in Common Bean

Gioia T, Logozzo G, Kami J, Zeuli PS, Gepts P.
From the Scuola di Scienze Agrarie, Forestali, Alimentari ed Ambientali, Universita degli Studi della Basilicata, Viale dell’Ateneo Lucano 10, 85100 Potenza, Italy (Gioia, Logozzo, Spagnoletti Zeuli); and the Department of Plant Sciences/MS1, University of California, 1 Shields Avenue, Davis, CA 95616–8780 (Kami and Gepts).

... with AtIND. Gene structure was predicted using the software FGENESH (http://linux1.softberry.com/berry.phtml), whereas the search for ORFs was performed using ORF finder (http://www.ncbi.nlm.nih.gov/projects/gorf/). To identify ...


Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 223-234 DOI: 10.1007/s00122-012-1827-5

Map-based cloning of a recessive genic male sterility locus in Brassica napus L. and development of its functional marker

Li et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China 2. Institute of Industrial Crops, Henan Academy of Agricultural Science, Zhengzhou, 450002, China

... Gene prediction and plant transformation The website-based software FGENESH (http://www.soft berry.com) was applied to predict the putative ORF from the candidate region. The genomic or coding sequences of predicted genes were submitted to NCBI (http://www.ncbi. ...


New Phytologist
Volume 197, Issue 2, pages 416–430, January 2013 DOI: 10.1111/nph.12026

Methylome of DNase I sensitive chromatin in Populus trichocarpa shoot apical meristematic cells: a simplified approach revealing characteristics of gene-body DNA methylation in open chromatin state

Lafon-Placette et al.,
1Universite d'Orleans, Faculte des Sciences, Laboratoire de Biologie des Ligneux et des Grandes Cultures (LBLGC), Orleans, France 2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), Orleans, France

... Identification of transposase was performed using Fgenesh software (http://linux1.softberry.com/ berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) and confirmed by TBlastX analysis (e-value < 10 ?30 ) on a flowering plant transcripts database. ...


BMC Genomics
2012, 13:409 http://www.biomedcentral.com/1471-2164/13/409

Evolution of the Rdr1 TNL-cluster in roses and other Rosaceous species

Diro Terefe-Ayana, Helgard Kaufmann, Marcus Linde and Thomas Debener
Institute for Plant Genetics, Leibniz University Hannover, Herrenhaeuser Str. 2, Hannover 30419, Germany

... Gene prediction and annotation based on the completely assembled sequence was carried out using the gene prediction program FGENESH (http://www.softberry.com). ...


Journal of Plant Interactions
Volume 8, Issue 1, 2013 pages 34-44 DOI: 10.1080/17429145.2012.721523

Positive selection pressure on rice blast resistance allele Piz-t makes it divergent in Indian land races

Thakur et al.,
a National Research Centre on Plant Biotechnology, IARI, New Delhi, 110012, India b Deparment of Biotechnology, Himachal Pradesh University, Shimla, 171005, India

... [CrossRef], [PubMed], [Web of Science ®], [CSA] View all references) and manually edited using BioEdit Software version 7.0.9.0 (www.mbio.ncsu.edu). Gene coding regions were predicted with FGENESH (www.softberry.com) using the Piz-t sequence as reference. ...


Mycology: An International Journal on Fungal Biology
Volume 3, Issue 1, 2012 pages 54-64 DOI: 10.1080/21501203.2011.654353

Two arginine biosynthesis genes are essential for pathogenicity of Colletotrichum higginsianum on Arabidopsis

Hiroyuki Takahara ab*, Aurelie Huser b & Richard O'Connell b
a Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, Nonoichi, Ishikawa, Japan b Max Planck Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, Cologne, Germany

... 2007) and the FGENESH prediction tool using Fusarium and Magnaporthe matrices (Softberry Inc., Mount Kisco, NY, USA). Sequence homology searches were performed against the NCBI nr protein data base using appropriate BLAST algorithms. ...


PLoS ONE
7(9): e44264. doi:10.1371/journal.pone.0044264

Identification and Sequence Analysis of Metazoan tRNA 3?-End Processing Enzymes tRNase Zs.

Wang et al.,
Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, Nanjing, China

... The splicing pattern was verified using the Fgenesh and Fgenesh_GC programs provided at the Softberry website (http://linux1.softberry.com/berry.phtml??topic=fgenesh). ...


Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 211-222 DOI: 10.1007/s00122-012-1826-6

Exploiting comparative mapping among Brassica species to accelerate the physical delimitation of a genic male-sterile locus (BnRf) in Brassica napus

Yanzhou Xie et al.,
1. National Key Laboratory of Crop Genetic Improvement, National Center of Rapeseed Improvement (Wuhan Branch), Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China 2. College of Agriculture, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China

... Biosystems, Foster City, CA, USA). Software packages FGENESH (http://www.softberry. com) and Glim- merHMM (Majoros et al. 2004) were both applied to pre- dict the putative ORF from the candidate region. The genomic or coding ...


Planta
Volume 237, Issue 1 , pp 279-292 DOI: 10.1007/s00425-012-1756-1

Young Leaf Chlorosis 1, a chloroplast-localized gene required for chlorophyll and lutein accumulation during early leaf development in rice

Kunneng Zhou et al.,
1. National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing, 210095, China 2. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... P0027G10. Within this region, five ORFs were predicted using the program FGENESH 2.2 (http://www. softberry.com) (Fig. 2b). To determine the mutation site, all five cDNA sequences were separately isolated from young leaves. ...


PLoS ONE
7(12): e52293. doi:10.1371/journal.pone.0052293

Full-Length Minor Ampullate Spidroin Gene Sequence.

Chen et al.,
Institute of Biological Sciences and Biotechnology, Donghua University, Shanghai, People's Republic of China Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada

... Fgenesh 2.6 (http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup=gf?ind) was used for intron prediction. ...


BMC Plant Biology
2012, 12:85 DOI: 10.1186/1471-2229-12-85

Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

Chen et al.,
1 School of Agriculture and Food Science, Zhejiang A & F University, Lin'an, Hangzhou, Zhejiang 311300, China 2 State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Resources and Environmental Sciences, Nanjing Agricultural University, Nanjing 210095, China

... As the absence of the cDNA sequence, the exon/intron structure of GaSus2 was predicted online using the FGENESH algorithm (http://linux1.softberry.com/berry.phtml), which resulted in the definition of 10 putative introns within its putative coding regions. ...


Genomics
Volume 99, Issue 4, April 2012, Pages 241–245 DOI:10.1016/j.ygeno.2012.01.007

Evolutionary genomics reveals the premetazoan origin of opposite gating polarity in animal-type voltage-gated ion channels

Xinjiang Cai
Division of Cardiology, Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA Department of Molecular Pathogenesis, New York University Langone Medical Center, New York, NY 10016, USA

... In cases when TBlastN searches identified putative genes of interest that had not been annotated, or when currently annotated genes in the databases were believed to be incomplete, GeneMark.hmm and FGENESH programs (http://www.softberry.com/berry.phtml?topic ...


BMC Genomics
2012, 13:253 doi:10.1186/1471-2164-13-253

Comprehensive analysis of CCCH zinc finger family in poplar (Populus trichocarpa)

Chai et al.,
1 Key Laboratory of Biofuels, Chinese Academy of Sciences, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, 266101, PR China 2 Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA, 30602, USA

... Subsequently, manual reannotation was performed to correct the putative CCCH sequences using online web server FGENESH (http://linux1.softberry.com/berry.phtml webcite). In this endeavor, 12 protein sequences were corrected for further analysis. ...


ChemBioChem
Volume 13, Issue 12, pages 1798–1804, August 13, 2012 DOI: 10.1002/cbic.201200187

Characterization of the Suillus grevillei Quinone Synthetase GreA Supports a Nonribosomal Code for Aromatic a-Keto Acids

Barbara Wackler 1, Dr. Gerald Lackner 1, Dr. Yit Heng Chooi 1, 2, Prof. Dr. Dirk Hoffmeister 1
1Friedrich-Schiller-Universitat, Department Pharmaceutical Biology at the Hans-Knoll-Institut, Beutenbergstrasse 11a, 07745 Jena (Germany) 2Current Address: University of California, Los Angeles, Department of Chemical and Biomolecular Engineering, Los Angeles, CA 90095 (USA)

... The DNA sequence of the combined insert sequences of these cosmids has been deposited in GenBank (#JQ681152) and was submitted to FGENESH (Softberry, Mount Kisco, NY) and to the BLAST server,29 to identify genes and exon/intron junctions. ...


The Plant Journal
Volume 72, Issue 1, pages 142–153, October 2012 DOI: 10.1111/j.1365-313X.2012.05072.x

The sunflower (Helianthus annuus L.) genome reflects a recent history of biased accumulation of transposable elements

Staton et al.,
1 Department of Genetics, University of Georgia, Athens, GA 30602, USA 2 Division of Biology, 426 Ackert Hall, Kansas State University, Manhattan, KS 66506, USA

... The bias in the EST matches to Gypsy elements, and the biased genomic abundance of these sequences are shown in the tracks below the predicted genes. Gene predictions were made using fgenesh (http://www.softberry.com) and maker (http://gmod.org/wiki/MAKER). ...


Chemistry & Biology
Volume 19, Issue 12, 21 December 2012, Pages 1611–1619 DOI: 10.1016/j.chembiol.2012.10.010

Terpendole E, a Kinesin Eg5 Inhibitor, Is a Key Biosynthetic Intermediate of Indole-Diterpenes in the Producing Fungus Chaunopycnis alba

Takayuki Motoyama1, Toshiaki Hayashi1, Hiroshi Hirota1, Masashi Ueki1, Hiroyuki Osada1
1 Chemical Biology Core Facility, Chemical Biology Department, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198, Japan

... Nucleotide and amino acid sequence data were analyzed by DNASIS-Mac software (Hitachi Software Engineering, Tokyo, Japan). Open reading frames were predicted by FGENESH and FGENESH + software (Softberry, Mount Kiscko, NY). Construction of Recombinant Strains. ...


BMC Genomics
2012, 13:553 doi:10.1186/1471-2164-13-553

Sequencing of the core MHC region of black grouse (Tetrao tetrix) and comparative genomics of the galliform MHC

Biao Wang 1*, Robert Ekblom 2, Tanja M Strand 1,3, Silvia Portela-Bens 1 and Jacob Hoglund 1
1 Population Biology and Conservation Biology, Department of Ecology and Genetics, Evolutionary Biology Centre, Uppsala University, Norbyvagen 18 D, Uppsala, SE-752 36, Sweden 2 Evolutionary Biology, Department of Ecology and Genetics, Evolutionary Biology Centre, Uppsala University, Norbyvagen 18 D, Uppsala, SE-752 36, Sweden

... Identification of coding regions and putative exons was conducted by three different gene prediction programs: Fgenesh ( http://www.softberry.com webcite), GeneMark.hmm ( http://exon.gatech.edu webcite) and Genscan ( http://genes.mit.edu/GENSCAN.html webcite) [ ...


PNAS
August 21, 2012 vol. 109 no. 34 13716-13721 DOI: 10.1073/pnas.1121096109

Rapid divergence and expansion of the X chromosome in papaya

Gschwend et al.,
aDepartment of Plant Biology, University of Illinois at Urbana–Champaign, Urbana, IL 61801; bTexas AgriLife Research Center, Department of Plant Pathology and Microbiology, Texas A & M University, Weslaco, TX 78596;

... V. monoica Gene Prediction. Genes were predicted in the V. monoica BACs using Genscan (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://linux1.softberry.com/berry.phtml), as well as homology to papaya-expressed sequence tags (ESTs) and gene models. ...


Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 273-284 DOI: 10.1007/s00122-012-1832-8

Fine mapping of fw3.2 controlling fruit weight in tomato

Na Zhang, Marin Talbot Brewer, Esther van der Knaap
1. Department of Horticulture and Crop Science, The Ohio State University/OARDC, 217A Williams Hall, 1680 Madison Avenue, Wooster, OH, 44691, USA 2. Department of Plant Pathology, University of Georgia, Athens, GA, USA

... The sequence of the BAC C03Hba0051C24 encompassing fw3.2 was analyzed with the ab initio gene prediction pro- grams FGENESH (http://www.softberry.com/berry.phtml) (Salamov and Solovyev 2000) and is consistent with the recently released annotation of the tomato ...


BMC Genomics
2012, 13:444 http://www.biomedcentral.com/1471-2164/13/444 doi:10.1186/1471-2164-13-444

Comparative genomics of the white-rot fungi, Phanerochaete carnosa and P. chrysosporium, to elucidate the genetic basis of the distinct wood types they colonize

Suzuki et al.,
1 Department of Chemical Engineering & Applied Chemistry, University of Toronto, 200 College Street, Toronto, ON M5S 3E5, Canada

...Using the repeat-masked assembly, several gene prediction programs falling into three general categories were used: 1) ab initio - FGENESH [52]; GeneMark [53], 2) homology-based - FGENESH+; Genewise [54] seeded by BLASTx alignments against GenBank’s database of non-redundant proteins (NR: [55]), and 3) EST-based - EST_map [56] seeded by EST contigs....


BMC Genomics
2012, 13:270 http://www.biomedcentral.com/1471-2164/13/270 doi:10.1186/1471-2164-13-270

The WRKY transcription factor family in Brachypodium distachyon

Tripathi et al.,
1 Department of Biology and Microbiology, South Dakota State University, Brookings, SD 57007, USA

... Each potential gene was then manually curated using both FGENESH [38] and...


PLoS ONE
7(3): e32658. doi:10.1371/journal.pone.0032658

Membrane Topology and Predicted RNA-Binding Function of the ‘Early Responsive to Dehydration (ERD4)’ Plant Protein

Archana Rai, Penna Suprasanna, Stanislaus F. D'Souza, Vinay Kumar
Nuclear Agricultural & Biotechnology Division, Bhabha Atomic Research Centre, Mumbai, India High Pressure & Synchrotron Radiation Physics Division, Bhabha Atomic Research Centre, Mumbai, India

...Gene structure study was performed using popular gene finding pipeline (FGENESH at www.softberry.com)...


BMC Genomics
2012, 13:171 doi:10.1186/1471-2164-13-171

Genomic characterization of the conditionally dispensable chromosome in Alternaria arborescens provides evidence for horizontal gene transfer

Hu et al.,
1 Department of Plant Pathology, The Ohio State University, Columbus, OH 43210, USA 2 Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430, USA

... Gene prediction, codon usage analysis & repetitive DNA identification. Gene prediction was conducted using FGENESH [47], an ab initio gene predictor provided in the Softberry website. A pre-trained Alternaria matrix was used to optimize predictions. ...


BMC Genomics
2012, 13:674 doi:10.1186/1471-2164-13-674

Design of a tobacco exon array with application to investigate the differential cadmium accumulation property in two tobacco varieties

Martin et al.,
1 Philip Morris International R&D, Philip Morris Products SA, Neuchatel 2000, Switzerland 2 Institut fur Mathematik und Informatik, Greifswald D-17487, Germany

...FGENESH was trained for tobacco by SoftBerry Inc. and run as an ab initio gene finder with default parameters. Further iterations of the tobacco genome assembly were also ...


The Plant Journal
Volume 72, Issue 2, pages 212–221, October 2012 DOI: 10.1111/j.1365-313X.2012.05059.x

Dynamic evolution of bz orthologous regions in the Andropogoneae and other grasses

Qinghua Wang 1, Hugo K. Dooner 1,2
1 Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA 2 Department of Plant Biology, Rutgers University, New Brunswick, NJ 08901, USA

... The Fgenesh gene prediction program (http://www.softberry.com) was used to annotate the non-orthologous genes in Coix and sorghum, and adjustment of exon/intron structures was based on the sorghum and rice transcript annotation. ...


Plant Physiology
July 2012 vol. 159 no. 3 1086-1098 doi: http://dx.doi.org/10.1104/pp.112.197483

Altered Chloroplast Development and Delayed Fruit Ripening Caused by Mutations in a Zinc Metalloprotease at the lutescent2 Locus of Tomato

Barry et al.,
Department of Horticulture, Michigan State University, East Lansing, Michigan 48824 (C.S.B., Q.M.) Boyce Thompson Institute for Plant Research, Ithaca, New York 14853 (G.M.A., R.P.M., J.J.G.)

...The prediction of genes within genomic DNA sequence was performed using the FGENESH hidden Markov model-based gene structure prediction program (http://linux1.softberry.com/berry.phtml). ...


Front Plant Sci.
2012; 3: 5. DOI: 10.3389/fpls.2012.00005

TriAnnot: A Versatile and High Performance Pipeline for the Automated Annotation of Plant Genomes

Leroy et al.,
1 UMR 1095, Genetics, Diversity and Ecophysiology of Cereals, Institut National de la Recherche Agronomique-Universite Blaise Pascal, Clermont-Ferrand, France 2 National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan

For ab initio gene prediction, TriAnnot uses four programs: FGeneSH [17], GeneID (Guigo et al., 1992), GeneMarkHMM


BMC Plant Biology
2012, 12:20 doi:10.1186/1471-2229-12-20

Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina

Caruso et al.,
1 Dipartimento di Scienze delle Produzioni Agrarie e Alimentari, Universita degli Studi di Catania, Via Valdisavoia 5, 95123 Catania, Italy 2 Institut Valencia d'Investigacions Agraries - Centre de Genomica, Carretera Montcada de l'Horta-Naquera Km. 4,5, 46113 Montcada de l'Horta (Valencia), Spain

...ORF prediction was based on the genome browser data for each analyzed species as well as Fgenesh analysis http://www.softberry.com...


PLoS ONE
7(2): e32010. doi:10.1371/journal.pone.0032010

A Highly Conserved, Small LTR Retrotransposon that Preferentially Targets Genes in Grass Genomes

Gao D, Chen J, Chen M, Meyers BC, Jackson S
Center for Applied Genetic Technologies and Institute for Plant Breeding Genetics and Genomics, University of Georgia, Athens, Georgia, United States of America State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China

...To predict the sequences in sorghum and maize, 20 kb of flanking sequence (10 kb on each side of the transposon) were analyzed by the FGENESH (http://linux1.softberry.com) and the GeneMark.hmm ...


PLoS Pathog
8(9): e1002952. doi:10.1371/journal.ppat.1002952

Comparative Pathogenomics Reveals Horizontally Acquired Novel Virulence Genes in Fungi Infecting Cereal Hosts

Gardiner DM et al.,
Commonwealth Scientific and Industrial Research Organization (CSIRO) Plant Industry, Queensland Bioscience Precinct, Brisbane, Queensland, Australia Plant Pathology, Institute of Integrative Biology, ETH Zurich, Zurich, Switzerland

...Protein coding genes were ab initio predicted in the F. pseudograminearum genome using FGENESH [52] based on the F. graminearum gene models as part of the MolQuest2 package from Softberry, AUGUSTUS [53] and GeneMark-ES...


PLoS ONE
7(2): e31149. doi:10.1371/journal.pone.0031149

Genome-Wide Identification, Evolutionary Expansion, and Expression Profile of Homeodomain-Leucine Zipper Gene Family in Poplar (Populus trichocarpa)

Hu et al.,
CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, People's Republic of China

... For the misannotated genes, manual reannotation was performed using online web server FGENESH (http://linux1.softberry.com/berry.phtml). ...


Theoretical and Applied Genetics
Volume 125, Issue 5 , pp 1047-1055 DOI 10.1007/s00122-012-1894-7

The isolation of Pi1, an allele at the Pik locus which confers broad spectrum resistance to rice blast

Lixia Hua et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropic Agrobioresources, Laboratory of Plant Resistance and Genetics, College of Natural Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China 2. National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, 305-8602, Japan

... The gene annotation tools RiceGAAS (http://ricegaas.dna.affrc. go.jp) and FGENESH (http://www.softberry.com) were then used to identify Pi1 candidates within the 277-kb segment of cv. Nipponbare defined by the closest flanking markers (CRG11-7 and K28). ...


Bioresource Technology
Volume 121, October 2012, Pages 404–410 http://dx.doi.org/10.1016/j.biortech.2012.07.027

Two neutral thermostable cellulases from Phialophora sp. G5 act synergistically in the hydrolysis of filter paper

Junqi Zhao et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... Transcription initiation sites and intron and exon information were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The presence of signal peptides was predicted using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP/). ...


Theoretical and Applied Genetics
Volume 125, Issue 4 , pp 773-779 DOI 10.1007/s00122-012-1870-2

Fine mapping and candidate gene analysis of the nuclear restorer gene Rfp for pol CMS in rapeseed (Brassica napus L.)

Zhi Liu et al.,
1. National Key Lab of Crop Genetic Improvement, National Center of Rapeseed Improvement (Wuhan Branch), Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... Candidate gene identification and sequence analysis The online system FGENESH (http://www.softberry.com) was used to identify predicted ORFs in the delimited gene region. ... b Candidate region of the Rfp locus and the predicted gene from http://www.softberry. com. ...


Plant Molecular Biology Reporter
Volume 30, Issue 4 , pp 1025-1031 DOI 10.1007/s11105-011-0408-0

Identification and Association Analysis of Castor Bean Orthologous Candidate Gene-Based Markers for High Oil Content in Jatropha curcas

Arti Sharma (1) Rajinder Singh Chauhan (1)
1. Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan, 173 215, HP, India

... gene sequences from other plants (Arabidopsis, Brassica, Medicago, sunflower, soybean, and cotton) were downloaded and annotated for open reading frames, including the 5? and 3?UTRs using gene prediction algorithms of FGenesH (http://sun1.softberry.com/berry. ...


The Journal of Biological Chemistry
doi: 10.1074/jbc.M111.317982 January 6, 2012, 287, 1371-1380.

Biochemical Characterization of Indole Prenyltransferases FILLING THE LAST GAP OF PRENYLATION POSITIONS BY A 5-DIMETHYLALLYLTRYPTOPHAN SYNTHASE FROM ASPERGILLUS CLAVATUS

Xia Yu ‡,1, Yan Liu ‡§,2, Xiulan Xie ¶, Xiao-Dong Zheng § and Shu-Ming Li ‡,3
From the ‡Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037 Marburg, Germany, the §Department of Food Science and Nutrition, Zhejiang University, 310058 Hangzhou, Zhejiang, China, and the ¶Fachbereich Chemie, Philipps-Universitat Marburg, Hans-Meerwein-Strasse, 35032 Marburg, Germany

... gov). FGENESH from Softberry and the DNASIS software package (version 2.1, Hitachi Software Engineering, San Bruno, CA) were used for exon prediction and sequence analysis, respectively. Chemicals. Dimethylallyl diphosphate ...


Functional & Integrative Genomics
Volume 12, Issue 3 , pp 489-500 DOI 10.1007/s10142-012-0283-2

New cis-regulatory elements in the Rht-D1b locus region of wheat

Jialei Duan et al.,
1. College of Biology Sciences, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District, 100094, Beijing, People’s Republic of China

... usda.gov/ITMI/Repeats/gene_annotation.pdf). Gene pre- dictions were accomplished mainly by using the program FGENESH with the monocot (corn, rice, wheat, and barley) training set (http://www.softberry.com). GENSCANW ...


Molecules and Cells
Volume 33, Issue 4 , pp 415-422 DOI 10.1007/s10059-012-0017-2

Ectopic expression of Capsicum-specific cell wall protein Capsicum annuum senescence-delaying 1 (CaSD1) delays senescence and induces trichome formation in Nicotiana benthamiana

Eunyoung Seo et al.,
2. Department of Plant Science, Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea 1. Seeders Inc., Daejeon, 305-509, Korea

... an- nuum 'CM334' (Yoo et al., 2003). Both the gene-coding region and the 3? untranslated region were predicted using the FGENESH program (http://linux1. softberry.com/berry.phtml). Gene-specific primers were designed for ...


Mol Biol Evol
(2012) 29 (1): 91-100. doi: 10.1093/molbev/msr149

Ancestral Ca2+ Signaling Machinery in Early Animal and Fungal Evolution

Xinjiang Cai *,1 and David E. Clapham * 2,3
1Molecular Pathogenesis Program, The Skirball Institute of Biomolecular Medicine, New York University Langone Medical Center 2Howard Hughes Medical Institute, Department of Cardiology, Children's Hospital Boston 3Department of Neurobiology, Harvard Medical School

... 2005) and FGENESH programs (http://www.softberry.com/berry.phtml?topic=index&group= programs&subgroup=gfind) were used to predict the genes of interest by using identified DNA segments and their neighboring regions of genomic sequences. ...


POJ
5(2):94-102 (2012)

Genome-wide analysis of cytosolic and chloroplastic isoforms of glutathione reductase in plant cells

Ahmad Tahmasebi 1, Farzaneh Aram 2, Mansour Ebrahimi 3, Manijeh Mohammadi-Dehcheshmeh 4, Esmaeil Ebrahimie 1&5*
1Department of Crop Production & Plant Breeding, College of Agriculture, Shiraz University, Shiraz, Iran 2Institute of Biotechnology, College of Agriculture, Shiraz University, Shiraz University, Shiraz, Iran

...Genomic sequences were also analyzed in the FGENESH gene structure prediction program (http://www.softberry.com) and GeneMark program (http://opal.biology.gatech.edu/GeneMark).... ...Protein sorting and subcellular localization predictions were performed according to ProtComp program Version 5 (http://www.softberry.com/)...


Phytopathology
May 2012, Volume 102, Number 5 Pages 506-518 http://dx.doi.org/10.1094/PHYTO-06-11-0180

Evidence for Morphological, Vegetative, Genetic, and Mating-Type Diversity in Sclerotinia homoeocarpa

Daniele Liberti, Jeffrey A. Rollins, and Philip F. Harmon
Department of Plant Pathology, 1453 Fifield Hall, University of Florida, Gainesville 32611.

... analysis. Protein prediction analysis was performed using ab initio gene prediction software FGENESH (36) running on the Softberry web interface (http:// www.softberry.com) selecting S. sclerotiorum as the reference ge- nome. ...


Phytopathology
February 2012, Volume 102, Number 2 Pages 222-228 http://dx.doi.org/10.1094/PHYTO-03-11-0075

Identification and Fine-Mapping of Xa33, a Novel Gene for Resistance to Xanthomonas oryzae pv. oryzae

P. Natraj Kumar et al.,
Directorate of Rice Research, Rajendranagar, Hyderabad 500 030, India.

... Identification of putative candidate genes. The genomic se- quence between the flanking SSR markers was downloaded from Japonica rice genome and analyzed using the online software FGENESH (http://www.softberry.com). ... softberry.com). ...


Plant and Soil
July 2012, DOI 10.1007/s11104-012-1345-x

The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber

M. Migocka, A. Warzybok, G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland

... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was determined using FGENESH or FGENESH+ programs available on softberry.com ...


Molecular Genetics and Genomics
Volume 287, Issue 4 , pp 295-311 DOI 10.1007/s00438-012-0675-y

Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model

Jian Wu et al.,
1. Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Department of Horticulture, Zhejiang University, 310058, Hangzhou, People’s Republic of China

... After searching for IAA genes, bioinformatics tools, such as DNASTAR and FGENESH (http://linux1.softberry.com/berry) were used to analyze and predict those unknown IAAs. Isolation of the open reading frame (ORF) cDNA sequences ...


Gene
Volume 499, Issue 1, 10 May 2012, Pages 108–120 http://dx.doi.org/10.1016/j.gene.2012.01.048

Genome-wide analysis of the mitogen-activated protein kinase gene family in Solanum lycopersicum

Fuling Kong et al.,
Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Department of Horticulture, Zhejiang University, Hangzhou 310058, People's Republic of China

... After searching for MAPK gene family, DNASTAR and FGENESH (http://linux1.softberry.com/berry) were used to analyze and predict those MAPK domains. ... Each predicted SlMAPK sequence was confirmed by FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...


Journal of Integrative Plant Biology
Volume 54, Issue 5, pages 321–329, May 2012 DOI: 10.1111/j.1744-7909.2012.01112.x

Identification and Fine Mapping of rhm1 Locus for Resistance to Southern Corn Leaf Blight in Maize

Yuanzeng Zhao et al.,
1 State Key Laboratory of Agrobiotechnology and National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing 100193, China 2 Department of Life Science and Technology, Henan Institute of Science and Technology, Xinxiang 453003, China

... region contains only one putative protein-coding gene using the FGENESH gene prediction program (http://linux1.softberry.com/berry.phtml). This predicted gene was a homologue of ... monocot training set (http://linux1.softberry.com/berry.phtml). The predicted genes were ...


Theoretical and Applied Genetics
September 2012 DOI 10.1007/s00122-012-1975-7

Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.)

D. Huang et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Science and Technology, Agricultural College, Guangxi University, Nanning, 530005, China 2. Rice Research Institute, Plant Protection Institute and Guangxi Rice Genetic Improvement and Biotechnology Lab, Guangxi Academy of Agricultural Sciences, Nanning, 530007, China

... The putative open reading frame (ORF) in the target region was predicted by the online software GENESCAN and FGENESH of Softberry (www.softberry.com/berry.phtml) with monocot plants as the model organism. Host selection behavior ...


Gene
Volume 507, Issue 1, 1 October 2012, Pages 54–60 http://dx.doi.org/10.1016/j.gene.2012.07.004,

Characterization of Aquilegia Polycomb Repressive Complex 2 homologs reveals absence of imprinting

Emily J. Gleason a, b, Elena M. Kramer a,
a Dept. of Organismic and Evolutionary Biology, Harvard University, 16 Divinity Ave. Cambridge, MA, 02138, USA b Dept. of Molecular and Cellular Biology, Harvard University, 16 Divinity Ave. Cambridge, MA, 02138, USA

... the query sequence. We then used the SoftBerry FGENESH program (http://linux1. softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) to predict open reading frames for the loci. cDNA sequences were ...


African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040

Isolation and characterization of a candidate gene for resistance to cereal cyst nematode from Aegilops variabilis in China

D. L. Xu et al.,
1 Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China. 2 Graduate University of the Chinese Academy of Sciences, Beijing, China.

... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...


Theoretical and Applied Genetics
Volume 125, Issue 6 , pp 1125-1135 DOI 10.1007/s00122-012-1899-2

Characterization, fine mapping and expression profiling of Ragged leaves1 in maize

Haiying Guan et al.,
1. Department of Plant Genetics and Breeding, State Key Laboratory of Agrobiotechnology and National Maize Improvement Center of China, China Agricultural University, Beijing, 100193, China 2. Department of Life Science and Technology, Henan Institute of Science and Technology, XinXiang, 453003, China

... 2004). The gene prediction was conducted by Softberry (http://linux1.softberry.com/berry. phtml?topic=fgenesh&group=programs&subgroup=gfind). Transcriptome sequencing and gene annotation The BC3 segregating population was grown in a green- house. ...


Molecular Genetics and Genomics
Volume 287, Issue 3 , pp 247-259 DOI 10.1007/s00438-012-0674-z

Candidate genes within a 143 kb region of the flower sex locus in Vitis

Iris Fechter et al.,
1. Julius Kuhn-Institut, Federal Research Centre for Cultivated Plants, Institute for Grapevine Breeding Geilweilerhof, 76833, Siebeldingen, Germany 2. Center for Biotechnology, Bielefeld University, 33594, Bielefeld, Germany

... PCR amplifications were per- formed to ensure order of contigs in cases of uncertainties. Gene prediction The sequences were annotated from the scaffolds using the software FGENESH (http://linux1.softberry.com/berry. phtml). ...


Braz. J. Plant Physiol.,
24(1): 69-73, 2012

Isolation and in silico characterization of cDNA encoding cyclophilin from etiolated Vigna mungo seedlings

Kalika Kuhar 1 , Varun Kumar Gupta 1 , Rekha Kansal 2 , Vijay Kumar Gupta 1 *
1 Department of Biochemistry, Kurukshetra University, Kurukshetra, Haryana, India. 2 National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (PUSA), New Delhi, India.

... The nucleotide sequence was analyzed in silico using VecScreen program of National Center for Biotechnology Information (NCBI), Basic Local Alignment Search Tool (BLAST), FGENESH program of Softberry web server and BioEdit. ...


Mol Biol Evol
2012, 29 (2): 631-645. doi: 10.1093/molbev/msr208

Zisupton—A Novel Superfamily of DNA Transposable Elements Recently Active in Fish

Astrid Bohne et al.,
1Institut de Genomique Fonctionnelle de Lyon, Universite de Lyon, Universite Lyon 1, Centre National de la Recherche Scientifique, Institut National de la Recherche Agronomique, Ecole Normale Superieure de Lyon, Lyon, France 2Department of Physiological Chemistry I, Biocenter, University of Wurzburg, Wurzburg, Germany

... 10 ?05 . Automatic sequence annotation was refined manually using expressed sequence tag data and related protein sequences with the help of FGENESH on the softberry web server (http://linux1.softberry.com). Nucleotide ...


3 Biotech.
2012 September; 2(3): 199–209. Published online 2012 March 24. doi: 10.1007/s13205-012-0047-7

Cloning, characterization and expression analysis of a novel gene encoding Kunitz-type protease inhibitor from Dolichos biflorus

Kalika Kuhar,1 Rekha Kansal,2 Amit Mishra,2 Kirpa Ram Koundal,2 and Vijay Kumar Gupta 1
1Department of Biochemistry, Kurukshetra University, Kurukshetra, Haryana India 2National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (PUSA), New Delhi, India

... The primers were designed from the coding region of the genes determined through Softberry software following the standard rules and analyzed using Fast PCR software for self-dimers, melting temperature ... 2) as predicted by FGENESH program of Softberry web server. ...


FGENESH 2011

Immunogenetics
2011 Nov;63(11):753-71. doi: 10.1007/s00251-011-0549-1. Epub 2011 Jun 28.

Defining the turkey MHC: identification of expressed class I- and class IIB-like genes independent of the MHC-B

Reed et al.,
Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St Paul, MN 55108, USA

... Final assembly of repeated contigs was confirmed by PCR and resequencing. Gene identification and annotation Sequences were analyzed with Softberry FGENESH and BLAST (http://linux1.softberry.com/all.htm) to identify putative transcripts and homologies to known genes. ...


Journal of Insect Physiology
Volume 58, Issue 4, April 2012, Pages 570–579 DOI: 10.1016/j.jinsphys.2011.12.009

Localization of two Na+- or K+-H+ antiporters, AgNHA1 and AgNHA2, in Anopheles gambiae larval Malpighian tubules and the functional expression of AgNHA2 in yeast

Minghui A. Xiang a, c, Paul J. Linser b, David A. Price b, William R. Harvey b, c, d, e
a Division of Nephrology and Hypertension, Department of Medicine, University of Florida-Jacksonville, Jacksonville, FL 32206, USA b Whitney Mosquito Biology Group, University of Florida, 9505 Ocean Shore Boulevard, St. Augustine, FL 32080, USA

... gambiae that were applied to FGENESH at the Softberry site (http://www.softberry.com/berry.phtml) identified a cDNA from a genomic region of 30 kb; it included the originally predicted cDNA exons and predicted two more exons at the 5? end although it had the same 3 ...


BMC Proceedings
2011, 5(Suppl 7):P65 doi:10.1186/1753-6561-5-S7-P65

Genome characterization of a Eucalyptus natural mutant

Fuchs et al.,
1 Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista (UNESP), Distrito de Rubiao Jr s/n CEP 18618-000, Botucatu (SP), Brazil 2 Departamento de Genetica, Escola Superior de Agricultura “Luiz de Queiroz” (ESALQ), Universidade de Sao Paulo (USP), Avenida Padua Dias, 11 CEP 13418-900, Piracicaba (SP), Brazil

... phytozome.net/ webcite) using BLAST. The genomic region identified was analyzed by FGENESH tool (Softberry, Inc. – http://www.softberry.com webcite) to find predicted genes in the region. Predicted genes were translated ...


Journal of Insect Physiology
Volume 57, Issue 9, September 2011, Pages 1190–1197 DOI: 10.1016/j.jinsphys.2011.05.011

Functions of duplicated genes encoding CCAP receptors in the red flour beetle, Tribolium castaneum

Bin Li a, 1, Richard W. Beeman b, Yoonseong Park a
a Department of Entomology, Waters Hall, Kansas State University, Manhattan, KS 66506, USA b USDA-ARS Center for Grain and Animal Health Research, 1515 College Avenue, Manhattan, KS 66502, USA

... Initial search results were further analyzed using the gene prediction software FGENESH (http://linux1.softberry.com/berry.phtml). Similar methods were used to mine candidate CCAP receptors from other insect genomes for comparisons of gene structures and sequences. ...


Funct Integr Genomics.
2011 Dec;11(4):599-609. doi: 10.1007/s10142-011-0237-0. Epub 2011 Jul 16.

Recent insertion of a 52-kb mitochondrial DNA segment in the wheat lineage

Zhang J, Jia J, Breen J, Kong X.
Key Laboratory of Crop Germplasm Resources and Utilization, MOA/Institute of Crop Science, CAAS/The Key Facility for Crop Gene Resources and Genetic Improvement, Beijing, People's Republic of China

... plot analysis (Krumsiek et al. 2007). Gene prediction and function assignment Gene prediction was performed using FGENESH at softberry web site (http://www.softberry. com) and GENES- CAN. Then, BLASTP against the non ...


Fungal Biology
Volume 116, Issue 2, February 2012, Pages 225–233 DOI: 10.1016/j.funbio.2011.11.005

mrflbA, encoding a putative FlbA, is involved in aerial hyphal development and secondary metabolite production in Monascus ruber M-7

Yishan Yang c, Li Li c, Xin Li c, Yanchun Shao a, c, Fusheng Chen a, b, c,
a State Key Laboratory of Agricultural Microbiology, Wuhan 430070, Hubei Province, PR China b Key Laboratory of Food Safety Evaluation of the Ministry of Agriculture, Wuhan 430070, Hubei Province, PR China

... Specific primers for 3'RACE were designed according to the predicted cDNA sequence of the mrflbA or mga1 gene using SoftBerry's FGENESH program (http://linuxl.softberry.com/ berry.phtml), while primers for 5'RACE were designed according to the sequences obtained by 3 ...


Breast Cancer Research and Treatment
Volume 130, Issue 3 , pp 1003-1010 DOI: 10.1007/s10549-011-1677-x

Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer susceptibility

Vuorela et al.,
1. Laboratory of Cancer Genetics, Department of Clinical Genetics and Biocenter Oulu, University of Oulu, Oulu University Hospital, P.O. Box 5000, 90014, Oulu, Finland 2. Department of Pathology and Forensic Medicine, School of Medicine, Institute of Clinical Medicine, University of Eastern Finland, 70211, Kuopio, Finland

... 2). According to FPROM human promoter prediction software (Softberry, Inc., Mt. ... FGENESH (Softberry, Inc., Mt. Kisco, NY), are abolished. Based on bioinformatics, the observed 27 bp deletion thus produces a null allele, and is pathogenic. ...


Biologia Plantarum
Volume 55, Issue 4 , pp 614-624 DOI: 10.1007/s10535-011-0159-7

Molecular cloning and phylogenetic analysis of cereal type II metacaspase cDNA from wheat

E. Piszczek, M. Dudkiewicz, M. Sobczak
1. Department of Biochemistry, Warsaw University of Life Sciences, 159 Nowoursynowska, PL-02776, Warsaw, Poland 2. Department of Experimental Design and Bioinformatics, Warsaw University of Life Sciences, 159 Nowoursynowska, PL-02776, Warsaw, Poland

... The identification of the coding region, open reading frame and the translation of TaeMCAII nucleotide sequence were made based on the FGENESH gene structure prediction using an HMM model constructed for monocot plants (SoftBerry software http://linux1.softberry.com ...


Plant Cell Reports
Volume 30, Issue 11 , pp 2059-2073 DOI: 10.1007/s00299-011-1113-z

Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum

J. Wu et al.,
1. Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Hangzhou, 310058, People’s Republic of China 2. Department of Horticulture, Zhejiang University, Hangzhou, 310058, People’s Republic of China

... databases. After searching for ARF genes, bioinformatics tools, such as DNASTAR and FGENESH (http://linux1.softberry.com/berry) were used to analyze and predict those unknown SlARFs. ... www. softberry.com/berry.phtml?topic=fgenesh). ...


Sains Malaysiana
40 (4). pp. 331-337. ISSN 0126-6039

Cloning and analysis of pyrG gene encoding orotidine 5-Monophosphate decarboxylase of aspergillus oryzaeStrain S1

Selina Oh Siew Ling, and Leong , Jiun Min and Abdul Munir Abdul Murad, and Nor Muhammad Mahadi , and Farah Diba Abu Bakar
BGI

... 475 bp). The pyrG contained one intron at position 623-687 bp based on the AUGUSTUS and FGENESH (SoftBerry) analysis corresponding to the intron present in the pyrG of A. oryzae (Accession Number: Y13811). In silico ...


Nucl. Acids Res.
(2011) 39 (suppl 1): D637-D639. doi: 10.1093/nar/gkq1016

FGDB: revisiting the genome annotation of the plant pathogen Fusarium graminearum

Wong et al.,
1Helmholtz Zentrum Munchen, German Research Center for Environmental Health, Institute of Bioinformatics and Systems Biology, Ingolstadter Landstrasse 1, D-85764 Neuherberg, 2Max-Planck-Institute for Terrestrial Microbiology, Department of Organismic Interactions, D-35043 Marburg

... Based on this set, all gene loci in FGDB v3.1 were re-annotated using a pipeline including (i) Fgenesh with different matrices (www.softberry.com); (ii) GeneMark-ES (8); (iii) Augustus with ESTs, precedingly annotated Fusarium models and/or Neurospora crassa protein ...


Theoretical and Applied Genetics
Volume 123, Issue 4 , pp 625-633 DOI: 10.1007/s00122-011-1612-x

Fine-mapping of the woolly gene controlling multicellular trichome formation and embryonic development in tomato

Changxian Yang, Hanxia Li, Junhong Zhang, Taotao Wang, Zhibiao Ye
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China 2. Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, 430070, China

... Protein coding genes were predicted from the resul- tant contig using the FGENESH program (http://linux1.soft- berry.com/berry.phtml). ... Analysis of the »200 kb sequence revealed that this fragment contains 19 ORFs as automatically predicted by FGENESH (http://softberry. ...


POJ
4(5):239-249(2011)

Comparative analysis of the genomic regions flanking Xa21 locus in indica and japonica ssp. of rice (Oryza sativa L.)

Kumar et al.,
1Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Gachibowli Prof. C.R. Rao Road , Hyderabad 500046, India 2Department of Plant Pathology, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India

... Protcomp V 8.0 (http://linux1.softberry.com/ berry.phtml) analysis for the sub cellular location of proteins showed that 80% of the predicted TEs were nuclear in localization while the remaining were cytoplasmic or mitochondrial in both the rice lines (Table 9). GC Content in the ... ...Gene prediction from the 100 kb region flanking to Xa21 locus of chromosome 11 in japonica and indica rice was carried out using HMM based gene structure prediction software FGENESH tool (www.softberry.com) trained for monocot plant species (Salamov and Solovyer, 2000) ...


Eukaryotic Cell
doi: 10.1128/EC.05255-11 December 2011 vol. 10 no. 12 1740-1741

Draft Genome Sequence of Penicillium marneffei Strain PM1

Woo et al.,
1Department of Microbiology 2State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong

... genome, were sequenced. The Phred/Phrap/Consed software package was used for base calling and sequence assembly (1,–,5). Protein-coding genes and introns were predicted using FGENESH (Softberry). The draft genome ...


Theoretical and Applied Genetics
Volume 122, Issue 5 , pp 1017-1028 DOI: 10.1007/s00122-010-1506-3

The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes

Yuan et al.,
1. Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China 2. Hubei Academy of Agricultural Science, Wuhan, 430064, China

... Wang et al. 2009). The gene content in the equivalent interval of cv. Nipponbare was predicted using GENESCAN (http://genes.mit.edu/ GENSCAN.html) and FGENESH (http://www.softberry. com). DNA sequence comparisons ...


BMC Proceedings
2011, 5(Suppl 7):O17 doi:10.1186/1753-6561-5-S7-O17

High-throughput targeted SNP discovery using Next Generation Sequencing (NGS) in few selected candidate genes in Eucalyptus camaldulensis

Prasad S Hendre *, Rathinam Kamalakannan, Rathinavelu Rajkumar and Mohan Varghese
ITC R&D Centre, Peenya Insdustrial Area, No.3, 1st Main, 1st Phase, Bangalore- 560 058, Karnataka, India

... block. Web-based gene prediction tool FGENESH (http://linux1.softberry.com webcite) was used for identifying genic regions such as UTRs, exons and introns with Arabidopsis thaliana gene model. Results and discussion. Forty ...


Fungal Biology
Volume 115, Issue 8, August 2011, Pages 775–781 DOI: 10.1016/j.funbio.2011.06.002,

Characterisation of the ArmA adenylation domain implies a more diverse secondary metabolism in the genus Armillaria

Mathias Misiek, Jana Braesel, Dirk Hoffmeister
Friedrich-Schiller-Universitat Jena, Department Pharmaceutical Biology at the Hans-Knoll-Institute, Beutenbergstrasse 11a, 07745 Jena, Germany

... The Aspergillus, Laccaria, or Phanerochaete search algorithms of FGENESH (Softberry, Mount Kisco, NY) were used to predict gene structures and exon/intron junctions in the insert sequences of three previously identified Armillaria cosmids 108, 138, and 152 (Misiek & ...


Mol Biol Evol
(2011) 28 (6): 1913-1926. doi: 10.1093/molbev/msr012

Molecular Evolution of the Metazoan PHD–HIF Oxygen-Sensing System

Kalle T. Rytkonen *,1, Tom A. Williams 2, Gillian M. Renshaw 3, Craig R. Primmer 1 and Mikko Nikinmaa 1
1Division of Genetics and Physiology, Department of Biology, University of Turku, Turku, Finland 2Department of Genetics, University of Dublin, Trinity College, Dublin, Ireland

... surrounding the primary BlastP hits in the genome contigs and repredicted the gene structure using three independent pieces of software: GENESCAN (http://genes.mit.edu/GENSCAN.html), Augustus (http://augustus.gobics.de/), and FGENESH (http://linux1.softberry.com). ...


Theoretical and Applied Genetics
Volume 123, Issue 4 , pp 585-601 DOI: 10.1007/s00122-011-1609-5

Towards an understanding of the nature of resistance to Phytophthora root rot in red raspberry

Graham et al.,
1. Genetics Department, Scottish Crop Research Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK 2. Biomathematics and Statistics Scotland, Invergowrie, Dundee, DD2 5DA, Scotland, UK

... Gene prediction Open reading frames from both BAC sequences were identified using the Softberry gene structure prediction program FGENESH (http://linux1. softberry.com/berry. phtml) using Vitis vinifera as the reference. ...


Applied Microbiology and Biotechnology
Volume 89, Issue 6 , pp 1851-1858 DOI: 10.1007/s00253-010-3016-2

An acid and highly thermostable xylanase from Phialophora sp. G5

Zhang et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, China 2. School of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan, 430023, China

... ncbi.him.nih.gov/gorf/gorf/gorf.html). Genes, introns, exons and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/ berry.phtml). The signal peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...


Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184–194 DOI: 10.1016/j.exppara.2010.07.012

Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases

Tiago M. Martins a, b, , , Virgilio E. do Rosario b, Ana Domingos a, b
a Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal

... A threshold of E ? 1e-04 was adopted for the tblastn search (Wu et al., 2003). The gene structure of the identified CP genes with multiple exons was predicted using the FGENESH and FGENESH+ software (http://www.softberry.com). ...


Advanced Studies in Biology
Vol. 3, 2011, no. 4, 169 – 180

Genetic Disease Resistance and Conservation of a Plant Gene that Encodes a Mitogen-Activated Protein Kinase Kinase Kinase

L. David Kuykendall, Jonathan Y. Shao, Rachel P. Naegele and J. Mitchell McGrath
Molecular Plant Pathology Laboratory, Plant Sciences Institute Beltsville Agricultural Research Center, Beltsville MD 20705, USA Department of Crop and Soil Sciences and USDA-ARS Sugar Beet and Bean Research, Michigan State University East Lansing, MI 48824-1325,USA

...The sequence contig was screened for coding sequence using a combination of the following programs: GeneMark [21] for eukaryotes:(http://exon.gatech.edu/GeneMark/eukhmm.cgi), GenScan [22] (http://genes.mit.edu/GENSCAN.html) FGENESH (http://linux1.softberry.com/berry.phtml...


Comparative and Functional Genomics
Volume 2011 (2011), Article ID 286089, 9 pages doi:10.1155/2011/286089

Repertoire of SSRs in the Castor Bean Genome and Their Utilization in Genetic Diversity Analysis in Jatropha curcas

Arti Sharma and Rajinder Singh Chauhan
Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan 173 215, India

... Castor bean genome sequence contigs harboring SSRs were annotated for putative open reading frames, including 5?UTRs and 3?UTRs, using gene prediction algorithms of FGenesH (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind ...


Advanced Science Letters
Volume 4, Numbers 11-12, November 2011 , pp. 3653-3657(5) DOI: http://dx.doi.org/10.1166/asl.2011.2027

Cloning and Sequence Analysis of Candidate Disease Resistance Genes from Dongxiang Common Wild Rice (O. rufipogon Griff.)

Han, Xiaoxia et al.,
BGI

... The Genomic DNA Sequence Analysis DNA sequence location and similarity analysis was performed by BLAST program (http://www.ncbi.nlm.nih.gov/).13 Gene pre- diction was performed by FGENESH (Solovyev and Salamov 1999; http://www.softberry.com/berry.phtml) and ...


New Phytologist
2011, 192: 164–178. doi: 10.1111/j.1469-8137.2011.03800.x

Comparative analysis of peanut NBS-LRR gene clusters suggests evolutionary innovation among duplicated domains and erosion of gene microsynteny.

Ratnaparkhe et al.,
1 Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30602, USA 2 Center for Genomics and Computational Biology, School of Life Sciences, School of Sciences, Hebei United University, Tangshan, Hebei 063000, China

... sequenced. Assembled sequences were visualized and manually edited using Consed (Gordon et al., 1998). Peanut BAC sequences were annotated using gene prediction programs FGENESH (http://www.softberry.com). The ...


Plant Molecular Biology Reporter
Volume 29, Issue 4 , pp 769-783 DOI: 10.1007/s11105-010-0284-z

Genome-Wide Analysis of Fatty Acid Desaturases in Soybean (Glycine max)

Xiaoyuan Chi et al.,
1. Shandong Peanut Research Institute, Qingdao, 266100, People’s Republic of China 2. Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, 266101, People’s Republic of China

... The searches were iterated until convergence. As for the incorrectly predicted genes, manual reannotation was performed using online web server FGENESH (http://linux1.softberry.com/berry.phtml; Salamov and Solovyev 2000). ...


Molecular Genetics and Genomics
Volume 285, Issue 1 , pp 79-90 DOI: 10.1007/s00438-010-0587-7

Relative evolutionary rates of NBS-encoding genes revealed by soybean segmental duplication

Xiaohui Zhang et al.,
1. State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China 2. National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China

... All new BLAST hits in the genomes, together with flanking regions of 5,000–10,000 bp at both sides, were annotated using the gene-finding programs FGENESH with the legume plant training set (http://www.softberry.com/) and GENSCAN with the Arabidopsis training set (http ...


Metabolic Engineering
Volume 13, Issue 6, November 2011, Pages 723–732 DOI: 10.1016/j.ymben.2011.09.008

Identification and engineering of the cytochalasin gene cluster from Aspergillus clavatus NRRL 1

Kangjian Qiao a, Yit-Heng Chooi a, Yi Tang a, b,
a Department of Chemical and Biomolecular Engineering, University of California, Los Angeles, CA 90095, United States b Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095, United States

... Gene predictions were performed via FGENESH program (www.softberry.com) and manually checked based on homologous gene/protein sequences in the GenBank database. Protein domain functions were deduced using Conserved Domain Search (NCBI). 2.3. ...


International Journal of Plant Genomics
Volume 2011 (2011), Article ID 370548, 8 pages doi:10.1155/2011/370548

Genes Encoding Callose Synthase and Phytochrome A Are Adjacent to a MAP3K?-Like Gene in Beta vulgaris US H20

L. David Kuykendall and Jonathan Y. Shao
Molecular Plant Pathology Laboratory, Agricultural Research Service, US Department of Agriculture, Plant Sciences Institute, Beltsville Agricultural Research Center, 10300 Baltimore Avenue, Building 004, Room 120, BARC-West, Beltsville, MD 20705, USA

... NCBI BLAST [8]. The 125 Kb sequence was screened for coding sequence using a combination of the following programs: GeneMark [9, 10] for eukaryotes (http://exon.gatech.edu/GeneMark/ eukhmm.cgi), Augustus (http://augustus.gobics.de/), and FgenesH (http://softberry.com ...


BMC Plant Biology
2011, 11:44 doi:10.1186/1471-2229-11-44

Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence

Kim E Nolan, Sergey Kurdyukov and Ray J Rose
Australian Research Council Centre of Excellence for Integrative Legume Research, School of Environmental and Life Sciences. The University of Newcastle. University Dr. Callaghan, NSW, 2308, Australia

... potential coding regions from the individual genomic sequences were predicted using FGENESH software (Softberry; http://linux1.softberry.com webcite) ...


Journal of Bioscience and Bioengineering
Volume 112, Issue 6, December 2011, Pages 551–557 DOI: 10.1016/j.jbiosc.2011.08.018,

Acidic b-mannanase from Penicillium pinophilum C1: Cloning, characterization and assessment of its potential for animal feed application

Hongying Cai et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China 2 Department of Microbial Engineering, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... Introns, exons and transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...


Journal of Molecular Evolution
Volume 72, Issue 5-6 , pp 498-509 DOI: 10.1007/s00239-011-9448-1

Co-Variation Among Major Classes of LRR-Encoding Genes in Two Pairs of Plant Species

Jiao Wang, Shengjun Tan, Li Zhang, Ping Li, Dacheng Tian
1. State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China 2. Rice Research Institute, Sichuan Agricultural University, Wenjiang, 611130, China

.. Their sequences and corresponding annotations were downloaded from the online databases (Table S1). The annotation methods and quality could affect the gene identification. To estimate the bias, we used the ab initio gene finder FGENESH (http://linux1.softberry. ...


New Phytologist
189: 321–334. doi: 10.1111/j.1469-8137.2010.03462.x

The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication.

Zhai et al.,
1 Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China 2 Rice Research Institute, Guangdong Provincial Academy of Agricultural Sciences, Guangzhou, 510640, China

... Candidate gene identification. The gene annotation tools RiceGAAS (http://ricegaas.dna.affrc. go.jp) and FGENSH (http://www.softberry.com) were used to identify Pik candidates within the 166-kb segment of cv Nipponbare defined by the flanking markers K34 and K28 (Fig. 1a). ...


Process Biochemistry
Volume 46, Issue 12, December 2011, Pages 2341–2346 DOI: 10.1016/j.procbio.2011.09.018,

A novel thermoacidophilic family 10 xylanase from Penicillium pinophilum C1

Cai et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... The signal peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). The exon–intron structure and transcription initiation sites of the full-length gene were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...


International Journal of Plant Genomics
Volume 2011 (2011), Article ID 291563, 12 pages doi:10.1155/2011/291563

Comparative Genomics in Perennial Ryegrass (Lolium perenne L.): Identification and Characterisation of an Orthologue for the Rice Plant Architecture-Controlling Gene OsABCG5

Hiroshi Shinozuka, 1,2,3 Noel O. I. Cogan, 1,2,3 German C. Spangenberg, 1,2,3,4 and John W. Forster 1,2,3,4
1Biosciences Research Division, Department of Primary Industries, Victorian AgriBiosciences Centre, La Trobe University Research and Development Park, 1 Park Drive, Bundoora, VIC 3083, Australia 2Molecular Plant Breeding Cooperative Research Centre, Bundoora, VIC 3083, Australia

... Gene structure prediction was performed using the FGENESH program with the parameter setting for monocot plants (http://linux1.softberry.com/berry.phtml). Phylogenetic analysis was performed using the CLUSTALW program (http://www.genome.jp/tools/clustalw/). ...


Advanced Studies in Biology
Vol. 3, 2011, no. 1, 13 - 24

A Plant Gene Encodes a ‘HSFA9-like’ Heat Shock Factor and is Part of a Cluster of Orthologous Genes Including NPR1, CaMP and CK1 in Beta vulgaris, Populus trichocarpa, Solanum lycopersicum and Vitis vinifera

David Kuykendall, Jonathan Shao, Kate Burdekin and Lauren Conway
Molecular Plant Pathology Laboratory, PSI, BARC 10300 Baltimore Avenue, Beltsville, MD 20705 USA

...Putative genes in these genomic regions were annotated using FGenesH program (Gene finding in Eukaryota, http://linux1.softberry.com/). ...


The Journal of Microbiology
Volume 49, Issue 3 , pp 473-480 DOI: 10.1007/s12275-011-0362-4

Isolation and characterization of a reducing polyketide synthase gene from the lichen-forming fungus Usnea longissima

Wang et al.,
1. Korean Lichen Research Institute, Sunchon National University, Sunchon, 540-742, Republic of Korea

... The potential open reading frame (ORF) of FoNRks2662 was scanned with FGENESH (Berg et al., 2008) using Aspergillus as the matrix (http://linux1. softberry.com). The putative function of these ORFs was determined using a basic local alignment search tool (BLAST). ...


Genome
2011, 54(12): 1041-1044, DOI: 10.1139/g11-068

Isolation of a strawberry gene fragment encoding an actin depolymerizing factor-like protein from genotypes resistant to Colletotrichum acutatum

Marta Ontivero, a Gustavo Martinez Zamor a,b Sergio Salazar, c Juan Carlos Diaz Ricci, b Atilio Pedro Castagnaro a
Seccion Biotecnologia, Estacion Experimental Agroindustrial Obispo Colombres-Unidad Asociada al INSIBIO, Av. William Cross 3150, 4101 Las Talitas, Tucuman, Argentina. bInstituto Superior de Investigaciones Biologicas (INSIBIO; CONICET- UNT) and Instituto de Quimica Biologica “Dr. Bernabe Bloj”, Universidad Nacional de Tucuman. Chacabuco 461, 4000 Tucuman. Argentina.

... The deduced amino acid sequence showed identity scores ranging between 93% and 60%, with E values comprised between 1 ? 10 –37 and 6 ? 10 –44 . The gene prediction programs SPL and FGENESH 2.6 (www.softberry.com) (Solovyev et al. ...


Plant Molecular Biology
Volume 77, Issue 1-2 , pp 59-75 DOI: 10.1007/s11103-011-9794-9

BraSto, a Stowaway MITE from Brassica: recently active copies preferentially accumulate in the gene space

Veronique Sarilar, Anne Marmagne, Philippe Brabant, Johann Joets, Karine Alix
1. AgroParisTech/CNRS, UMR 0320/UMR 8120 Genetique Vegetale INRA/Univ. Paris-Sud/CNRS/AgroParisTech, Ferme du Moulon, 91190, Gif-sur-Yvette, France 2. CNRS, UMR 0320/UMR 8120 Genetique Vegetale INRA/Univ. Paris-Sud/CNRS/AgroParisTech, Ferme du Moulon, 91190, Gif-sur-Yvette, France

... We used a combination of FGENESH v.2.6 (http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind, Salamov and Solovyev 2000), with arabidopsis thaliana (arabidopsis) as the reference model, and BLASTP to characterize the genomic ...


Front Plant Sci.
2011; 2: 35. DOI: 10.3389/fpls.2011.00035

Mining Disease-Resistance Genes in Roses: Functional and Molecular Characterization of the Rdr1 Locus

Terefe-Ayana et al.,
1Institute for Plant Genetics, Leibniz University Hannover, Hannover, Germany

... Gene prediction and annotation. Bioedit (Hall, 1999) was used for viewing and editing of sequences. Gene prediction and annotation was done using the gene prediction programs FGENESH and GENSCAN (http://www.softberry.com; http://genes.mit.edu/GENSCAN.html). ...


Journal of Plant Genetics and Transgenics
Vol 2, No 1 (2011) Chandel

In Silico Expression Analysis of QTL Specific Candidate Genes for Grain Micronutrient (Fe/Zn) Content Using ESTs and MPSS Signature Analysis in Rice (Oryza sativa L.)

Girish Chandel, P. Samuel, M. Dubey, R. Meena
BGI

... The nucleotide sequences were downloaded and analyzed for open reading frames (ORFs) and the CDS (Coding DNA sequence) using gene prediction algorithms of FGenesH (http://sun1.softberry.com/berry.phtml?topic=fgenesh&group =programs&subgroup=gfin). ...


Plant Physiology
March 2011 vol. 155 no. 3 1301-1311 DOI: 10.1104/pp.110.168500

Genetic Control of a Transition from Black to Straw-White Seed Hull in Rice Domesticationome

Zhu et al.,
National Center for Gene Research and Institute of Plant Physiology and Ecology (B.-F.Z., L.S., Y.Z., J.Z., Y.S., D.L., D.F., C.L., B.H.) and State Key Laboratory of Plant Molecular Genetics and Institute of Plant Physiology and Ecology (H.L.), Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200233, China;

... fully sequenced (Fig. 2C). Only one open reading frame (ORF) was identified in the 8.8-kb DNA fragment using FGENESH gene prediction analysis (http://linux1. softberry.com/berry.phtml; Fig. 2D). Two BACs corresponding ...


PLoS ONE
6(8): e24230. doi:10.1371/journal.pone.0024230

Next Generation Sequencing Provides Rapid Access to the Genome of Puccinia striiformis f. sp. tritici, the Causal Agent of Wheat Stripe Rust

Cantu et al.,
Department of Plant Sciences, University of California Davis, Davis, California, United States of America Genome Center, University of California Davis, Davis, California, United States of America

... 12]. Exon-intron structures of transposable elements were predicted with the aid of Softberry FGENESH (linux1.softberry.com). Protein sequences of transposable elements were aligned using MAFFT with the linsi option [29]. ...


J. Exp. Bot.
(2011) 62 (8): 2585-2597. doi: 10.1093/jxb/erq433

Time course and amplitude of DNA methylation in the shoot apical meristem are critical points for bolting induction in sugar beet and bolting tolerance between genotypes

Trap-Gentil et al.,
1Universite d'Orleans, UFR-Faculte des Sciences, UPRES EA 1207 ‘Laboratoire de Biologie des Ligneux et des Grandes Cultures’ (LBLGC), rue de Chartres, BP 6759, F-45067 Orleans, France 2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), F-45067 Orleans, France

... The determination of transposable elements (TEs) in the BvFLC and BvVIN3 genomic sequences was realized by the identification of potential coding sequences (Fgenesh on http://linux1.softberry. com/berry.phtml) followed by similarity analysis using BLASTP and analysis of ...


African Journal of Biotechnology
Vol. 10 (66), pp. 14738-14745, 26 October, 2011 DOI: 10.5897/AJB11.667

Isolation of candidate disease resistance genes from enrichment library of Oryza minuta based on conserved domains

Han et al.,
1State Key Laboratory of Hybrid Rice, Longping Branch of Graduate School, Central South University, Changsha 410125, P. R. China. 2China National Hybrid R&D Center, Changsha 410125, P. R. China.

... The gene prediction program used was FGENESH (http:// www.softberry.com.cn), and the domains were predicted by the SMART program (http://smart.embl-heidelberg.de/) and CDD program (http://www.ncbi.nlm.nih.gov/sites/entrez?db=cdd). Results. ...


Molecular Breeding
Volume 28, Issue 3 , pp 343-357 DOI: 10.1007/s11032-010-9487-0

Identification of suitable reference genes for studying gene expression in cucumber plants subjected to abiotic stress and growth regulators

M. Migocka, A. Papierniak
1. Department of Plant Physiology, Institute of Plant Biology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland

... The selected cucumber sequences were then input into the programs identifying the full cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.gatech.edu/ eukhmm.cgi) and FGENESH (http://www.softberry.ru/berry.phtml). ...


BMC Evolutionary Biology
2011, 11:165 doi:10.1186/1471-2148-11-165

Immunoglobulin heavy chains in medaka (Oryzias latipes)

Susana Magadan-Mompo 1, Christian Sanchez-Espinel 2 and Francisco Gambon-Deza 3
1 Oceanographic Center of Vigo, Spanish Institute of Oceanography (IEO), Subida a Radio Faro 50, 36390 Vigo, Pontevedra, Spain 2 Shared Unit of Immunology, University of Vigo - Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As LagoasMarcosende, Vigo 36310, Pontevedra, Spain

... immunoglobulin mRNAs. Limits of unpublished antibodies were deduced following instructions in the software FGENESH (http://www.softberry.com webcite) and Augustus (http://augustus.gobics.de/submission webcite) [26]. Messenger ...


New Phytologist
189: 710–722. doi: 10.1111/j.1469-8137.2010.03492.x

Isolation and characterization of MAT genes in the symbiotic ascomycete Tuber melanosporum.

Rubini et al.,
1 National Research Council, Plant Genetics Institute – Perugia Division, Via della Madonna Alta 130, I–06128 Perugia, Italy 2 UMR 1136, Interactions Arbres/Microorganismes, INRA-Nancy, F–54280 Champenoux, France

... comparison and dotplot analysis were carried out using National Center for Biotechnology Information (NCBI) blast and Dotmatcher (EMBOSS Package v. 6.0.1). Gene structure prediction of MAT1-1-1 was performed with fgenesh software (http://linux1.softberry.com) using ...


Journal of Plant Biology
Volume 54, Issue 5 , pp 294-302 DOI: 10.1007/s12374-011-9166-7

Genetic Variation and Evolution of the Pi9 Blast Resistance Locus in the AA Genome Oryza Species

Liu et al.,
1. Hunan Provincial Key Laboratory of Crop Germplasm Innovation and Utilization, Hunan Agricultural University, Changsha, Hunan, 410128, China 3. Crop Biotech Institute & Graduate School of Biotechnology, Kyung Hee University, Yongin, 446–701, South Korea

... by MEGA 4.0. Gene coding regions were predicted with GeneScan (http://genes.mit.edu/ GENSCAN.html) and Fegenesh (http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&subgroup=gfind) using the Pi9 sequence as the reference. ...


Molecular Genetics and Genomics
Volume 286, Issue 1 , pp 21-36 DOI: 10.1007/s00438-011-0616-1

Mapping Fusarium wilt race 1 resistance genes in cotton by inheritance, QTL and sequencing composition

Ulloa et al.,
1. USDA-ARS, Western Integrated Cropping Systems Research Unit, 17053 N. Shafter Ave., Shafter, CA, 93263, USA 2. Department of Nematology, University of California-Riverside, Riverside, CA, 92521, USA

... for analysis. Gene predic- tion and annotation were performed with the gene predic- tion programs Augustus (Stanke and Morgenstern 2005) and FGENESH (Softberry Mount Kisco, NY, USA, http:// www.softberry.com). Local ...


Journal of Industrial Microbiology & Biotechnology
Volume 38, Issue 9 , pp 1211-1218 DOI: 10.1007/s10295-010-0899-y

a-Amylase activity during pullulan production and ?-amylase gene analyses of Aureobasidium pullulans

Manitchotpisit et al.,
1. Biological Sciences Program, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand 2. Plant Biomass Utilization Research Unit, Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand

... CA). The mRNA sequence, amino acid sequence, initial start codon, stop codon, and number of exons were predicted by the hidden Markov model plus protein-based gene prediction FGENESH ? (Softberry, Inc.). Calculations ...


Tropical Plant Biology
Volume 4, Issue 3-4 , pp 217-227 DOI: 10.1007/s12042-011-9083-4

Molecular and Cytological Characterization of Centromeric Retrotransposons in a Wild Relative of Rice, Oryza granulata

Dongying Gao, Zhiyun Gong, Rod A. Wing, Jiming Jiang, Scott A. Jackson
1. Center for Applied Genetic Technologies and Institute for Plant Breeding Genetics and Genomics, University of Georgia, 111 Riverbend Rd., Athens, GA, 30602, USA 2. Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA

... In order to generate the phylogenetic tree with the conserved RT domains of LTR retrotransposons, the internal sequences from OGRetro9 and other 30 retroelements were annotated with FGENESH (http://linux1.softberry.com/berry.phtml) and GENEMARK (http://exon.gatech ...


BMC Evolutionary Biology
2011, 11:263 doi:10.1186/1471-2148-11-263

Evolutionary view of acyl-CoA diacylglycerol acyltransferase (DGAT), a key enzyme in neutral lipid biosynthesis

Turchetto-Zolet et al.,
1 Programa de Pos-Graduacao em Genetica e Biologia Molecular, Departamento de Genetica, Universidade Federal do Rio Grande do Sul, Brazil 2 Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Brazil

... The structural organization of the DGAT genes was determined after alignment of genomic DNA and cDNA and EST sequences. Genomic sequences were also analyzed in the FGENESH gene structure prediction program http://www.softberry.com/ webcite[58]. ...


BMC Plant Biology
2011, 11:26 doi:10.1186/1471-2229-11-26

Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation

Masaki Fujisawa, Toshitsugu Nakano and Yasuhiro Ito
National Food Research Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan

... Gene structures were predicted using the sim4 [60] and the FGENESH 2.6 [61] programs with a parameter for the tomato genome (available at the Softberry site: http://linux1.softberry.com/berry.phtml ...


Journal of Genetics and Genomics
Volume 38, Issue 7, 20 July 2011, Pages 315–325 DOI: 10.1016/j.jgg.2011.06.003

Use of methylation filtration and C0t fractionation for analysis of genome composition and comparative genomics in bread wheat

Bandopadhyay et al.,
a Department of Genetics & Plant Breeding, Ch. Charan Singh University, Meerut 250004, India b Department of Biotechnology, Birla Institute of Technology, Mesra 835215, Ranchi, India

... Gene prediction was achieved using FGenesH (http://softberry.com/berry.phtml). 2.9. Fluorescence in situ hybridization (FISH). Four RD clones containing SSRs were used as probes, which were labeled with digoxigenin-11-dUTP by nick translation. ...


Theoretical and Applied Genetics
Volume 123, Issue 6 , pp 973-983 DOI: 10.1007/s00122-011-1640-6

Fine genetic mapping of cp: a recessive gene for compact (dwarf) plant architecture in cucumber, Cucumis sativus L.

Li et al.,
1. Horticulture College, Northwest Agriculture & Forestry University, Yangling, 712100, China 2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA

... Gene annotation was performed with the computer program FGENESH (http://sunl.softberry.com/) and function prediction was conducted with BLASTx at the NCBI (National Center for Biotechnology Information) website (http://blast.ncbi.nlm.nih.gov). Molecular marker analysis ...


Theoretical and Applied Genetics
Volume 122, Issue 4 , pp 795-803 DOI: 10.1007/s00122-010-1487-2

Fine genetic mapping localizes cucumber scab resistance gene Ccu into an R gene cluster

Kang et al.,
1. Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, 100081, Beijing, China 3. Key Laboratory of Horticultural Crops Genetic Improvement, Ministry of Agriculture, 100081, Beijing, China

... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and verified by FGENESH (http://sunl.softberry.com/) (Salamov and Solovyev 2000), GENESCAN (http://genes.mit.edu/GENSCAN.html) (Burge and Karlin 1997), TwinScan (http://mblab ...


BMC Genomics
2011, 12:609 doi:10.1186/1471-2164-12-609

Structural characterization of helitrons and their stepwise capturing of gene fragments in the maize genome

Dong et al.,
State Key Laboratory of Agrobiotechnology and National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing, 100193, China

... Then the obtained sequences were extended 10 kb each in the 5'-terminus and 3'-terminus respectively. Finally, the obtained putative autonomous helitrons were annotated by Fgenesh (http://linux1.softberry.com/berry.phtml webcite). ...


Agricultural Sciences in China
Volume 10, Issue 4, April 2011, Pages 481–489 DOI: 10.1016/S1671-2927(11)60028-X

Characterization of Zm26Sub5 and Its Potential Roles in Regulating Pollen Fertility of S-CMS in Maize

Zheng-feng ZHANG a, b, Yong-lian ZHENG b
a College of Life Science, Huazhong Normal University, Wuhan 430079, P.R. China b National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China

... embl-heidelberg.de/Alignment/). Gene prediction for the Zm26Sub5 DNA sequence was carried out, analyzing introns, exons, and poly(A), with the FGENESH 2.6 program (http://www.softberry.com/all/ htm). The protein encoded ...


The Plant Journal
2011, 65: 230–243. doi: 10.1111/j.1365-313X.2010.04414.x

Identification of legume RopGEF gene families and characterization of a Medicago truncatula RopGEF mediating polar growth of root hairs.

Riely et al.,
1 Department of Plant Pathology, University of California, One Shields Avenue, Davis, CA 95616, USA 2 Beijing Forestry University, Beijing, China

...Bacterial artificial chromosomes identified as containing possible RopGEFs were analyzed using softberry fgenesh gene prediction tools to identify possible open reading frames in MtRopGEFs (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...


Molecular and Cellular Biochemistry
Volume 357, Issue 1-2 , pp 263-274 DOI: 10.1007/s11010-011-0897-z

Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene

Abdul Rouf Banday, Shafquat Azim, Mohammad Tabish
1. Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, Uttar Pradesh, 202002, India

... mit.edu/GENSCAN.html), GeneSplicer (http://cbcb.umd. edu/software/GeneSplicer/), FGENESH (http://www.soft berry.com/berry.phtml). Alignment analysis was carried out using the Gene stream Align tool (http://www2.igh.cnrs. ...


Theoretical and Applied Genetics
Volume 122, Issue 7 , pp 1247-1264 DOI: 10.1007/s00122-011-1528-5

Molecular basis of seed lipoxygenase null traits in soybean line OX948

Reinprecht et al.,
1. Department of Plant Agriculture, University of Guelph, Guelph, ON, N1G 2W1, Canada 3. Agriculture and Agri-Food Canada, Greenhouse and Processing Crops Research Centre, Harrow, ON, N0R 1G0, Canada

... 2007) during the current study. The gene structure was also analyzed with the FGenesh 2.6 available at http://www. linux1.softberry.com (Salamov and Solovyev 2000). Translation of nucleotide sequences was generated on ExPASy (http://www.expasy.ch/tools/dna.html). ...


Plant Biotechnology Reports
Volume 5, Issue 4 , pp 331-344 DOI: 10.1007/s11816-011-0187-y

Isolation of an Rx homolog from C. annuum and the evolution of Rx genes in the Solanaceae family

Shi et al.,
1. Department of Plant Science, Plant Genomics and Breeding Institute, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Republic of Korea 2. Research Institute for Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Republic of Korea

... GENESCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://linux1.softberry.com/ berry.phtml) were used for BAC sequence annotation of a Rx1-containing BAC from potato, a CapRGC-containing BAC from pepper, and a LaRGC-containing BAC from tomato. ...


New Phytologist
2011, 192: 713–726. doi: 10.1111/j.1469-8137.2011.03824.x

Conservation and clade-specific diversification of pathogen-inducible tryptophan and indole glucosinolate metabolism in Arabidopsis thaliana relatives.

Bednarek et al.,
1 Max Planck Institute for Plant Breeding Research, Department of Plant Microbe Interactions, Carl-von-Linne-Weg 10, D-50829 Koln, Germany 2 Institute of Bioorganic Chemistry, Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan, Poland

... To predict the open reading frames (ORFs) from the genomic candidate regions, Fgenesh (http://www.softberry.com) was used with parameters optimized for A. thaliana. The predicted proteins were aligned using ClustalW and visualized using Jalview (Waterhouse et al., 2009). ...


PLoS Genet
7(4): e1002029. doi:10.1371/journal.pgen.1002029

The Phylogenetic Origin of oskar Coincided with the Origin of Maternally Provisioned Germ Plasm and Pole Cells at the Base of the Holometabola.

Lynch et al.,
Affiliation: Institute for Developmental Biology, University of Cologne, Cologne, Germany Department of Biology, McGill University, Montreal, Canada

...The genomic region surrounding the region showing homology to Osk was used as input into FgenesH using the Apis model at http://linux1.softberry.com/ to predict an Osk sequence, ...


Mobile DNA
2011, 2:12 http://www.mobilednajournal.com/content/2/1/12

Crypton transposons: identification of new diverse families and ancient domestication events

Kenji K Kojima and Jerzy Jurka
Genetic Information Research Institute, 1925 Landings Drive, Mountain View, CA 94043, USA

...We predicted exon-intron boundaries with the aid of SoftBerry FGENESH: http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind...


Genetica
Volume 139, Issue 4 , pp 489-496 DOI: 10.1007/s10709-011-9569-x

Transfer of a chromosomal Maverick to endogenous bracovirus in a parasitoid wasp

Dupuy et al.,
1. Institut de Recherche sur la Biologie de l’Insecte, UMR CNRS 6035, Universite F. Rabelais, UFR Sciences et Techniques, Parc Grandmont, 37200, Tours, France

... The hit was considered significant when the e-value was lower than 10-4. Open reading frames (ORFs) were identified using FGENESH (http://linux1.softberry.com) and putative ORFs were confirmed and adjusted if necessary through alignments with T. castaneum Maverick ...


Nature
478, 119–122 (06 October 2011) doi:10.1038/nature10431

Control of flowering and storage organ formation in potato by FLOWERING LOCUS T

Navarro et al.,
Departamento de Genetica Molecular de Plantas, Centro Nacional de Biotecnologia-CSIC. Calle Darwin 3, 28049 Madrid, Spain Laboratory of Plant Molecular Genetics, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma 630-0101, Japan

... The best genome matches (Supplementary Table 2)were downloaded and open reading frames were predicted using FGENESH (http://linux1.softberry.com/berry.phtml) and ORF Finder ...


BMC Evolutionary Biology
2011, 11:219 doi:10.1186/1471-2148-11-219

A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2

Fan et al.,
1 Laboratory of Yeast Genetics and Molecular Biology, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China 2 Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China

...The splicing pattern was verified using the FGENESH and FGENESH_GC programs provided at the Softberry website...


PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.

Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany

...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99] and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...


MPMI
Vol. 24, No. 1, 2011, pp. 79–90. doi:10.1094/ MPMI -06-10-0131

TaDAD2, a Negative Regulator of Programmed Cell Death, Is Important for the Interaction Between Wheat and the Stripe Rust Fungus

Wang et al.,
1 College of Plant Protection and Shaanxi Key Laboratory of Molecular Biology for Agriculture, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China; 2 College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, P. R. China;

...The HsDAD (Homo sapiens) was employed as the outgroup control for the construction of phylogenetic trees. Gene structure was predicted by FGENESH....


PLoS Genet
(2011), 7(8): e1002230. doi:10.1371/journal.pgen.1002230

Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea.

Amselem et al.,
Unite de Recherche Genomique – Info, UR1164, INRA, Versailles, France, Biologie et Gestion des Risques en Agriculture – Champignons Pathogenes des Plantes, UR1290, INRA, Grignon, France Broad Institute of MIT and Harvard, Cambridge, Massachusetts, United States of America

...For S. sclerotiorum and B. cinerea B05.10, gene structures were predicted using a combination of FGENESH and GENEID....


Molecular Ecology
(2011), 20: 2603–2618. doi: 10.1111/j.1365-294X.2011.05119.x

Characterization of a genomic divergence island between black-and-yellow and gopher Sebastes rockfishes.

BUONACCORSI et al.,
1 Juniata College, 1700 Moore St. Huntingdon, PA 16652, USA 2 Columbia River Inter-Tribal Fish Commission, 3059-F National Fish Hatchery Road, Hagerman, ID 83332, USA

... The sequenced region was manually annotated using ab initio gene predictions from Genscan (Burge & Karlin 1997) and FgenesH (SoftBerry; Fish gene model). Microsatellites were identified using Tandem Repeat Finder (Benson 1999). ...


Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976

Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.

Berka et al.,
Novozymes, Inc., Davis, California, USA. US Department of Energy Joint Genome Institute, Walnut Creek, California, USA. Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.

... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly; cDNA-based EST_map (http://www.softberry.com/) seeded ...


Plant Physiology
October 2011 vol. 157 no. 2 937-946 DOI: 10.1104/pp.111.174912

Evolution of the S-Locus Region in Arabidopsis Relatives

Ya-Long Guo 2*, Xuan Zhao 2, Christa Lanz and Detlef Weigel
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany

... Annotation of the BAC sequences was performed using FGENESH (http://linux1. softberry.com/berry.phtml). The annotation was confirmed by ...


Nature Communications
2, Article number: 202 doi:10.1038/ncomms1189

Effector diversification within compartments of the Leptosphaeria maculans genome affected by Repeat-Induced Point mutations

Rouxel et al.,
INRA-Bioger, UR1290, Avenue Lucien Bretignieres, BP 01, Thiverval-Grignon F-78850, France. Murdoch University, South Street, Murdoch, Western Australia 6150, Australia.

...The EuGene prediction pipeline v. 3.5a (ref. 48), which integrates ab initio (Eugene_IMM, SpliceMachine and Fgenesh 2.6 (www.softberry.com)) and similarity methods (BLASTn, GenomeThreader, BLASTx), was used to predict gene models. ...


Nature Genetics
43, 228–235 (2011) doi:10.1038/ng.769

The draft genome of the parasitic nematode Trichinella spiralis

Mitreva et al.,
The Genome Center, Washington University School of Medicine, St. Louis, Missouri, USA. Department of Genetics, Washington University School of Medicine, St. Louis, Missouri, USA.

...Protein-coding genes were predicted using a combination of ab initio programs47 and FgenesH (Softberry, Corp) and the evidence-based program EAnnot48. ...


Theoretical and Applied Genetics
Volume 122, Issue 3 , pp 459-470 DOI: 10.1007/s00122-010-1460-0

Characterization and genetic analysis of a low-temperature-sensitive mutant, sy-2, in Capsicum chinense

An et al.,
1. Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute for Agriculture and Life Sciences, Seoul National University, 599 Gwanak-ro Gwank-gu, Seoul, 151-921, Korea 2. Key Laboratory of Crop Genomics and Genetic Improvement of Ministry of Agriculture, Beijing Key Lab of Crop Genetic Improvement, China Agriculture University, Beijing, 100094, China

... C2_At1g09070. In the sequence, 51 genes were predicted by gene prediction FGENESH (http://linux1.softberry. com) and blastx (http://blast.ncbi.nlm.nih.gov). There were several candidate genes including five lipoxygenase genes, ...


The Plant Journal
(2011), 65: 745–756. doi: 10.1111/j.1365-313X.2010.04461.x

Cross-genome map based dissection of a nitrogen use efficiency ortho-metaQTL in bread wheat unravels concerted cereal genome evolution.

Quraishi et al.,
1 INRA/Universite Blaise Pascal UMR 1095 GDEC, Domaine de Crouelle, 234 Avenue du Brezet, 63100 Clermont-Ferrand, France 2 BIOGEMMA, 8 Rue des Freres Lumiere, 63028 Clermont-Ferrand Cedex 2, France

... nih.gov/) and SwissProt databases (http://expasy.org/sprot/), with the results of two gene predictor programs, Eugene (Matheet al., 2002) with the rice (Oryza sativa) training version and FgeneSH (Salamov and Solovyev, 2000) with default parameters (http://sun1.softberry.com/). ...


Plant Physiology October
2011 vol. 157 no. 2 757-769 DOI: 10.1104/pp.111.181990

Genome-Wide Comparison of Nucleotide-Binding Site-Leucine-Rich Repeat-Encoding Genes in Arabidopsis

Guo et al.,
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany

... Gordon et al., 1998). Primer walking and PCR were used to fill or polish gaps and ambiguous regions. Annotation was performed using FGENESH and FGENESH+ (http://linux1.softberry.com/berry.phtml). Spidey (http://www.ncbi ...


BMC Genomics
2011, 12:142 doi:10.1186/1471-2164-12-142

Exceptional lability of a genomic complex in rice and its close relatives revealed by interspecific and intraspecific comparison and population analysis

Tian et al.,
1 Department of Agronomy, Purdue University, West Lafayette, IN 47907, USA 2 Arizona Genomics Institute, The University of Arizona, Tucson, AZ 85721, USA

... Putative gene models were predicted using the FGENESH program with the monocot training set (http://www.softberry.com webcite), and were further investigated to determine whether they are actually genes following described previously criteria [6]. Truncated gene fragments ...


The Plant Journal
(2011), 68: 777–787. doi: 10.1111/j.1365-313X.2011.04728.x

Rice 14-3-3 protein (GF14e) negatively affects cell death and disease resistance.

Manosalva, P. M., Bruce, M. and Leach, J. E.
Boyce Thompson Institute for Plant Research, Ithaca, NY 14853, USA.

... Throughput Genomic Sequences (HTGS) database. The fgenesh program (http://www.softberry.com/berry.phtml) was used to predict 14-3-3 gene members from significant rice BAC hits. All sequences corresponding to various ...


Genomics
Volume 97, Issue 5, May 2011, Pages 313–320 DOI: 10.1016/j.ygeno.2011.02.007

Comparative analysis of Gossypium and Vitis genomes indicates genome duplication specific to the Gossypium lineage

Lin et al.,
a Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30605, USA b Center for Genomics and Biocomputing, College of Sciences, Hebei Polytechnic University, Tangshan, Hebei, 063000, China

...Genes were identified from BAC sequences using FGENESH (http://linux1.softberry.com/berry.phtml). ...


BMC Evolutionary Biology
2011, 11:78 doi:10.1186/1471-2148-11-78

Evolution of Parallel Spindles Like genes in plants and highlight of unique domain architecture

Cigliano et al.,
1 CNR - National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, Via Universita 133, 80055 Portici. Italy 2 DISSPAPA, Dept. of Soil, Plant and Environmental Sciences, University of Naples "Federico II", Via Universita 100, 80055 Portici. Italy

... Germany). PSL1 gene structure and cDNA predictions were carried out using FGENESH online tool (http:/ / linux1.softberry.com/ berry.phtml?topic=fgenesh&group=pro grams&subgroup=gfind webcite) selecting Tomato as organism. ...


BMC Research Notes
2011, 4:518 doi:10.1186/1756-0500-4-518

Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)

Maik Klie and Thomas Debener
Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universitat Hannover, Herrenhauser Str. 2, 30419 Hannover, Germany

...Open reading frames and 5'and 3' UTR regions were predicted using the FGENESH algorithm [34] with specifications for dicot plants....


Aging Cell
(2011), 10: 896–907. doi: 10.1111/j.1474-9726.2011.00727.x

Alternative splicing factor or splicing factor-2 plays a key role in intron retention of the endoglin gene during endothelial senescence.

Blanco, F. J. and Bernabeu, C.
Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), and Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), c/Ramiro de Maeztu 9, 28040 Madrid, Spain

... Genome Bioinformatics (http://genome.ucsc.edu/). Then, the FSPLICE and FGENESH tools were used to predict exons and introns in the DNA sequences (http://linux1. softberry.com/berry.phtml). The Transeq tool at the European ...


PLoS Pathog
(2011), 7(7): e1002137. doi:10.1371/journal.ppat.1002137

Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens.

Klosterman et al.,
USDA-ARS, Salinas, California, United States of America University of California, Davis, California, United States of America

...Protein-encoding genes were annotated using a combination of manually curated genes, in addition to EST BLAST alignments, and ab initio gene predictions made by FGENESH, FGENESH+ (http://linux1.softberry.com), and ...


PLoS Negl Trop Dis
(2011), 5(10): e1340. doi:10.1371/journal.pntd.0001340

Characterisation of the Trichinella spiralis Deubiquitinating Enzyme, TsUCH37, an Evolutionarily Conserved Proteasome Interaction Partner.

White et al.,
Division of Cell and Molecular Biology, Department of Life Sciences, Imperial College London, London, United Kingdom Whitehead Institute for Biomedical Research, Cambridge, Massachusetts, United States of America

...Contig 1.2 was analysed by 4 different gene prediction programmes: AUGUSTUS [24], GenemarkHMM [31], SNAP [32] and Fgenesh [33]. ...


The Plant Cell May
2011 vol. 23 no. 5 1861-1875 DOI: 10.?1105/?tpc.?111.?085456

A Small Zinc Finger Thylakoid Protein Plays a Role in Maintenance of Photosystem II in Arabidopsis thaliana

Yan Lu a, 1, David A. Hall a and Robert L. Last a,b,2
aDepartment of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824 bDepartment of Plant Biology, Michigan State University, East Lansing, Michigan 48824

...Complete genomic sequence (including 500 bp upstream and downstream of the original partial sequence) was used to predict new gene structures with the FGENESH program (a Hidden Markov Model-based gene prediction program; http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind)....


PLoS ONE
(2011), 6(3): e17505. doi:10.1371/journal.pone.0017505

Elucidation of Functional Markers from Aspergillus nidulans Developmental Regulator FlbB and Their Phylogenetic Distribution.

Cortese MS, Etxebeste O, Garzia A, Espeso EA, Ugalde U
Department of Applied Chemistry, Faculty of Chemistry, University of the Basque Country, San Sebastian, Spain, IKERBASQUE, Basque Foundation for Science, Bilbao, Spain Department of Cellular and Molecular Medicine, Centro de Investigaciones Biologicas (CSIC), Madrid, Spain

...and Fgenesh (Softberry) [71] were considered along with manual verification of splice sites....


Genome Biology
2011, 12:R48 doi:10.1186/gb-2011-12-5-r48

A physical map for the Amborella trichopoda genome sheds light on the evolution of angiosperm genome structure

Zuccolo et al.,
1 Arizona Genomics Institute, School of Plant Sciences and BIO5 Institute for Collaborative Research, University of Arizona, 1657 East Helen Street, Tucson, AZ 85721, USA 2 Department of Plant Biology, University of Georgia, 4504 Miller Plant Sciences, Athens, GA 30602, USA

...FGENESH [63] annotations for the Amborella contigs were included on the horizontal axes of the dot plots. ...


Plant Physiology
October 2011 vol. 157 no. 2 770-789 DOI: 10.?1104/?pp.?111.?179648

The Tomato Terpene Synthase Gene Family

Falara et al.,
Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan 48109–1048 (V.F., T.A.A., T.T.H.N., I.S., Y.M., M.E.B., E.P.); Department of Plant Physiology, Swammerdam Institute of Life Sciences, 1098 XH Amsterdam, The Netherlands (E.A.S., P.M.B., R.C.S.)

...he FGENESH gene prediction tool (www.softberry.com) was used for initial annotation of the predicted tomato TPS genes....


PLoS Pathog
(2011), 7(11): e1002348. doi:10.1371/journal.ppat.1002348

Multiple Candidate Effectors from the Oomycete Pathogen Hyaloperonospora arabidopsidis Suppress Host Plant Immunity. PLoS Pathog 7(11): e1002348. doi:10.1371/journal.ppat.1002348

Fabro et al.,
The Sainsbury Laboratory, John Innes Centre, Norwich, United Kingdom School of Life Sciences, Warwick University, Wellesbourne, United Kingdom

...ORFs from ATG to Stop codon were identified using FgenesH (www.softberry.com) and ...


BMC Plant Biology
2011, 11:20 doi:10.1186/1471-2229-11-20

ZINC-INDUCED FACILITATOR-LIKE family in plants: lineage-specific expansion in monocotyledons and conserved genomic and expression features among rice (Oryza sativa) paralogs

Ricachenevsky et al.,
1 Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, P.O.Box 15005, Porto Alegre, 91501-970, Brazil 2 Departamento de Botanica, Instituto de Biociencias, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre, 91501-970, Brazil

...Two unnanotated ZIFL genes from Zea mays were predicted using Fgenesh (http://www.softberry.com ...


FGENESH 2010

Cytogenet Genome Res
2011;132:55-63 (DOI: 10.1159/000319491)

Sequence of a Turkey BAC Clone Identifies MHC Class III Orthologs and Supports Ancient Origins of Immunological Gene Clusters

L.D. Chaves a, b, S.B. Krueth a, M.M. Bauer a, K.M. Reed a
aDepartment of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, Minn., and bNational Jewish Health, Division of Allergy and Clinical Immunology, Department of Medicine, Denver, Colo., USA

... Sequences were analyzed with the basic local alignment search tool (BLAST), GENESCAN (http://genes.mit.edu/GENSCAN.html) and Softberry FGENESH (http://linux1.softberry.com/ all.htm) to identify putative transcripts and homologies to known genes. ... 


Gene
Volume 452, Issue 2, 1 March 2010, Pages 45-53, doi:10.1016/j.gene.2009.11.001

Comparative genomics identifies new alpha class genes within the avian glutathione S-transferase gene cluster

Ji Eun Kim a, Miranda M. Bauer b, Kristelle M. Mendoza b, Kent M. Reed b and Roger A. Coulombe Jr. a,
a Department of Veterinary Sciences and Graduate Toxicology Program, Utah State University, Logan, UT 84322, USA b Department of Veterinary and Biomedical Sciences, University of Minnesota, St. Paul, MN 55108, USA

.. 2.4. Gene identification and annotation. The assembled sequence was analyzed with Softberry FGENESH (http://linux1.softberry.com/all.htm) and the basic local alignment search tool (BLAST) to identify putative transcripts and homologies to known genes. ... 


Gene
Volume 468, Issues 1-2, 15 November 2010, Pages 41-47 doi:10.1016/j.gene.2010.08.003

Two conserved Z9-octadecanoic acid desaturases in the red flour beetle, Tribolium castaneum

Irene Horne a, Nerida Gibb a, Katherine Damcevski a, Karen Glovera and Victoria S. Haritos a
a CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia

... were obtained. Each of the contigs was then subjected to a gene prediction program in Softberry (http://www.softberry.com/cgi- bin/programs/gfin/fgenesh) using parameters for Brugia malaya and Caenorhabditis elegans. 2.2 ... 


Journal of Invertebrate Pathology
Volume 105, Issue 2, October 2010, Pages 156-163 doi:10.1016/j.jip.2010.06.003

Transient transcription of a putative RNase containing BEN domain encoded in Cotesia plutellae bracovirus induces an immunosuppression of the diamondback moth, Plutella xylostella

Bokri Park and Yonggyun Kim
Department of Bioresource Sciences, Andong National University, Andong 760-749, Republic of Korea

... 17 18 2.2. Gene prediction using bioinformatic tools 19 20 Open reading frame (ORF) was predicted from a viral genome segment using 21 FGENESH program (Softberry, Inc., Mount Kisco, NY, USA) by access to 22 http://linux1.softberry.com/berry.phtml?topic=index&group ... 


Genome
Volume 53, Number 1, 1 January 2010 , pp. 55-67(13)

Microsatellites in Brassica unigenes: relative abundance, marker design, and use in comparative physical mapping and genome analysis

Parida, Swarup K.; Yadava, Devendra K.; Mohapatra, Trilochan

... Also, unigenes were checked using software tools such as FGENESH (Softberry, Inc., Mount Kisco, New York; www. softberry.com), ORF Finder (Stothard 2000; http:// bioinformatics.org/sms/orf_find.html), and UTRScan (http ... 


Bioinformatics
2010, 26 (12): 1488-1492. doi: 10.1093/bioinformatics/btq167

Ergatis: a web interface and scalable software system for bioinformatics workflows

Orvis et al.,
1 Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, MD, 2 J. Craig Venter Institute, Rockville, MD, USA

... Ergatis contains components for over a dozen different gene prediction programs, such as GeneWise (Birney et al., 2004), GeneMark (Besemer and Borodovsky, 2005) and FGENESH (SoftBerry), as well as RNA prediction. ... SoftBerry. "Gene finding in Eukaryota.". ... 


Mol Biol Evol
2010, 27 (11): 2487-2506. doi: 10.1093/molbev/msq133

Orthologous Comparisons of the Hd1 Region across Genera Reveal Hd1 Gene Lability within Diploid Oryza Species and Disruptions to Microsynteny in Sorghum

Sanyal et al.,
1Department of Agronomy, Purdue University 2Department of Plant Sciences, BIO5 Institute, Arizona Genomics Institute, University of Arizona, Tucson

... The sequences were then annotated for genes using a combination of ab initio prediction programs FGENESH (www.softberry.com, Salamov and Solovyev 2000) and Page 8. 8 ... (www.softberry.com, Salamov and Solovyev 2000) and with previous annotation. We ... 


Nucl. Acids Res
2010 doi: 10.1093/nar/gkq1016

FGDB: revisiting the genome annotation of the plant pathogen Fusarium graminearum

Wong et al.,
1Helmholtz Zentrum Munchen, German Research Center for Environmental Health, Institute of Bioinformatics and Systems Biology, Ingolstadter Landstrasse 1, D-85764 Neuherberg, 2Max-Planck-Institute for Terrestrial Microbiology, Department of Organismic Interactions, D-35043 Marburg,

... Based on this set, all gene loci in FGDB v3.1 were re-annotated using a pipeline including (i) Fgenesh with different matrices (www.softberry.com); (ii) GeneMark-ES (8); (iii) Augustus with ESTs, precedingly annotated Fusarium models and/or Neurospora crassa protein ...


PLoS ONE
5(3): e9620. doi:10.1371/journal.pone.0009620

Morphological and Genomic Characterization of Filobasidiella depauperata: A Homothallic Sibling Species of the Pathogenic Cryptococcus Species Complex

Marianela Rodriguez-Carres, Keisha Findley, Sheng Sun, Fred S. Dietrich, Joseph Heitman
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, United States of America

... Assembled sequences were subsequently annotated employing the gene predictor software FGENESH from SoftBerry© and using as reference current gene predictions in C. neoformans (http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup=gf ... 


Mol Biol Rep.
2010 Feb;37(2):801-8. Epub 2009 Jul 4

Molecular cloning and characterization of five genes encoding pentatricopeptide repeat proteins from Upland cotton (Gossypium hirsutum L.)

Yang L, Zhu H, Guo W, Zhang T
National Key Laboratory of Crop Genetics and Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, 210095, Nanjing, Jiangsu, China.

... The remaining non- redundant sequences were assembled by CAP3 assembly tool [24] with default parameter. Potential genes of BAC sequences originated from the G. hirsutum database were predicted by a program: FGENESH (http://www.softberry. ... 


J Mol Evol.
2010 Jan 1. [Epub ahead of print]

Strong Positive Selection Drives Rapid Diversification of R-Genes in Arabidopsis Relatives

Chen Q, Han Z, Jiang H, Tian D, Yang S.
State Key Laboratory of Pharmaceutical Biotechnology, Department of Biology, School of Life Sciences, Nanjing University, Nanjing, 210093, China.

... the gene-finding programs FGENESH (http://www. softberry.com/) and GENSCAN (http://genes.mit.edu/ genescan.html/) to obtain information on complete open reading frames. To exclude potentially redundant candidate NBS ... 


Eukaryotic Cell
January 2010, p. 164-172, Vol. 9, No. 1 doi:10.1128/EC.00194-09

Evolutionary Dynamics of Mating-Type Loci of Mycosphaerella spp. Occurring on Banana

Mahdi Arzanlou, 1,2,3 Pedro W. Crous, 1,2 and Lute-Harm Zwiers 1
Evolutionary Phytopathology, CBS-KNAW Fungal Biodiversity Center, Utrecht 3508 AD, The Netherlands,1 Wageningen University and Research Center (WUR), Laboratory of Phytopathology, Wageningen 6708 PB, The Netherlands,2

... reading frames (ORFs) and intron positions were predicted by comparing the sequence data with known MAT sequences from other filamentous fungi, as well as by means of the FGENESH gene prediction module from the MOLQUEST software package (Softberry, Inc., Mount ... 


Plant Molecular Biology Reporter
Volume 28, Number 1, March 2010 , pp. 152-161(10) DOI: 10.1007/s11105-009-0134-z

Identification of NBS-Type Resistance Gene Homologs in Tobacco Genome

Xiaodong et al.,
1: Institute of Crop Science, Zhejiang University, Hangzhou, 310029, China 2: Joint Laboratory of Tobacco Bioinformatics, Yunnan Institute of Tobacco Science, Yuxi, 653100, China,

... 2006) for sequence cleaning and assembly. FGENESH was used to perform gene prediction (http://www.softberry.com) (Salamov and Solovyev 2000). HMMER (Eddy 1998) was used to search protein sequences Plant Mol Biol Rep (2010) 28:152–161 153 Page 3. ... 


J. Agric. Food Chem.
2010, 58 (5), pp 3184–3190 DOI: 10.1021/jf904367r

An Acidophilic and Acid-Stable b-Mannanase from Phialophora sp. P13 with High Mannan Hydrolysis Activity under Simulated Gastric Conditions

Zhao et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P. R. China

... sequence. Sequence Analysis The exon-intron structure of the full-length mannanase gene was predicted using GENESCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/berry.phtml/). The ... 


New Phytologist
Special Issue: Plant polyploidy

Volume 186, Issue 1, pages 228–238, April 2010 DOI: 10.1111/j.1469-8137.2009.03164.x

Tandem duplication of the FLC locus and the origin of a new gene in Arabidopsis related species and their functional implications in allopolyploids

Nah, G. and Jeffrey Chen, Z.
1. Section of Molecular Cell and Developmental Biology 2. Institute for Cellular and Molecular Biology 3. Section of Integrative Biology 4. Center for Computational Biology and Bioinformatics, The University of Texas at Austin, Austin, TX 78712, USA

... Sonnhammer & Durbin, 1995). The genomic sequences were annotated using fgenesh (http://www.softberry.com), a gene prediction software program for A. thaliana genome annotation (Swarbreck et al., 2008). The predicted genes ... 


Funct Integr Genomics.
2010 May;10(2):241-51. Epub 2009 Dec 12

Recruitment of closely linked genes for divergent functions: the seed storage protein (Glu-3) and powdery mildew (Pm3) genes in wheat (Triticum aestivum L.)

Wang ZN, Huang XQ, Cloutier S.
Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB, Canada, R3T 2M9.

... ricegaas.dna.affrc. go.jp/) using the gene prediction algorithm of FGENESH Funct Integr Genomics Page 3. (http://www.softberry.com/) and GENESCAN (http://gene mark.mit.edu/GENESCAN.htm). The predicted gene sequences ... 


Journal of Basic Microbiology
Volume 50, Issue 1, pages 59–71, February 2010 DOI: 10.1002/jobm.200900113

Adenylyl cyclase regulates heavy metal sensitivity, bikaverin production and plant tissue colonization in Fusarium proliferatum

Gabor Kohut 1, Brigitta Olah 1, Attila L. Adam 1, Jorge Garcia-Martinez 2, Laszlo Hornok Prof. 1
1. Agricultural Biotechnology Center, Mycology Group of the Hungarian Academy of Sciences, Institute of Plant Protection, Szent Istvan University, Godollo, Hungary 2. Department of Genetics, Faculty of Biology, University of Seville, Seville, Spain

... Biotechnology Centre (Godollo, Hungary). Se- quence data were analyzed with the Lasergene software package (DNAStar Inc., Madison, Wisconsin, USA) and the FGENESH program (http://www.softberry.com). Blast searches were ... 


Theor Appl Genet.
2010 Apr;120(6):1099-106. Epub 2009 Dec 24

Fine mapping of pepper trichome locus 1 controlling trichome formation in Capsicum annuum L. CM334.

Kim et al.,
Department of Plant Sciences, Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, South Korea.

... 2003). Repeat sequences were filtered by RepeatMasker (http://www. repeatmasker.org) and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were predicted by FGENESH (http://linux1.softberry.com) or GENESCAN (http://genes. ... 


Eukaryotic Cell
January 2010, p. 46-58, Vol. 9, No. 1 doi:10.1128/EC.00259-09

Organization and Evolutionary Trajectory of the Mating Type (MAT) Locus in Dermatophyte and Dimorphic Fungal Pathogens

Wenjun Li, 1 Banu Metin, 1 Theodore C. White ,2 and Joseph Heitman 1
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina,1 Seattle Biomedical Research Institute, Seattle, Washington2

... Putative genes in the MAT locus and flanking regions were predicted by using a combination of primary annotation from the Broad Institute, GeneMark (37), BLAST (1), ORF Finder (http://www.ncbi.nlm.nih.gov/projects/gorf/), and FGENESH (http://linux1.softberry.com/berry.phtml ... 


Molecular Plant Pathology
2010, 11: 395–407. doi: 10.1111/j.1364-3703.2010.00612.x

The two-component histidine kinase Fhk1 controls stress adaptation and virulence of Fusarium oxysporum

RISPAIL, N. and DI PIETRO, A
Departamento de Genetica, Universidad de Cordoba, Campus de Rabanales Edificio Gregor Mendel C5, 14071 Cordoba, Spain

... ing the complete fhk1 gene, including the promoter, coding region and terminator, was sequenced manually, revealing an open reading frame of 3882 bp interrupted by five putative introns, according to the Fgenesh 2.6 prediction server (http:// linux1.softberry.com/berry.phtml ... 


Funct Integr Genomics
2010 Mar;10(1):111-22. Epub 2009 Aug 2

Conserved globulin gene across eight grass genomes identify fundamental units of the loci encoding seed storage proteins

Gu YQ, Wanjugi H, Coleman-Derr D, Kong X, Anderson OD.
Western Regional Research Center, United States Department of Agricultural-Agricultural Research Service, Albany, CA 94710, USA. yong.gu@ars.usda.gov

... 2003) and wheat A genome (BAC AY494981 and DQ537335, Gu et al. 2004, 2006, respectively). FGENESH (http://www.softberry.com/nucleo.html) and GEN- ESCAN (http://genemark.mit.edu/GENESCAN.htm) were used for gene prediction. ... 


Molecular Breeding
Volume 26, Number 2, August 2010 , pp. 275-292(18)

Genic markers for wild abortive (WA) cytoplasm based male sterility and its fertility restoration in rice

Ngangkham, Umakanta et al.,
1: National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India 2: Division of Genetics, Indian Agricultural Research Institute, New Delhi, 110012, India

... msu.edu/pseudomolecules) and indica cultivar 93–11 (Beijing Rice Information System, http://rice.genomics. org.cn/rice) were downloaded and annotated using FGENESH (http://sun1.softberry.com/berry.phtml) gene prediction software to identify protein encoding genes. ... 


Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184-194 doi:10.1016/j.exppara.2010.07.012

Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases

ATiago M. Martins a, b, Virgilio E. do Rosario b and Ana Domingos a, b
Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal

... A threshold of E 1e-04 was adopted for 93 the tblastn search (Wu et al., 2003). The gene structure of the identified CP genes with 94 multiple exons was predicted using the FGENESH and FGENESH+ software 95 (http://www.softberry.com). ... 


Mol Genet Genomics.
2010 May;283(5):427-38. Epub 2010 Mar 9

Unique evolutionary pattern of numbers of gramineous NBS-LRR genes

Li et al.,
State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China.

... with Xanking regions of 5,000–10,000 bp on both sides, were annotated using the gene-finding programs FGENESH with the monocot training set (http://www.soft- berry.com/) and GENSCAN with the maize training set (http://genes.mit.edu/GENSCAN.html) to obtain informa ...


Mol Biol Evol
2010 doi: 10.1093/molbev/msq156

Tracing the evolution of the floral homeotic B- and C-function genes through genome synteny

Barry Causier *,1, Rosa Castillo 2,4, Yongbiao Xue 3, Zsuzsanna Schwarz-Sommer 2 and Brendan Davies 1
1 Centre for Plant Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom 2 Max-Planck-Institut fur Zuchtungsforschung, Carl-von-Linne-Weg 10, 50829 Koln, Germany

... Lukashin and Borodovsky 1998) (each using the Arabidopsis dataset, with default settings), and FGENESH (www.softberry.com) (using both Arabidopsis and tobacco datasets, with default settings). In most cases each algorithm predicted a similar ... 


Veterinary Immunology and Immunopathology
Volume 137, Issues 1-2, 15 September 2010, Pages 176-180 doi:10.1016/j.vetimm.2010.04.018

Polymorphism of sheep MHC Class IIb gene TAPASIN

N. Siva Subramaniam a, E.F. Morgan a, C.Y. Lee a, J.D. Wetherall a and D.M. Groth a
Western Australian Biomedical Research Institute (WABRI) & Centre for Health Innovation Research Institute, School of Biomedical Sciences, Curtin University of Technology, Perth, Western Australia 6845, Australia

... A consensus genetic structure for sheep 108 TAPASIN was determined from analysis of the predictions from GENSCAN (Burge & 109 Karlin 1997) Burge and Karlin, 1997), TWINSCAN (Korf et al. 2001) and 110 FGENESH (http://www.softberry.com). ... 


Theor Appl Genet.
2010 Feb;120(4):709-20. Epub 2009 Nov 3.

Nucleotide diversity and molecular evolution of the PSY1 gene in Zea mays compared to some other grass species

Fu et al.,
National Maize Improvement Center of China, Key Laboratory of Crop Genomics and Genetic Improvement, China Agricultural University, Yuanmingyuan West Road, Haidian, Beijing, China.

... Gene structure was predicted separately for each species using the soft- ware packages FGENESH (http://linuxl.softberry.com) and NNPP (http://www.fruitfly.org). Alignments were per- formed among all species with the ClustalX version 8.1 (Thompson et al. ... 


The Journal of Immunology
May 1, 2010 vol. 184 no. 9 5038-5046 doi: 10.4049/?jimmunol.0903374

Intron-Containing Type I and Type III IFN Coexist in Amphibians: Refuting the Concept That a Retroposition Event Gave Rise to Type I IFNs

1. Zhitao Qi*†, Pin Nie*, Chris J. Secombes‡ and Jun Zou‡
*State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei; †Chemical and Biological Engineering College, Yancheng Institute of Technology, Jiangsu, China

... ca.expasy.org/tools). Putative transcripts were predicted from the genome sequences using the GenScan program (http://genes/mit.edu/GENSCAN.html) and the Fgenesh program (www.softberry.com). Signal peptides were ... 


Molecular Breeding
Volume 26, Number 2, August 2010 , pp. 325-338(14)

SNP haplotypes of the BADH1 gene and their association with aroma in rice (Oryza sativa L.)

Singh, Anuradha et al.,
1: Rice Genome Laboratory, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India 2: Division of Genetics, Indian Agricultural Research Institute, New Delhi, 110012, India

... work well. The position of exons and introns were identified using gene prediction software FGENESH (www.softberry.com) and verified manually by checking against the full length cDNA sequence of the BADH1 gene. The ... 


Theor Appl Genet.
2010 May;120(7):1443-50. Epub 2010 Jan 2010

Fine mapping of a resistance gene to bacterial leaf pustule in soybean

Kim DH, Kim KH, Van K, Kim MY, Lee SH
Department of Plant Science and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Korea

... Composite interval mapping (CIM) was performed by Qgene V. 4.2.2 (Joehanes and Nelson 2008) with scan interval 1. Gene annotation was conducted with gene prediction program FGENESH (http:// www.softberry.ru) against Arabidopsis database. ... 


Plant Science
Volume 179, Issue 4, October 2010, Pages 399-406 doi:10.1016/j.plantsci.2010.06.017

Disease resistance signature of the leucine-rich repeat receptor-like kinase genes in four plant species

Tang et al.,
a State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 210093 Nanjing, China b Department of Life Science, Lianyungang Teacher's College, 222006 Lianyungang, China

... Then the nucleotide sequences of candidate Ser/Thr/Tyr kinase genes, together with flanking regions of 5,000-10,000 bp at both sides, were annotated using the gene-finding programs FGENESH (http://www.softberry.com/) and GENSCAN (http://genes.mit.edu/genescan.html ... 


Comparative Biochemistry and Physiology Part D: Genomics and Proteomics
Volume 5, Issue 2, June 2010, Pages 151-156 doi:10.1016/j.cbd.2010.03.006

Novel isoform of the Xenopus tropicalis PKA catalytic alpha subunit: An example of alternative splicing

Mohammad Tabish, Vladimir I. Rodionov
Center for Cell Analysis and Modeling, University of Connecticut Health Center, Farmington, Connecticut 06032, USA

... Gene/Exon finding tools were used at HMMgene (http://www.cbs.dtu.dk/services/HMMgene), Genescan (http://genes.mit.edu/ GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/ software/GeneSplicer/), FGENESH (http://www.softberry.com/berry.phtml). ... 


Molecular breeding
2010, vol. 25, no2, pp. 187-201

Development and evaluation of broadly applicable markers for Restorer-of-fertility in pepper

Deuk et al.,
(1) Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute for Agriculture and Life Sciences, Seoul National University, 151-921, Seoul, Korea (2) Breeding and Research Station, Monsanto Korea, 363-955, Chungwon, Korea

... search using petunia Rf gene sequence as query. FGENESH program (www.softberry.com) was used to predict gene sequences from sequences of selected BAC clones. Among predicted fifteen genes, sequence of the first ... 


Plant Science
Volume 179, Issue 3, September 2010, Pages 257-266 doi:10.1016/j.plantsci.2010.05.012

Distribution and diversity of PIF-like transposable elements in the Bambusoideae subfamily

Ming-Bing Zhou a, Jiang-Jie Lu a, Hao Zhonga, Xiang-Min Liu a and Ding-Qin Tang a
a The Nurturing Station for the State Key Laboratory of Subtropical Silviculture, Zhejiang Agriculture and Forestry University, LinAn 311300, Zhejiang Province, PR China

.. The putative coding exons of these sequences, as well as those derived from our 114 PCR experiments, were predicted using web software of Netgene2 115 (http://www.cbs.dtu.dk/services/ NetGene2/) and FGENESH 116 (http://sun1.softberry.com/berry.phtml?topic ... 


Genome
Volume 53, Number 9, 1 September 2010 , pp. 658-666(9)

Comparative genomic analysis of the false killer whale (Pseudorca crassidens) LMBR1 locus

Dae-Won Kim et al.,

.. submit.html) (Benson 1999). We also searched for potential genes on the contig sequences using FGENESH (SoftBerry, Inc., Mount Kisco, New York), geneid (http://genome.imim. es/geneid.html), and GeneMark (http://exon.biology.gatech. edu/eukhmm.cgi). ...


Fungal Genetics and Biology
Volume 47, Issue 8, August 2010, Pages 663-671 doi:10.1016/j.fgb.2010.04.008

Phytophthora nicotianae transformants lacking dynein light chain 1 produce non-flagellate zoospores

Reena D. Narayan a, Leila M. Blackman a, Weixing Shan 1, a and Adrienne R. Hardham a
a Plant Science Division, Research School of Biology, The Australian National University, Canberra, ACT 2601, Australia

... DNA sequences were 22 searched for introns using FGENESH 23 (http://linux1.softberry.com/ berry.phtml?topic=fgenesh&group=programs&subgroup24 =gfind). For phylogenetic analysis, homologues of DLC1 were retrieved from NCBI 25 and JGI databases. ... 


Plant Physiology Preview
Published on September 10, 2010; 10.1104/pp.110.163923

Genome structures and halophyte-specific gene expression of the extremophile Thellungiella parvula in comparison to Thellungiella salsuginea (T. halophila) and Arabidopsis thaliana

Oh et al.,
1 University of Illinois Urbana-Champaign; 2 Purdue University

... An ab-initio ORF prediction with FGENESH(http://linux1.softberry.com/berry.phtml) identified 2,229 ORFs, ... The open reading frames (ORFs) in genomic sequences were predicted ab initio with FGENESH (http://www.softberry.com) adopting Arabidopsis parameters. ... 


BMC Plant Biol.
2010 Aug 19;10:183. doi:10.1186/1471-2229-10-183

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Seabra AR, Vieira CP, Cullimore JV, Carvalho HG.
Instituto de Biologia Molecular e Celular da Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal.

... resources (http://www.medicago.org/genome/). Organization of both GS2 genes and prediction of MtGS2b coding sequence was carried out using the FGENESH2.6 software from Softberry (www.softberry.com). MtGS2a and MtGS2b amino acid sequences were ... 


PLoS ONE
2010 5(4): e9958. doi:10.1371/journal.pone.0009958

Association and Linkage Analysis of Aluminum Tolerance Genes in Maize

Krill AM, Kirst M, Kochian LV, Buckler ES, Hoekenga OA
1 United States Department of Agriculture-Agricultural Research Service, Robert W. Holley Center for Agriculture and Health, Ithaca, New York, United States of America, 2 Cornell University, Department of Plant Breeding and Genetics, Ithaca, New York, United States of America

.. Genes of interest were placed on the physical-genetic map of maize using the BLAST tool implemented by the Maize Genome Sequencing Project [42]. Gene architecture predictions were made using the FGenesH tool as implemented by Softberry [46]. Statistical tests. ... 


Fish & Shellfish Immunology
Volume 29, Issue 4, October 2010, Pages 594-599 doi:10.1016/j.fsi.2010.06.004

Ig heavy chain genes and their locus in grass carp Ctenopharyngodon idella

Xiao et al.,
a State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, China b Graduate School of the Chinese Academy of Sciences, Beijing 100039, China

... sequence. The software GENSCAN (http://genes.mit.edu/GENSCAN.html), 131 FGENESH (http://linux1.softberry.com/all.htm) and BLASTX 132 (http://blast.ncbi. nlm.nih.gov/Blast.cgi) were employed for the genome annotation. ... 


Molecular breeding
2010, vol. 25, no1, pp. 155-166

Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice

Channamallikarjuna et al.,
(1) National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, 110012, New Delhi, India (2) Directorate of Rice Research, Andhra Pradesh, Hyderabad, India

... Nipponbare (www.ncbi.nlm.nih.gov) was used for gene prediction. FGENESH gene pre- diction software (www.softberry.com) was used to predict genes in this sequence. Predicted genes were functionally annotated by using BLASTp (bit- score C 100, E value B -20) software. ... 


Fungal Genetics and Biology
Volume 47, Issue 9, September 2010, Pages 761-772 doi:10.1016/j.fgb.2010.06.001

Characterization of the mating type (MAT) locus in the Phialocephala fortinii s.l. – Acephala applanata species complex

Pascal L. Zaffarano a, Angelo Duo a and Christoph R. Grunig a
a Institute of Integrative Biology (IBZ), Forest Pathology and Dendrology, ETH Zurich, 8092 Zurich, Switzerland

... 184 185 2.5. Annotation of the MAT locus 186 187 Positions of open reading frames, transcription start and poly-A motifs in 188 sequences were predicted with FGENESH (http://linux1.softberry.com/ berry. 189 phtml?topic=fgenesh&group=programs&subgroup=gfind). ... 


Eukaryotic Cell
2010 doi:10.1128/EC.00161-10

Co-localization of Amanitin and a Candidate Toxin-Processing Prolyl Oligopeptidase in Amanita Basidiocarps

Hong Luo, Heather E. Hallen-Adams, John S. Scott-Craig, and Jonathan D. Walton
Department of Energy Plant Research Laboratory, Michigan State University, E. Lansing MI 48824

... AbPOPA and AbPOPB, and two hybridizing clones were sequenced completely. 11 FGENESH (www.softberry.com) was used to predict proteins ab initio using the 12 Coprinopsis cinerea model. Each predicted protein was then used to search GenBank nr 13 using BLASTP. ...


BMC Plant Biology
2010, 10:145doi:10.1186/1471-2229-10-145

Comprehensive Analysis of NAC Domain Transcription Factor Gene Family in Populus trichocarpa

Hu et al.,
1 Qingdao Institute of BioEnergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao 266101, PR China 2 Current address: Complex Carbohydrate Research Center, The University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA

... putative pseudogenes or incorrect annotations, and manual reannotation was performed to correct and reannotate the putative NACs using online web server FGENESH (http://linux1.softberry.com/ berry.phtml) [59]. In this endeavor, seven sequences encoding only ... 


Bioorganic & Medicinal Chemistry
Volume 18, Issue 12, 15 June 2010, Pages 4542-4546 doi:10.1016/j.bmc.2010.04.058

Identification of csypyrone B1 as the novel product of Aspergillus oryzae type III polyketide synthase CsyB

Yasuyo Seshime a, †, Praveen Rao Juvvadi b, ‡, Katsuhiko Kitamoto b, Yutaka Ebizuka c and Isao Fujii a
a School of Pharmacy, Iwate Medical University, 2-1-1 Nishitokuta, Yahaba, Iwate 028-3694, Japan b Department of Biotechnology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan

... These sequences were hand annotated by using FGENESH program (Softberry, Inc.) and/or GeneID program. 25 Acknowledgements We thank Dr. D. Wakana for measurement of the physicochemical properties of the compound, and Dr. T. Kushiro for helpful suggestions. ... 


PNAS
January 5, 2010 vol. 107 no. 1 472-477 doi: 10.1073/pnas.0908007107

Angiosperm genome comparisons reveal early polyploidy in the monocot lineage

Tang, Haibao,Bowers, John E.,Wang, Xiyin,Paterson, Andrew H.
aPlant Genome Mapping Laboratory and bDepartment of Plant Biology, University of Georgia, Athens, GA 30602

... set (Sbi1.4) from the Joint Genomics Institute (19), and the grapevine gene set from Genoscope (3). Two Musa balbisiana BACs (AC226052.1 and AC226053.1) were downloaded from GenBank, with putative gene models predicted using FGENESH (http://www.softberry.com). ... 


BMC Plant Biology
2010, 10:25 6doi:10.1186/1471-2229-10-256

Functional divergence of the NIP III subgroup proteins involved altered selective constraints and positive selection

Qingpo Liu and Zhujun Zhu
College of Agriculture and Food Science, Zhejiang A & F University, Lin'an, Hangzhou 311300, China

... Programs InterProScan [45] and Page 14. ConPred II [46] were utilized to detect conserved domains and predict the putative transmembrane regions (TMs), respectively. FgeneSH (http://linux1.softberry.com/) was employed to predict the gene structures of candidates identified. ...


BMC Plant Biology
2010, 10:180 doi:10.1186/1471-2229-10-180

Structure and evolution of Apetala3, a sex-linked gene in Silene latifolia

Cegan et al.,
1 Laboratory of Plant Developmental Genetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i.Kralovopolska 135, CZ-612 65 Brno, Czech Republic 2 Department of Plant Biology, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno, Czech Republic

... software [48] (http://genes.mit.edu/GENSCAN.html) and FGENESH [49] (http://linux1.softberry. com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ORFs were found with ORF Finder [50] (http://www.ncbi.nlm.nih.gov/projects/gorf/) and a ...


BMC Plant Biology
2010, 10:135 doi:10.1186/1471-2229-10-135

Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection

Cheng et al.,
1 San Joaquin Valley Agricultural Science Center, USDA-ARS 9611 South Riverbend Avenue, Parlier, CA 93648, USA 2 Department of Biology, California State University, Fresno, CA 93740, USA

... a grape genomic database (GenBank Accessions: AM475392.1, CAAP02000243. 1, CAAP02005006.1) using the BLAST (http://www.ncbi.nlm.nih.gov/) and FGENESH (http://www.softberry.com/berry.phtml) programs. A pair ...


BMC Genomics
2010, 11:179 doi:10.1186/1471-2164-11-179

Characterization of the ovine ribosomal protein SA gene and its pseudogenes

Broeke et al.,
1 Department of Nutrition, Genetics and Ethology, Faculty of Veterinary Medicine, Ghent University, Heidestraat 19, B-9820 Merelbeke, Belgium 2 Departamento de Mejora Genetica Animal, INIA, Ctra La Coruna Km 7.5, Madrid 28040, Spain

... Promoter sequences were searched with CISTER, Neural Network Promoter Prediction, FPROM and TFsearch [36,38-40]. ... 36. FGENESH Webserver [http://linux1.softberry.com] ...


Functional Plant Biology
2010 37, 194–205.

Cloning and characterisation of ZmZLP1, a gene encoding an endoplasmic reticulum-localised zinc transporter in Zea mays

Xu Y, Wang B, Yu J, Ao G, Zhao Q
A State Key Laboratory of Agribiotechnology, China Agricultural University, Beijing 100193, China.

... The ZmZIP genomic sequences of Zea mays contigs were from http://maize.tigr.org/release5. 0/azm5.shtmL and were annotated for open reading frames using the gene prediction algorithms of FGenesH (http://www.softberry.com); the others are in GenBank (http://www.ncbi.nlm ...


PLoS Biol
2010, vol. 8, num. 2, e1000313

Genome sequence of the pea aphid Acyrthosiphon pisum

Rozas Liras et al.,

... 2007-04628 award to ACCW. FgenesH models were donated by Softberry, Inc. This research was additionally supported in part by the Intramural Research Program of the NIH, National Library of Medicine. The funders had no ...


BMC Plant Biology
2010, 10:246

Sequencing of 6.7 Mb of the melon genome using a BAC pooling strategy

Gonzalez et al.,
Molecular Genetics Department, Center for Research in Agricultural Genomics CRAG (CSIC-IRTA-UAB), Jordi Girona, 18-26, 08034 Barcelona, Spain

... setting the minimum identity parameter to 92. In some cases, the FGENESH annotation software at http://linux1.softberry.com/berry.phtml, with Arabidopsis as plant model, was used to complement or improve the Augustus annotation. The predicted coding ... 


Plant Physiology
152:1772-1786 (2010)

Genomic Analysis of Wild Tomato Introgressions Determining Metabolism- and Yield-Associated Traits

Kamenetzky et al.,
Instituto de Biotecnologia, Instituto Nacional de Tecnologia Agropecuaria, and Consejo Nacional de Investigaciones Cientificas y Tecnicas, B1712WAA Castelar, Argentina (L.K., R.A., S.B., F.C.); Departamento de Botanica, Instituto de Biociencias, Universidade de Sao Paulo, Sao Paulo 05508–900, Brazil (F.d.G., L.B., M.-A.V.S., M.R.)

... S. pennellii BAC/cosmid full-length sequences as well as three S. lycopersicum BAC clones, C04HBa0331L22, C07HBa0061J13, and C11HBa0062I24, were annotated using two different gene prediction programs: FGENESH (www.softberry.com; Salamov and Solovyev, 2000 ... 


PLoS Pathog
2010 6(4): e1000846. doi:10.1371/journal.ppat.1000846

SREB, a GATA Transcription Factor That Directs Disparate Fates in Blastomyces dermatitidis Including Morphogenesis and Siderophore Biosynthesis

Gauthier et al.,
1 Department of Medicine, University of Wisconsin, Madison, Wisconsin, United States of America, 2 Department of Pediatrics, University of Wisconsin, Madison, Wisconsin, United States of America

... blast.ncbi.nlm.nih.gov/Blast.cgi). FGENESH was used to identify predicted exons and introns in the SREB gene (www.softberry.com). Generation of null mutants. Two vectors, pBTS4-KO1 and pBTS4-KO2, were used to delete. 


Mol Genet Genomics.
2010 Feb;283(2):135-45. Epub 2009 Dec 19

Genome-wide discovery of DNA polymorphism in Brassica rapa

Park S, Yu HJ, Mun JH, Lee SC.
Department of Horticultural Crop Research, National Institute of Horticultural and Herbal Science, RDA, Suwon, 441-440, Republic of Korea.

. 2009). A list of BAC clones with GenBank accession numbers is provided in Table S1. Ab initio gene prediction for the BAC sequences was obtained by using the FGENESH program (www.softberry.com) based on a B. rapa matrix. ... 


Developmental & Comparative Immunology
Volume 34, Issue 4, April 2010, Pages 465-473 doi:10.1016/j.dci.2009.12.007

In search of the origin of FREPs: Characterization of Aplysia californica fibrinogen-related proteins

A.M. Gorbushin, Y.V. Panchin, and N.V. Iakovleva
Institute of Evolutionary Biochemistry and Physiology RAS, pr. Torez 44, Saint-Petersburg 194223, Russia

... contigs having even weak similarity to juxtaposed IgSF and FreD domains were retrieved from the nucleotide database and the coding region was preliminary identified by several invertebrate gene prediction models using FGeneSH software (http://linux1.softberry.com/berry ...


Microbiology
156 (2010), 278-286; DOI 10.1099/mic.0.033886-0

A tyrosine O-prenyltransferase catalyses the first pathway-specific step in the biosynthesis of sirodesmin PL

Anika Kremer and Shu-Ming Li
Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie, Deutschhausstrasse 17A, D-35037 Marburg, Germany

... Computer-assisted sequence analysis. FGENESH (SoftBerry; http://linux1.softberry.com/) and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used for exon/intron prediction and sequence analysis, respectively. ... 


FGENESH 2009

Genome Biology and Evolution
2009 Vol. 1 265-277; doi:10.1093/gbe/evp025

Origin and Diversification of Land Plant CC-Type Glutaredoxins

M. Ziemann*, M. Bhave* and S. Zachgo**
*Environment and Biotechnology Centre, Faculty of Life and Social SciencesSwinburne University of Technology, Hawthorn, Victoria, Australia **Department of Botany, University of Osnabruck, Osnabruck, Germany

... gene models. In cases of low conservation of exon sequences and lack of transcript information, FGENESH hidden Markov model-based gene structure prediction (http://linux1.softberry.com/berry.phtml) was utilized. Values ...


Current Genetics
Volume 55, Number 3 / June, 2009 pp. 253-262

The telomere-linked helicase (TLH) gene family in Magnaporthe oryzae: revised gene structure reveals a novel TLH-specific protein motif

Cathryn J. Rehmeyer, Weixi Li, Motoaki Kusaba and Mark L. Farman
(1) Department of Plant Pathology, University of Kentucky, Lexington, KY 40546, USA (2) Department of Biology, University of Kentucky, Lexington, KY 40546, USA

... Dean et al. 2005). The masked sequences were then used for gene prediction with Fgenesh (Salamov and Solovyev 2000) trained on M. oryzae sequences (Softberry, http://www.softberry.com). Various gene prediction tools ...


Nature
461, 1135-1138 (22 October 2009) | doi:10.1038/nature08498

A transposon-induced epigenetic change leads to sex determination in melon

Martin et al.,
(1) INRA-CNRS, UMR1165, Unite de Recherche en Genomique Vegetale, 2 rue Gaston Cremieux, F-91057 Evry, France (2) Plateforme de Cytologie et d’Imagerie Vegetale, Institut Jean Pierre Bourgin, INRA, 78026 Versailles Cedex, France

... After assembly, two forms of gene annotation were performed: (1) ab initio gene prediction with GENSCAN (http://genes.mit.edu/GENSCAN.html), GeneMark.hmm (http://exon.gatech.edu/ GeneMark/eukhmm.cgi) and FGENESH (http://www.softberry.com/berry.phtml); and (2 ...


Journal of Equine Veterinary Science
2009 Volume 29, Issue 6, Pages 519-526

Search for Polymorphism in Exon 2 of the Equine Leptin Gene

N. Huff, D. Thompson Jr., K. Bondioli

... View Within Article. Splicing donor and acceptor consensus sequences were located at the putative exon/intron borders. The predicted splice sites at the intron/exon boundaries were analyzed using a computer program (FGeneSH, Softberry, Inc., Mount Kisco, NY). ...


Molecular Genetics and Genomics
Volume 282, Number 2 / August, 2009, pp. 205-215

Genome-wide analysis of conservation and divergence of microsatellites in rice

Manish Roorkiwal 1, Atul Grover 1 and Prakash C. Sharma 1
(1) University School of Biotechnology, Guru Gobind Singh Indraprastha University, Kashmere Gate, Delhi, 110403, India

.. 1.6.2 (Softberry; downloadable from http://www.molquest.com) prior to the alignment. This allowed much higher number of queries to be handled per day compared to a maximum of 25 per day when FGENESH was accessed through World Wide Web portal of Softberry. ...


Russian Journal of Plant Physiology
Volume 56, Number 4 / July, 2009, pp.532-539

Delimitation of the fgr gene for rice fragrance to a 28-kb DNA fragment

Ding et al.,
(1) College of Agriculture and Biotechnology, China Agricultural University, Beijing, 100094, China (2) High-Tech Research Center, Shandong Academy of Agricultural Science, Jinan, Shandong, 250100, China

... region. The sequence analysis of this fragment using FGENESH (http:/www.softberry. com) predicted three candidate genes encoding putative 3-methyllcrotonyl- CoA carboxylase, putative isoleucyl-tRNA synthetase, and BADH2. ...


BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271

The evolution of Brassica napus FLOWERING LOCUST paralogues in the context of inverted chromosomal duplication blocks

Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted Research, Harpenden, Herts, AL5 2JQ, UK

... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ... "Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...


Theor Appl Genet.
2009 May;118(8):1509-17. Epub 2009 Mar 6.

Fine mapping SPP1, a QTL controlling the number of spikelets per panicle, to a BAC clone in rice (Oryza sativa)

Liu T, Mao D, Zhang S, Xu C, Xing Y.
National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, 430070, Wuhan, China.

... Putative ORF prediction in 107 kb region The putative open reading frame (ORF) in the 107-kb region was predicted by the online software FGENESH on the basis of the gene structure available on the Internet (http://linux1.softberry.com/berry.phtml?topic=fgenesh& ... Cited by 1 - Related articles - All 3 versions


PLoS One.
2009; 4(9): e6981 doi: 10.1371/journal.pone.0006981.

Identifying and Characterizing a Novel Protein Kinase STK35L1 and Deciphering Its Orthologs and Close-Homologs in Vertebrates

Pankaj Goyal, 1* Antje Behring, 1 Abhishek Kumar, 2 and Wolfgang Siess 1
1Institute for Prevention of Cardiovascular Diseases, University of Munich, Munich, Germany 2University of Bielefeld, Bielefeld, Germany

... This region was highly conserved among mammals (Figure 3B Figure 3 ). We investigated this region for coding sequences manually and by using different gene prediction software such as FGENESH (www.softberry.com). ...


Molecular Immunology
Volume 46, Issues 8-9, May 2009, Pages 1679-1687

The immunoglobulin heavy chain locus in the reptile Anolis carolinensis

Francisco Gambon Deza, Christian Sanchez Espinel and Susana Magadan Mompo
aUnidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n°, Vigo 36210, Pontevedra, Spain bInstituto Superior de Saude do Alto Ave (ISAVE), Quinta de Matos, Geraz do Minho, 4830-31 PVL, Portugal

... The constant region genes and exons were obtained by comparison with those already described for E. macularius. A dotplot was made with E. macularius and A. carolinensis sequences using the DNASTAR (lasergene), FGENESH and FEX software (http://www.softberry.com). ...


The Plant Genome
doi: 10.3835/?plantgenome.2009.01.0001 vol. 2 no. 3 211-223

Retrotransposons within Syntenic Regions between Soybean and Medicago truncatula and Their Contribution to Local Genome Evolution

Bindu Joseph et al.,
Dep. of Agronomy, Iowa State Univ., Ames, IA 50011

... (2006). BAC Sequence Analysis. The LG I UBP12 region BAC sequences were annotated using gene prediction programs FGENESH (www.softberry.com) and GeneMark (Lomsadze et al., 2005, http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi; verified 30 July 2009). ...


Plant Science
Volume 176, Issue 3, March 2009, Pages 352-359

Characterization of six novel NAC genes and their responses to abiotic stresses in Gossypium hirsutum L.

Chaomin Meng, Caiping Cai, Tianzhen Zhang and Wangzhen Guo
National Key Laboratory of Crop Genetics & Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, PR China

... Additionally, assembled sequences were compared to exon predictions from FGENESH (http://www.softberry.com). From these gene predictions, gene-specific primers (Table 1) were designed for PCR from cDNA and genomic DNA. ...


J Biosci.
2009 Jun;34(2):251-61.

Physical mapping, expression analysis and polymorphism survey of resistance gene analogues on chromosome 11 of rice.

Ghazi IA, Srivastava PS, Dalal V, Gaikwad K, Singh AK, Sharma TR, Singh NK, Mohapatra T.
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110 012, India.

... The FASTA form of each BAC/PAC clone sequence was downloaded as a text file one by one. Gene prediction was performed for each clone using FGENESH (www. softberry.com) trained for monocot species (Salamov and Solovyer 2000). ...


TAG Theoretical and Applied Genetics
Volume 118, Number 6 / April 2009 pp. 1027-1034

Identification and mapping of Pi41 , a major gene conferring resistance to rice blast in the Oryza sativa subsp. indica reference cultivar, 93-11

Qinzhong Yang 1, 2, Fei Lin 1, Ling Wang 1 and Qinghua Pan 1
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, 510642 Guangzhou, China

... markers. Flanking markers were used to identify candidate NBS- LRR genes, with the help of GENSCAN (http://genes.mit. edu), FGENSH (http://sun1.softberry.com) and RiceGAAS (http://rgp.dna.affrc.go.jp) software. The sequence ...


Developmental & Comparative Immunology
Volume 33, Issue 4, April 2009, Pages 547-558

Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties

Baojian Sun, Borre Robertsen, Zhiqiang Wang and Bin Liu
aDepartment of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromso, N-9037 Tromso, Norway bInstitute of Oceanology, Chinese Academy of Sciences, Qingdao and Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China

... 2.2. Bioinformatics. Annotation of genes in genomic sequences was performed by analysis with the programs Genscan (http://genes.mit.edu/GENSCAN.html) and Fgenesh (http://softberry.com) combined with manual inspections. ...


The Plant Genome
doi: 10.3835/?plantgenome2008.09.0007 vol. 2 no. 1 93-101

Gene Content and Distribution in the Nuclear Genome of Fragaria vesca

Pontaroli et al.,
Dep. of Genetics, Univ. of Georgia, Athens, GA 30602;

... Gordon et al., 1998). Fosmid Sequence Annotation. Ab initio gene prediction was performed on each fosmid sequence using FGENESH (Softberry, Inc., Mount Kisco, NY) with the Arabidopsis training set. All the obtained predicted ...


Planta
Volume 229, Number 4 / March, 2009, pp. 885-897

Regulation of the cellulose synthase-like gene family by light in the maize mesocotyl

Harrie van Erp 1, 2 and Jonathan D. Walton 1
(1) Department of Energy-Plant Research Laboratory, Michigan State University, E. Lansing, MI 48824, USA (2) Present address: Institute of Biological Chemistry, Washington State University, Pullman, WA, 99164, USA

... Supplementary Table S1). Proteins encoded by the MAGI sequences were determined using the FGENESH monocotyledon ab initio gene prediction program (http://www.softberry.com) (Yao et al. 2005). The predicted protein ...


BMC Plant Biol.
2009 Jul 17;9:93.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.

Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.

... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih. gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...


Plant Molecular Biology
Volume 70, Numbers 1-2 / May, 2009, pp. 47-61

Structural characterization of Brachypodium genome and its syntenic relationship with rice and wheat

Naxin Huo et al.,
(1) Genomics and Gene Discovery Research Unit, USDA-ARS, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, USA (2) Department of Plant Sciences, University of California, Davis, CA 95616, USA

... In addition, coding regions in the BAC sequences were also predicted using FGENESH (http:// www.softberry.com) set for a monocot model. Predicted genes were then compared to the nonredundant and dbEST databases of NCBI (March 2008) using BLASTN and BLASTX. ...


Molecular Plant
2009 doi:10.1093/mp/ssp064

The CELLULOSE-SYNTHASE LIKE C (CSLC) Family of Barley Includes Members that Are Integral Membrane Proteins Targeted to the Plasma Membrane

Dwivany et al.,
Plant Cell Biology Research Centre, School of Botany, University of Melbourne Victoria 3010, Australia

... the 5' and 3' directions. Most of the intron/exon boundaries predicted by FGENESH (www.softberry.com) in the HvCSLC1 and HvCSLC4 genomic sequences were confirmed from EST data. A schematic representation of the ...


Plant Physiology and Biochemistry
Volume 47, Issue 7, July 2009, Pages 650-652

Evidence of a sirtuin gene family in grapevine (Vitis vinifera L.)

Matteo Busconi, Serena Reggi, Corrado Fogher and Luigi Bavaresco
aIstituto di Botanica e Genetica vegetale, Universita Cattolica del Sacro Cuore, Via Emilia Parmense, 84 29100 Piacenza, Italy bIstituto di Frutti-Viticoltura, Universita Cattolica del Sacro Cuore, Via Emilia Parmense, 84 29100 Piacenza, Italy

... When appropriate, the prediction of hypothetical gene structure was performed using the following software in parallel: FGENESH (http://linux1.softberry.com), GeneMark (http://exon.gatech.edu), and GENSCAN (http://genes.mit.edu). ...


Fungal Genetics and Biology
Volume 46, Issue 9, September 2009, Pages 695-706

Mutations to LmIFRD affect cell wall integrity, development and pathogenicity of the ascomycete Leptosphaeria maculans

Angela P. Van de Wouw, Filomena A. Pettolino, Barbara J. Howlett and Candace E. Elliott
aSchool of Botany, The University of Melbourne, Vic. 3010, Australia

... study are listed in Table 1. The coding region of a gene flanking the T-DNA insertion (subsequently referred to as LmIFRD) and a gene downstream of the T-DNA (subsequently referred to as LmcABH-like) were predicted using FGENESH software (http://www.softberry.com/berry ...


BMC Evol Biol.
2009 Jul 19;9:168.

Evolution of a subtilisin-like protease gene family in the grass endophytic fungus Epichloe festucae

Bryant MK, Schardl CL, Hesse U, Scott B.
Institute of Molecular Biosciences, Massey University, Private Bag 11222, Palmerston North, New Zealand

... reading frames for SLP and unlinked non-SLP genes were identified using FGENESH, an HMM-based gene structural prediction using the Fusarium graminearum parameters (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfi nd). ...


Functional & Integrative Genomics
Volume 9, Number 1 / February, 2009, pp. 97-108

The 172-kb genomic DNA region of the O. rufipogon yld1.1 locus: comparative sequence analysis with O. sativa ssp. japonica and O. sativa ssp. indica

Beng-Kah Song et al.,
(1) School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia (2) Genome Dynamics Program, Scottish Crop Research Institute, Dundee, DD2 5DA, UK

... affrc.go.jp/usr-bin/login.cgi) and was aided by the rice training set of the gene-finding program GeneMark.hmm (Lukashin and Borodovsky 1998, http://genemark.biology. gatech.edu/GeneMark/), fgenesh (http://www.softberry. com/berry.phtml) and RiceHMM (Sakata et al. ...


Genetics
Published Articles Ahead of Print: October 12, 2009, doi:10.1534/genetics.109.106922

Fine Mapping and Haplotype Structure Analysis of a Major Flowering Time Quantitative Trait Locus on Maize Chromosome 10

Ducrocq et al.,
INRA

... c0111K09) were analyzed using TE-Nest (KRONMILLER and WISE 2008) and RepeatMasker (http://www.repeatmasker.org/) in order to localize transposable elements. Masked sequences were annotated using Fgenesh (http://linux1.softberry.com/berry.phtml, version 2.6). ...


Plant Molecular Biology Reporter
Volume 27, Number 4 / December, 2009, pp. 526-533

The Promoters of Forisome Genes MtSEO2 and MtSEO3 Direct Gene Expression to Immature Sieve Elements in Medicago truncatula and Nicotiana tabacum

Noll et al.,
1) Institut fur Biochemie und Biotechnologie der Pflanzen der Westfalischen Wilhelms, Universitat Munster, Hindenburgplatz 55, Munster, 48143, Germany (2) Department of Biology, University of York, Heslington, York, YO10 5DD, UK

... The MtSEO promoter sequences were aligned using the Lasergene software package v7.1 (DNAstar, Madison, WI, USA). Putative TATA box sequences were identified by analyzing the corresponding genomic clone using the FGENESH program (http://www.softberry.com). ...


Molecular Genetics and Genomics
Volume 281, Number 5 / May, 2009, pp. 565-578

Characterization of cyclophilin-encoding genes in Phytophthora

Pamela Hui Peng Gan 1 , Weixing Shan 1, 2, Leila M. Blackman 1 and Adrienne R. Hardham 1
1) Plant Cell Biology Group, Research School of Biological Sciences, School of Biology, The Australian National University, GPO Box 475, Canberra, ACT, 2601, Australia (2) Present address: College of Plant Protection, Northwest A & F University, Yangling, China

... eng/scripts/01_13.html. Genes were predicted from genomic sequences using FGENESH (Softberry Inc., Mount Kisco, NY, USA), with diatom-speciWc parameters and GENSCAN (Chesnick et al. 2000). To analyze pro- moter ...


Heredity.
2009 Mar;102(3):266-73. Epub 2008 Nov 12

Evolutionary fate of rhizome-specific genes in a non-rhizomatous Sorghum genotype

Jang et al.,
Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30602, USA.

... GAP2 (Huang, 1994) programs. Alternatively, gene structures were predicted by FGE- NESH gene prediction software (http://sun1.softberry. com/berry.phtml) with the training set for monocot plants. Orthologs of Oryza sativa ...


Molecular Breeding
Volume 24, Number 4 / November, 2009, pp. 433-446

Development of SNP markers linked to the L locus in Capsicum spp. by a comparative genetic analysis

Hee-Bum Yang 1, Wing Yee Liu 1, Won-Hee Kang 1, Molly Jahn 2 and Byoung-Cheorl Kang
(1) Department of Plant Science, Seoul National University, 599 Gwanak-ro Gwank-gu, Seoul, 151-921, Korea (2) College of Agriculture and Life Science, University of Wisconsin, Madison, WI 53706, USA

... National University, Korea). BAC sequence annotation The FGENESH program (http://linux1.softberry.com/ berry.phtml) was used to predict genes from the contig sequence based on tomato organism informa- tion. To search for ...


BMC Biol.
2009 Jul 23;7:43.

Features of the ancestral bilaterian inferred from Platynereis dumerilii ParaHox genes

Hui et al.,
Department of Zoology, University of Oxford, Oxford, UK

... To find additional genes in these contigs besides the ParaHox genes, the entire contig sequences were scanned with GENSCAN and FGENESH (implemented at www.softberry.com [79]), and all predicted peptide sequences searched against Genbank with BLASTP. ...


Genetics
Vol. 181, 405-419, February 2009, doi:10.1534/genetics.108.093583

Molecular Analysis of a Large Subtelomeric Nucleotide-Binding-Site–Leucine-Rich-Repeat Family in Two Representative Genotypes of the Major Gene Pools of Phaseolus vulgaris

Geffroy et al.,
* Institut de Biotechnologie des Plantes, UMR-CNRS 8618, INRA, Universite Paris-Sud, 91 405 Orsay, France, Department of Chromosome Biology, University of Vienna, 1030 Vienna, Austria

... Ann Arbor, MI). The genomic sequence was annotated by using the gene prediction program Fgenesh (Softberry website) and was manually edited by a homology search against available databases. The genomic sequence ...


Molecular Biology and Evolution
2009 26(7):1651-1661; doi:10.1093/molbev/msp076

Sixty Million Years in Evolution of Soft Grain Trait in Grasses: Emergence of the Softness Locus in the Common Ancestor of Pooideae and Ehrhartoideae, after their Divergence from Panicoideae

Charles et al.,
* Unite de Recherches en Genomique Vegetale (UMR INRA 1165–CNRS 8114UEVE), Organization and evolution of Plant Genomes, Evry, France Plant Genome Mapping Laboratory, University of Georgia

... We used the gene prediction given by the program FGENESH (http://www.softberry.com; with the Monocot matrix) as well as BlastN and BlastX and TBlastX alignments against dbEST (http://www.ncbi.nlm.nih.gov/), SwissProt (http://expasy.org/sprot/), and synteny with ...


BMC Genomics.
2009 Aug 13;10:376.

Integrating microarray analysis and the soybean genome to understand the soybeans iron deficiency response

O'Rourke et al.,
Department of Genetics, Developmental and Cellular Biology, Iowa State University, Ames, Iowa 50011, USA.

... QTL (Figure 1, Additional files 1 and 2). Sequences of the delineated iron QTL regions were analyzed using FGENESH (www.softberry.com) using Arabidopsis as the training model to identify gene structure predictions. The ...


Fungal Genetics and Biology
Volume 46, Issue 5, May 2009, Pages 353-364

Biosynthesis of the cyclooligomer depsipeptide bassianolide, an insecticidal virulence factor of Beauveria bassiana

Yuquan Xu et al.,
aSW Center for Natural Products Research and Commercialization, Office of Arid Lands Studies, College of Agriculture and Life Sciences, The University of Arizona, 250 E. Valencia Rd., Tucson, AZ 85706-6800, USA bDepartment of Entomology, College of Agriculture and Life Sciences, The University of Arizona, 1140 E. South Campus Dr., Tucson, AZ 85721-0036, USA

... closure. Sequence assembly was done with Sequencher 4.7 (Gene Codes Corp). HMM-based gene models were built with FGENESH (Softberry) using the F. graminearum and the Aspergillus nidulans training sets. The models ...


Theor Appl Genet.
2009 Apr;118(6):1199-209. Epub 2009 Feb 15.

ps-2, the gene responsible for functional sterility in tomato, due to non-dehiscent anthers, is the result of a mutation in a novel polygalacturonase gene

Gorguet B, Schipper D, van Lammeren A, Visser RG, van Heusden AW.
Graduate School of Experimental Plant Sciences, Wageningen UR Plant Breeding, PO Box 386, 6700 AJ, Wageningen, The Netherlands

... genetic map. ORF4, a putative polygalacturonase gene, mapped the clos- est to the ps-2 locus (Fig. 2). Subsequently, the putative introns and exons were identiWed using the FGENSH soft- ware of Softberry. The candidate ...


Molecular & Cellular Proteomics
October 1, 2009, 8, 2368-2381.

In Planta Proteomics and Proteogenomics of the Biotrophic Barley Fungal Pathogen Blumeria graminis f. sp. hordei

Bindschedler et al.,
School of Biological Sciences, The University of Reading, P. O. Box 221, Reading RG6 6AS, United Kingdom, Centre for Bioinformatics, Imperial College, Fleming Building, South Kensington Campus, London SW7 2AZ, United Kingdom

... to predict ORFs. Putative ORFs were determined with the FGENESH prediction program using either the Leptosphaeria maculans or the Sclerotinia sclerotiorum ORF prediction models (SoftBerry, Inc.). Putative classical secretion ...


PLoS Pathog.
2009 January; 5(1): e1000261.

Genomic Survey of the Non-Cultivatable Opportunistic Human Pathogen, Enterocytozoon bieneusi

Akiyoshi et al.,
1Division of Infectious Diseases, Department of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, North Grafton, Massachusetts, United States of America 2Marine Biological Laboratory, Woods Hole, Massachusetts, United States of America

... ECU08_1090/ECU08_1100). Introns. DNA sequences of contigs greater than 10 kb were analyzed by FGENESH (http://www.softberry.com; [44]), an HMM-based gene structure prediction program, to identify putative introns. For the ... Cited by 11 - Related articles - All 7 versions


BMC Res Notes.
2009; 2: 206.

Intragenic tandem repeats in Daphnia magna: structure, function and distribution

Isabelle Colson,1 Louis Du Pasquier,1 and Dieter Ebert 1
1Basel University, Zoological Institute, Vesalgasse 1, CH-4051 Basel, Switzerland

... 18. Salamov A, Solovyev V:Ab initio gene finding in Drosophila genomic DNA. Genome Res 2000,10: 516-522. 19. Fgenesh [http://linux1.softberry.com/berry.phtml?topic= fgenesh&group=programs&sy bgroup=gfind]. Page 13. - 12 - 20. ...


World Journal of Microbiology and Biotechnology
Volume 25, Number 6 / June, 2009, pp. 989-995

Characteristic analysis of transformants in T-DNA mutation library of Monascus ruber

Shao et al.,
(1) College of Food Science and Technology, Huazhong Agricultural University, Hongshan District, 430070 Wuhan, Hubei, People’s Republic of China

... et al. 2004) was carried out to extend the DNA sequences flanking TAIL-PCR products. Up to now, we have amplified eight full DNA sequences, which were submitted to FGENESH (http://linux1.softberry.com/berry. phtml) to ...


PLoS Pathogens
January 2009, Volume 5, Issue 1, e1000261. doi:10.1371/journal.ppat.1000261

Genomic Survey of the Non-Cultivatable Opportunistic Human Pathogen, Enterocytozoon bieneusi

Akiyoshi et al.,
1 Division of Infectious Diseases, Department of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, North Grafton, Massachusetts, United States of America, 2 Marine Biological Laboratory, Woods Hole, Massachusetts, United States of America

... ECU08_1090/ECU08_1100). Introns. DNA sequences of contigs greater than 10 kb were analyzed by FGENESH (http://www.softberry.com; [44]), an HMM-based gene structure prediction program, to identify putative introns. For the ...


PNAS
February 17, 2009 vol. 106 no. 7 2295-2300 doi: 10.1073/pnas.0807350106

Duplicate genes increase expression diversity in closely related species and allopolyploids

Misook Ha a,b,c, Eun-Deok Kim a and Z. Jeffrey Chen a,b,c,d
Sections of aMolecular Cell and Developmental Biology and dIntegrative Biology bCenter for Computational Biology and Bioinformatics, and cInstitute for Cellular and Molecular BiologyOne University StationA-4800University of TexasAustinTX 78712

... The sequencing reads were assembled and edited. A. arenosa genes were annotated using FGENESH (www.softberry.com) and BLAST against cDNA sequences of A. thaliana. Annotated genomic sequences are deposited in GenBank (accession no. FJ461780). ...


Plant Physiology
149:286-296 (2009)

A Germin-Like Protein Gene Family Functions as a Complex Quantitative Trait Locus Conferring Broad-Spectrum Disease Resistance in Rice

Manosalva et al.,
Bioagricultural Sciences and Pest Management and Program in Plant Molecular Biology, Colorado State University, Fort Collins, Colorado 80523–1177 (P.M.M., R.M.D, J.E.L.); Plant Pathology, Kansas State University, Manhattan, Kansas 66502–5502 (P.M.M.);

... cgi) using the HTGS database. FGENESH (http://www.softberry.com/berry.phtml) was used to predict putative oxalate oxidase and OsGLP from significant rice bacterial artificial chromosome hits. All nucleotide and inferred amino ...


Plant Journal.
60(1):181-193, October 2009.

Genome organization of the tomato sun locus and characterization of the unusual retrotransposon Rider

Jiang N, Gao D, Xiao H, van der Knaap E.
Department of Horticulture, Michigan State University, East Lansing, MI 48824, USA.

... Tomato eIF4a6 was used to assess equal loading and mRNA and cDNA quality. Primer sequences are listed in Table S3. Annotations TOP. The gene sequences were identified using the ab initio gene prediction program FGENESH (http://www.softberry.com/berry.phtml ). ...


Nucleic Acids Research
2009, Vol. 37, Database issue D750-D754 doi:10.1093/nar/gkn887

SpBase: the sea urchin genome database and web site

R. Andrew Cameron, Manoj Samanta, Autumn Yuan, Dong He and Eric Davidson
Center for Computational Regulatory Genomics, Beckman Institute 139–74, California Institute of Technology, Pasadena, CA 91104, USA

... were independently employed by individual groups to arrive at sets of gene models for eventual annotation: Gnomon at NCBI (13); FgenesH from Softberry (14,15 ...


FGENESH 2008

Nature
2008, 4doi:10.1038/nature07410

The Phaeodactylum genome reveals the evolutionary history of diatom genomes.

Bowler et al.
1. CNRS UMR8186, Department of Biology, Ecole Normale Supe'rieure, 46 rue d'Ulm, 75005 Paris, France
2. Stazione Zoologica 'Anton Dohrn', Villa Comunale, I-80121 Naples, Italy

... Gene predictors used for these annotations included ab initio Fgenesh 12 trained on sets of known genes and reliable homology-based gene models from P. tricornutum and T.pseudonana, and homology-based Fgenesh+ 12 and Genewise 13 seeded by BLASTX alignments against sequences in the NCBI non-redundant protein set. ...


Nature
2008, 452, 949 - 955.

The genome of the model beetle and pest Tribolium castaneum.

Richards et al.
1. Human Genome Sequencing Cente
2. Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA.

... Work at the BCM-HGSC was funded by grants from the NHGRI and USDA. FgenesH and FgenesH++ analysis was donated by Softberry Inc. This research was additionally supported in part by the Intramural...


Nature
2008, 452, 991 - 996.

The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus)

Ming et al.
Hawaii Agriculture Research Center, Aiea, Hawaii 96701, USA
Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801, USA

...in training ab initio gene prediction software Augustus, GlimmerHMM and SNAP. Ab initio gene prediction software Fgenesh, Genscan and TWINSCAN were trained on Arabidopsis. Spliced alignments of proteins from the plant division of...


Nature
Volume 453 Number 7198 pp1064 - 1071 (19 Jun 2008), doi: 10.1038/nature06967

The amphioxus genome and the evolution of the chordate karyotype.

Putnam et al.
# Department of Energy Joint Genome Institute, Walnut Creek California 94598, USA
# Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720, USA

... A\Supplementary Note 3. Annotation of protein coding genes 3.1 Expressed sequence tag sequencing. cDNA libraries for amphioxus were prepared from gastrula and neurula stage embryos, and from larvae as described by 6, and a single library was created for Petromyzon marinus (sea lamprey). Approximately 32,000 expressed sequence tags (ESTs) were attempted from each library. (Supplementary Table S6). 3.2 Gene prediction, functional annotation and quality control. The JGI Annotation Pipeline was used for annotation of the amphioxus v1.0 assembly described here. The pipeline includes the following steps: (1) repeat masking, (2) mapping ESTs, full length cDNAs, and putative full length known genes, (3) gene structure prediction using several methods, (4) protein functional annotation using several methods, and (5) combining gene predictions into a non redundant representative set of gene models, which are subject to genome-scale analysis. The genomic sequence, predicted genes and annotations of amphioxus, together with available evidence, are available at the JGI Genome Portal (www.jgi.doe.gov/Amphioxus) and from GenBank under accession number ABEP01000000. Transposons were masked using RepeatMasker 7 tools and a custom library of manually curated repeats (see above Supplementary Note 2.4). 480,070 ESTs were clustered into 77,402 consensus sequences and both individual ESTs and consensus sequences were mapped onto genome assembly using BLAT4. Gene predictors used for annotation of amphioxus v1.0 included ab initio FGENESH 8, homology- based FGENESH+ 8, homology-based GENEWISE 9, and EST-based ESTEXT (Grigoriev, unpublished, available upon request). ...


Nature
452, 88 - 92 (06 Mar 2008), doi: 10.1038/nature06556, Letter

The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis

Martin et al.,
MR 1136, INRA-Nancy Universite, Interactions Arbres/Microorganismes, INRA-Nancy, 54280 Champenoux, France.

...in the scaffold assembly (Supplementary Table 2). Genome annotation Gene models were predicted using FgenesH, homology-based FgenesH+ (ref. 18) and Genewise, as well as EuGAne and TwinScan, and alignments of several complementary DNA...


Nature
451, 193 - 196 (10 Jan 2008), doi: 10.1038/nature06453, Letter

Identification of the sex genes in an early diverged fungus

Alexander Idnurm, Felicia J. Walton, Anna Floyd, Joseph Heitman
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710, USA.

...were searched with BLASTp, BLASTn or tBLASTn programs. Gene predictions from unannotated genomic DNA were made with FGENESH software using the settings for Schizosaccharomyces pombe. HMG domains were aligned in ClustalW, in MacClade...


Genetics
Published Articles Ahead of Print: December 15, 2008, doi:10.1534/genetics.108.093583

Molecular Analysis of a Large Subtelomeric NBS-LRR Family in Two Representative Genotypes of the Major Gene Pools of Phaseolus vulgaris

Valerie et al.,
Institut de Biotechnologie des Plantes University of Vienna Institut Pasteur

... Arbor, MI, USA). The genomic sequence was annotated by using the gene prediction program Fgenesh (Softberry website) and was manually ...


PLoS Genet.
2008 November; 4(11): e1000261.

Zebrafish Mutants calamity and catastrophe Define Critical Pathways of Gene–Nutrient Interactions in Developmental Copper Metabolism

Erik C. Madsen and Jonathan D. Gitlin
Edward Mallinckrodt Department of Pediatrics, Washington University School of Medicine, St. Louis, Missouri, United States of America

... This contig was scanned for potential genes using the FGENESH program (www.softberry. com) and comparing to the Ensembl database (www.ensembl.org). ...


BMC Plant Biology
2008, 8:133 doi:10.1186/1471-2229-8-133

The lipoxygenase gene family: a genomic fossil of shared polyploidy between Glycine max and Medicago truncatula

Shin et al.,
Department of Plant Science, Seoul National University, Seoul 151-921, Korea

... FgeneSH on an Arabidopsis matrix, because the resultswere better suited for BLASTZ resultsthan that of the Medicago matrix (http://www.softberry.com). Each ...


BMC Genomics
2008, 9:555 doi:10.1186/1471-2164-9-555

New insights into the origin of the B genome of hexaploid wheat: Evolutionary relationships at the SPA genomic region with the S genome of the diploid relative Aegilops speltoides

Salse et al.,
Organisation and Evolution of Plant Genomes (OEPG), UMR INRA 1165 - CNRS 8114 UEVE - Unite de Recherche en Genomique Vegetale (URGV). 2, rue Gaston Cremieux, CP5708, 91057 Evry cedex. France.

Gene structures and putative functions were identified by combining results of BLASTN and BLASTX alignments against dbEST (http://www.ncbi.nlm.nih.gov/) and SwissProt databases (http://expasy.org/sprot/), with results of 2 gene predictor programs, Page 17 15 Eugene [53] with rice (Oryza sativa) training version and FgeneSH [54] (with default parameters (http://sun1.softberry.com/).


BMC Genetics
2008, 9:78 doi:10.1186/1471-2156-9-78

Genomic Complexity of the Variable Region-Containing Chitin-Binding Proteins in Amphioxus

Dishaw et al.,
All Children’s Hospital,Department of Molecular Genetics,801SixthStreet South,St. Petersburg,FL 33701,USA

... html),FGENESH and FGENESH+ (http://linux1.softberry.com/all.htm) or genomescan[63,66] (http://genes.mit.edu/genomescan. html).Details ...


BMC Evolutionary Biology
2008, 8:115 doi:10.1186/1471-2148-8-115

Roots of angiosperm formins: the evolutionary history of plant FH2 domain-containing proteins

Michal Grunt, Viktor Zarsky and Fatima Cvrckova
Department of Plant Physiology, Faculty of Sciences, Charles University, Vinicna' 5, CZ 128 43 Praha 2, Czech Republic

... For each new gene, splice sites were predicted using at least three of the following eukaryotic gene-prediction programs: GeneMark.hmm [84], FGENESH [85] at the Softberry, Inc. website [86] ...


Appl. Environ. Microbiol.
December 2008 doi:10.1128/AEM.01889-08

Telomere organization in the ligninolytic basidiomycete Pleurotus ostreatus

Gumer Perez, Jasmyn Pangilinan, Antonio G. Pisabarro, and Lucia Ramirez
Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, 31006 Pamplona, Spain; DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598, USA

... The Hidden 153 Markov Model (HMM)-based program FGENESH was used for web-based gene 154 prediction (http://www.softberry.com/berry.phtml). ...


International Journal of Integrative Biology
2008 v.3 No 1, 50

SNP in Granule Bound Starch Synthase-I (GBSS-I) gene in Indian rice genotypes

SK Srivastava, U Roy

... The genes for both the BACs have been predicted using FGENESH software (http://www.softberry.com), which revealed the presence of 23 and 34 genes respectively ...


International Journal of Plant Genomics
Volume 2008, Article ID 391259, 8 pages doi:10.1155/2008/391259

Conserved Microsynteny of NPR1 with Genes Encoding a Signal Calmodulin-Binding Protein and a CK1-Class Protein Kinase in Beta vulgaris and Two Other Eudicots

David Kuykendall, Jonathan Shao, and Tammy Murphy
Molecular Plant Pathology Laboratory, Agricultural Research Service, United States Department of Agriculture, 10300 Baltimore Avenue, Building 004, Room 120, Beltsville, MD 20705, USA

... The sequence contig was screened for coding sequence using a combination of the following programs: GeneMark [18, 19] for eukaryotes (http://exon.gatech.edu/GeneMark/eukhmm.cgi), GenScan (http://genes.mit.edu/GENSCAN.html), FGENESH (http:// softberry.com/), and GRAIL ...


BMC Genomics
2008, 9:563 doi:10.1186/1471-2164-9-563

The UDP-glucosyltransferase multigene family in Bombyx mori

Huang et al.,
The Key Sericultural Laboratory of Agricultural Ministry, Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400715, China

... query sequence and its flanking regions were extracted, and put into Softberry database for predicting new genes by using FGENESH taking the available insect...


CURRENT SCIENCE
VOL. 95, NO. 8, 25 OCTOBER 2008

Identification of candidate gene-based markers (SNPs and SSRs) in the zinc and iron transporter sequences of maize (Zea mays L.)

Arti Sharma and R. S. Chauhan
Advanced Centre of Hill Bioresources and Biotechnology, CSK HP Agricultural University, Palampur 176 062, India Department of Biotechnology and Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan 173 215, India

... for open reading frames (ORFs), including the promoter regions and the 3?UTRs using gene prediction algorithms of FGenesH (http:// sun1.softberry.com/berry ...


Yeast
Sequencing Report 2008 Volume 25 Issue 9, Pages 673 - 679

The gap-filling sequence on the left arm of chromosome 2 in fission yeast Schizosaccharomyces pombe

Sasaki et al.,
ASPEX Division, Research Centre, Asahi Glass Co., Ltd., Japan

... Corporation). ORFs, introns and exons were predicted using FGENESH (http://www.softberry.com/) (Sala- mov et al., 2000) on an Sz. ...


Insect Biochemistry and Molecular Biology
Volume 38, Issue 12, December 2008, Pages 1111-1120

A genomewide survey of homeobox genes and identification of novel structure of the Hox cluster in the silkworm, Bombyx mori

Chai et al.,
The Key Sericultural Laboratory of Agricultural Ministry, College of Biotechnology, Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China

... The intergenic sequences where the lost homeobox genes were found were further put into the Softberry database for predicting new genes by using the FGENESH ...


International Journal of Integrative Biology
2008 Volume 2 N.3 pp.153-156

Sprome: A database on promoters of abiotic stress inducible genes in rice

R Sundheep, L Arul, P Nagarajan, P Balasubramanian

...FGENESH, a gene prediction tool based on Hidden Markov Model (HMM) was used to predict the presence of plausible Exon/UTR in the putative promoter region (http://www.softberry.com/berry ...


Trends in Biochemical Sciences
Volume 33, Issue 12, December 2008, Pages 577-582

Eukaryote polyphosphate kinases: is the 'Kornberg' complex ubiquitous?

Paul Hooley, Michael P. Whitehead and Michael R.W. Brown
School of Applied Sciences, Wulfruna Street, University of Wolverhampton, Wolverhampton, WV1 1SB, UK

... Genome projects perform automatic annotations using gene-finding programs such as FGENESH (Softberry) or Artemis (Sanger Centre), with somewhat arbitrary cut ...


Heredity
12 Nov 2008, doi: 10.1038/hdy.2008.119

Evolutionary fate of rhizome-specific genes in a non-rhizomatous Sorghum genotype

C S Jang, T L Kamps, H Tang, J E Bowers, C Lemke, A H Paterson
1. 1Plant Genome Mapping Laboratory, University of Georgia, Athens, GA, USA 2. 2Plant Genomics Lab, Department of Applied Plant Sciences Technology, Kangwon National University, Chuncheon, Korea

... Alternatively, gene structures were predicted by FGENESH gene prediction software (http://sun1.softberry.com/berry.phtml) with the training set for monocot plants. Orthologs of Oryza sativa corresponding to...


Theor Appl Genet
DOI 10.1007/s00122-008-0888-y

Fine genetic mapping of xa24, a recessive gene for resistance against Xanthomonas oryzae pv. oryzae in rice

Xiaoming Wu, Xianghua Li, Caiguo Xu and Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... Gene prediction analysis was performed with the programs GENSCAN (http://genes.mit. edu/GENSCAN.html), FGE- NESH (http://www.softberry.com/berry.phtml) and Gene ...


Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 71-79 doi:10.1016/j.gene.2008.07.027

SRWD: A novel WD40 protein subfamily regulated by salt stress in rice (Oryzasativa L.)

Ji Huang et al.
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China

... Using corresponding genomic sequence, the opening read frame (ORF) was predicted by Fgenesh program at Softberry server (http://www.softberry.com) and this ...


Molecular Plant
2008 1(5):830-838; doi:10.1093/mp/ssn045

Fine Mapping of Spr3, a Locus for Spreading Panicle from African Cultivated Rice (Oryza glaberrima Steud.)

Ji-Jing Luo, Wei Hao, Jian Jin, Ji-Ping Gao and Hong-Xuan Lin
National Key Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, The Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China

... The counterpart DNA sequences of the interval defined by the markers L4359 and L4264 of Nipponbare were predicted with FGENESH of Softberry (www.softberry.com ...


Genome
Volume 51, Number 6, 1 June 2008 , pp. 452-464(13)

Comparative genomic analysis of the whale (Pseudorca crassidens) PRNP locus

Kim, Dae-Won et al.

... Ab initio gene pre- diction was performed on the genomic sequences using FGENESH (SoftBerry, Inc., Mount Kisco, New York; http:// www.softberry.ru/berry.phtml ...


Fungal Genetics and Biology
Volume 45, Issue 11, November 2008, Pages 1487-1496 doi:10.1016/j.fgb.2008.08.009

Characterization of the atromentin biosynthesis genes and enzymes in the homobasidiomycete Tapinella panuoides

Patrick Schneider, Sarah Bouhired and Dirk Hoffmeister
Pharmaceutical Biology and Biotechnology, Albert-Ludwigs-Universitat, Stefan-Meier-Strasse 19, 79104 Freiburg, Germany

... The Aspergillus or Phanerochaete search algorithms of FGENESH (Softberry, Mount Kisco, NY) were used to predict gene structures and exon/intron junctions. 2.5. ...


Molecular Phylogenetics and Evolution
Volume 49, Issue 1, October 2008, Pages 349-355 doi:10.1016/j.ympev.2008.04.025

Molecular evolution and diversification of plant cysteine proteinase inhibitors: New insights after the poplar genome

M. Margis-Pinheiro et al.
a Programa de Pos-graduacao em Genetica e Biologia Molecular, Departamento de Genetica, Universidade Federal do Rio Grande do Sul, Brazil
b Programa de Pos-graduacao em Biologia Celular e Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Brazil
c Departamento de Bioquimica, Instituto de Ciencias Basicas da Saude, Universidade Federal do Rio Grande do Sul, Brazil

... Genomic sequences from Arabidopsis thaliana and Oryza sativa were also analyzed in the FGENESH gene structure prediction program (http://www.softberry.com/). ...


J. Biol. Chem.
Vol. 283, Issue 40, 26859-26868, October 3, 2008 doi:10.1074/jbc.M804979200

Ergot Alkaloid Biosynthesis in Aspergillus fumigatus:
OVERPRODUCTION AND BIOCHEMICAL CHARACTERIZATION OF A 4-DIMETHYLALLYLTRYPTOPHAN N-METHYLTRANSFERASE


Ole Rigbers and Shu-Ming Li
From the Heinrich-Heine-Universitat Dusseldorf, Institut fur Pharmazeutische Biologie und Biotechnologie, Universitatsstrasse 1, D-40225 Dusseldorf, Germany and the Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie, Deutschhausstrasse 17A, D-35037 Marburg, Germany

... Computer-assisted Sequence Analysis-FGENESH (Softberry, Inc.) and the DNASIS software package (version 2.1; Hitachi Software Engineering, San Bruno, CA) were ...


Gene
Volume 418, Issues 1-2, 15 July 2008, Pages 41-48 doi:10.1016/j.gene.2008.04.005

Is crab duplex-specific nuclease a member of the Serratia family of non-specific nucleases?

V. E. Anisimova et al.
a Shemiakin and Ovchinnikov Institute of Bioorganic Chemistry RAS, Miklukho-Maklaya 16/10, 117871 Moscow, Russia b Evrogen JSC, Miklukho-Maklaya 16/10, 117871 Moscow, Russia

... The putative N- and/or C-terminal terminal ends were searched in the genomic regions using FGENESH software (http://sun1.softberry.com). ...


Int J Plant Genomics
2008: 348621. Published online 2008 June 18. doi: 10.1155/2008/348621.

Development in Rice Genome Research Based on Accurate Genome Sequence

Takashi Matsumoto, Jianzhong Wu, Baltazar A. Antonio, and Takuji Sasaki
Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, 2-1-2, Kannondai, Tsukuba, Ibaraki 3058602, Japan

... It retrieves rice sequences from GenBank and analyzes them with gene prediction programs such as Genscan [31] and FgeneSH (http://www.softberry.com/berry.phtml ...


Molecular Genetics and Genomics
Volume 279, Number 5 / May 2008 pp. 473-480

Construction of a fosmid library of cucumber ( Cucumis sativus ) and comparative analyses of the eIF4E and eIF(iso)4E regions from cucumber and melon ( Cucumis melo )

J. D. F. Meyer, W. Deleu3, J. Garcia-Mas and M. J. Havey
(1) Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA
(2) Vegetable Crops Unit, Agricultural Research Service, US Department of Agriculture, Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA
(3) IRTA, Centre de Recerca en Agrigenomica CSIC-IRTA-UAB, Carretera de Cabrils Km 2, 08348 Cabrils (Barcelona), Spain

... 1997; http://www.ncbi.nlm.nih.gov/ BLAST/), GENESCAN (Burge and Karlin 1997; http:// www.genes.mit.edu/GENSCAN.html), and FGENESH (http://www.softberry.com). ...


Molecular Breeding
Volume 22, Number 4 / November 2008 pp. 593-602

Cloning and sequence diversity analysis of GmHs1 pro-1 in Chinese domesticated and wild soybeans

Cuiping Yuan et al.
(1) Institute of Crop Sciences, Chinese Academy of Agricultural Sciences/Crop Germplasm & Biotechnology, Ministry of Agriculture, Beijing, 100081, China
(2) Institute of Crop Germplasm Resources, Shanxi Academy of Agricultural Sciences, Taiyuan, 030031, China

... ORF and amino acid sequence were predicted with FGENESH 2.5 software (http://www. softberry.com) and used as a basis to estimate sequence diversity at ...


Genetics.
Published Articles Ahead of Print: September 9, 2008, doi:10.1534/genetics.108.092304

Dynamics and differential proliferation of transposable elements during the evolution of the B and A genomes of wheat

Mathieu Charles et al.
1 URGV (INRA-CNRS-UEVE), 2 CEA Genoscope, 3 Murdoch University, 4 INRA

... Six genes (of known or unknown function) and two putative genes were identified using the FGENESH prediction software (http://www.softberry. com) and by identification of homologs in rice (Figure ...


Gene
Volume 420, Issue 2, 1 September 2008, Pages 135-144 doi:10.1016/j.gene.2008.05.019

Expression analysis of rice A20/AN1-type zinc finger genes and characterization of ZFP177 that contributes to temperature stress tolerance

Ji Huang et al.
State key laboratory of crop genetics and germplasm enhancement, Nanjing Agricultural University, Nanjing 210095, China

... By database searching and FgeneSH prediction (http://www.softberry.com), it was found 12 putative proteins containing both A20 and AN1 zinc finger motifs in ...


Molecular Breeding
Volume 22, Number 4 / November 2008 pp. 603-612

Gene identification and allele-specific marker development for two allelic low phytic acid mutations in rice ( Oryza sativa L.)

Zhao et al.
(1) IAEA-Zhejiang University Collaborating Center, National Key Laboratory of Rice Biology and Key Laboratory of Chinese Ministry of Agriculture for Nuclear-Agricultural Sciences, Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, 310029, China
(2) Institute of Crop Science and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
(3) Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Wagramer Strasse 5, P.O. Box 100, 1400 Vienna, Austria

... et al. 2004). Gene prediction was made using the FGENESH program available on http://www.softberry.com/berry.phtml. PCR primers ...


Crop Sci
48:S-49-S-68 (2008)

Structural Features of the Endogenous CHS Silencing and Target Loci in the Soybean Genome

Jigyasa H. Tuteja and Lila O. Vodkin
Dep. of Crop Sciences, 384 ERML, 1201 W. Gregory Dr., Univ. of Illinois, Urbana, IL 61801.

... For ab initio predictions, FGeneSH with the Medicago truncatula-based training set (http://www.softberry.com; verified 9 Jan. 2008) was run. ...


Gene
Volume 411, Issues 1-2, 31 March 2008, Pages 27-37

Multiple tandem gene duplications in a neutral lipase gene cluster in Drosophila

Irene Horne and Victoria S. Haritos
CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia

... Genomic regions containing significant sequence similarity in multiple regions were then examined for genes using FGENESH on Softberry (http://www.softberry.com ...


J. Virol.
July 2008, p. 6697-6710, Vol. 82, No. 13 doi:10.1128/JVI.00212-08

A single Banana streak virus integration event in the banana genome as the origin of infectious endogenous pararetrovirus (EPRV)

Philippe Gayral et al.,
CIRAD BIOS, UMR Biologie et Ge'ne'tique des Interactions Plante-Parasite (BGPI), TA 4-54/K Campus international de Baillarguet, F-34398 Montpellier Cedex 5, France;

... genes (FgenesH for monocot plants (44), softberry software (http://www.softberry. com) and 184 ACCEPTED at Google Indexer on May 20, 2008 jvi.asm.org ...


Int. J. Mol. Sci.
2008, 9, 1717-1729; DOI: 10.3390/ijms9091717

Are the Genes nadA and norB Involved in Formation of Aflatoxin G1

Kenneth C. Ehrlich, Leslie L. Scharfenstein Jr., Beverly G. Montalbano and Perng-Kuang Chang
Southern Regional Research Center, 1100 Robert E. Lee Blvd, P.O. Box 19687, New Orleans, LA 70179, USA

... a coding sequence with a single intron are predicted for nadA in A. parasiticus SU-1 and BN008 isolates based on an analysis using the Softberry FGENESH coding ...


New Phytologist
Volume 179 Issue 1 Page 196-208, July 2008

Magnaporthe grisea avirulence gene ACE1 belongs to an infection-specific gene cluster involved in secondary metabolism

Jerome Collemare et al.,
UMR5240 CNRS/UCB/INSA/BAYER CropScience, 14-20 Rue Pierre Baizet, 69263 Lyon cedex 09, France

... FgenesH (http://www.softberry.com) was used to identify introns using Schizosaccharomyces pombe and Neurospora crassa matrices. ...


Chembiochem
Volume 9 Issue 7, Pages 1019 - 1023, 2008

Synthetic Strategy of Nonreducing Iterative Polyketide Synthases and the Origin of the "Classical Starter-Unit Effect"

Jason M. Crawford, Dr., Anna L. Vagstad, Karen P. Whitworth, Kenneth C. Ehrlich, Dr., Craig A. Townsend, Dr.
1Department of Chemistry, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218, USA, Fax: (+1) 410-516-8420 2Southern Regional Research Center, United States Department of Agriculture, 1100 RE Lee Boulevard, New Orleans, LA 70124, USA

... by using the revised sequence re- sulted in an alternative splicing pattern that translated through the GXCXG motif (FGENESH, http://www.softberry.com, Sup ...


Trends in Plant Science
doi:10.1016/j.tplants.2008.02.009

Diamonds in the rough: mRNA-like non-coding RNAs

Linda A. Rymarquis, James P. Kastenmayer, Alexander G. Huttenhofer and Pamela J. Green
Delaware Biotechnology Institute, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA 213501 Hamlet Square Court, Germantown, MD 20874, USA 3Innsbruck Biocentre, Division of Genomics and RNomics, Innsbruck Medical University, Fritz-Pregl Stra?e 3, 6020 Innsbruck, Austria

... The remaining RNAs are screened for ORFs, using programs such as GeneMark [25], GenScan [26], Fgenesh (www.softberry.com) or EST scan [27]. ...


Mycological Research
Volume 112, Issue 2, February 2008, Pages 216-224

Processing sites involved in intron splicing of Armillaria natural product genes

Mathias Misieka and Dirk Hoffmeister
Pharmaceutical Biology and Biotechnology, Albert-Ludwigs-Universitat, Stefan-Meier-Strasse 19, 79104 Freiburg, Germany

... For exon/intron identification we used the Aspergillus and Phanerochaete mode implemented in FGENESH (Softberry, Mount Kisco, NY) and Augustus (Stanke & ...


Current Bioinformatics
Volume 3, Number 2, May 2008 , pp. 87-97(11)

Genome Annotation in Plants and Fungi: EuGene as a Model Platform

Foissac, Sylvain et al.,

... Simultaneously, a specific version of FGenesH was built for M. truncatula by the SoftBerry company (http://www.- softberry.com/). ...


Mol Biol Evol.
25(5):892-902; doi:10.1093/molbev/msn029

Comparative analysis of the MIR319a microRNA locus in Arabidopsis and related Brassicaceae

Norman Warthmann, Sandip Das, Christa Lanz and Detlef Weigel
Department of Molecular Biology, Genome Center, Max Planck Institute for Developmental Biology, D-72076 Tubingen, Germany

... 2005) and FGENESH (www.softberry.com) were used to predict putative novel ORFs, and validated using TBLASTN against the NCBI nr database. 6 Page 7. ...


FEMS Yeast Research
Volume 8 Issue 3 Page 432-441, May 2008

The endogenous adrenodoxin reductase-like flavoprotein arh1 supports heterologous cytochrome P450-dependent substrate conversions in Schizosaccharomyces pombe

Kerstin M. Ewen, Burkhard Schiffler, Heike Uhlmann-Schiffler, Rita Bernhardt, Frank Hannemann
Department of Biochemistry, Saarland University, Saarbrucken, Germany; and Department of Medical Biochemistry, Saarland University, Homburg, Germany

... The program fgenesh (http://www.softberry.com) was applied to identify the position and composition of the arh1 gene as well as to deduce the amino acid ...


Eukaryotic Cell
February 2008, p. 368-378, Vol. 7, No. 2

A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes

A. Gioti et al.,
UMR1290 BIOGER-CPP, INRA, Route de St-Cyr, 78026 Versailles, France

... were improved manually for seven genes, one of which was not predicted by automatic software Blastx alignment data; FGenesh (http://www.softberry.com) and ...


DNA Research
2008 15(2):93-102; doi:10.1093/dnares/dsn001

Sequence Level Analysis of Recently Duplicated Regions in Soybean [Glycine max (L.) Merr.] Genome

Kyujung Van et al.,
Department of Plant Science, Seoul National University, San 56-1, Sillim-dong, Gwanak-gu, Seoul 151-921, South Korea

... Also, gene annotation was conducted with the web-based gene prediction programs FGENESH (http://sun1.softberry.com/berry.phtml) and GeneMark (http://exon.gatech ...


Insect Biochemistry and Molecular Biology
Volume 38, Issue 3, March 2008, Pages 331-345

Annotation and expression profiling of apoptosis-related genes in the yellow fever mosquito, Aedes aegypti

Bart Bryanta, Carol D. Blairb, Ken E. Olsonb and Rollie J. Clem
Molecular, Cellular, and Developmental Biology Program, Arthropod Genomics Center, Division of Biology, Ackert Hall, Kansas State University, Manhattan, KS, USA bArthropod-Borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO, USA

... Genscan (http://genes.mit.edu/GENSCAN.html) and fgenesh (http://www.SoftBerry.com) were used to predict genes and complete missing regions of some EST contigs. ...


Plant Physiology
146:940-951 (2008)

Characterization of the Monoterpene Synthase Gene tps26, the Ortholog of a Gene Induced by Insect Herbivory in Maize

Changfa Lin et al.,
Waksman Institute, Rutgers University, Piscataway, New Jersey 08855 (C.L., B.S., Z.X., H.K.D.); Department of Plant Biology, Rutgers University, New Brunswick, New Jersey 08901 (B.S., Z.X., H.K.D.);

... Analysis of the sequence by the gene-finding program Fgenesh (www.softberry.com) predicted that, like stc1, tps26 consisted of seven exons. ...


Disease Markers
Volume 24, Number 2 / 2008 Pages 111-117

Analysis of Crohn's disease-related CARD15 polymorphisms in Spanish patients with idiopathic uveitis

N. Rodriguez-Perez, A. Aguinaga-Barrilero, Marina B. Gorrono-Echebarria, Mercedes Perez-Blas, J.M. Marti'n-Villa
Inmunologia, Facultad de Medicina, Universidad Complutense de Madrid, Madrid, Spain Servicio de Oftalmologia, Hospital Universitario Principe de Asturias, Alcala de Henares, Madrid, Spain

... Analysis carried out with GEN- SCAN (http://genes.mit.edu/GENSCAN.html), FCGENESH (http://www.softberry.com/berry.phtml) and GRAIL (http://grail.lsd.ornl.gov ...


Crop Sci
48:S-49-S-68 (2008)

Structural Features of the Endogenous CHS Silencing and Target Loci in the Soybean Genome

Jigyasa H. Tuteja and Lila O. Vodkin
Dep. of Crop Sciences, 384 ERML, 1201 W. Gregory Dr., Univ. of Illinois, Urbana, IL 61801.

... For ab initio predictions, FGeneSH with the Medicago truncatula-based training set (http://www.softberry.com; verified 9 Jan. 2008) was run. ...


Journal of Integrative Plant Biology
Volume 50 Issue 4 Page 466-474, April 2008

Cell-wall Invertases from Rice are Differentially Expressed in Caryopsis during the Grain Filling Stage

Yong-Qin Wang et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences, Beijing 100101, China; Graduate School of the Chinese Academy of Sciences, Beijing 100049, China

... Splice site prediction was carried out with programs GENSCAN (http://genes.mit.edu/ GENSCAN.html) and FGENESH (http://www.softberry.com/berry.phtml). ...


Journal of Integrative Plant Biology
Volume 50 Issue 1 Page 62-75, January 2008

Cloning and Expression Analysis of Rice Sucrose Transporter Genes OsSUT2M and OsSUT5Z

Ai-Jun Sun et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences, Beijing 100101, China; 2Graduate School of the Chinese Academy of Sciences, Beijing 100049, China

... The ORF of these two potential sucrose transporters were figured out by FGENESH (http://www.softberry.com/), and primers used for RT-PCRs were designed by ...


Molecular Plant
2008 1(3):471-481; doi:10.1093/mp/ssn014

Mutation of a Gene in the Fungus Leptosphaeria maculans Allows Increased Frequency of Penetration of Stomatal Apertures of Arabidopsis thaliana

Candace E. Elliott, Harjono, and Barbara J. Howlett
School of Botany, The University of Melbourne, Melbourne, Vic 3010, Australia Current address: Laboratory of Forest Protection, Faculty of Forestry, Gadjah Mada University, Yogyakarta, Indonesia 55281

... using a primer walking strategy. Genes on the cosmid were predicted using FGENESH software (www.softberry.com). A BLASTp search (www ...


Plant Physiology
146:200-212 (2008)

Recurrent Deletions of Puroindoline Genes at the Grain Hardness Locus in Four Independent Lineages of Polyploid Wheat

Wanlong Li, Li Huang and Bikram S. Gill
Wheat Genetic and Genomic Resources Center, Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506–5502

... Protein-coding genes were predicted using the program FGENESH (http://sun1.softberry. com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) with the ...


Genomics
Volume 91, Issue 5, May 2008, Pages 467-475

Improved detection and annotation of transposable elements in sequenced genomes using multiple reference sequence sets

Nicolas Buisinea 1, Hadi Quesneville, 2 and Vincent Colot
Unite' de Recherche en Ge'nomique Ve'ge'tale, INRA UMR1165–CNRS UMR8114–Universite' d'Evry Val d'Essonne, 2 rue Gaston Cre'mieux, 91057 Evry, France Laboratoire Bioinformatique et Ge'nomique, Institut Jacques Monod, Tour 42, 2 place Jussieu, 75251 Paris, France

... The functional content of each RU sequence was predicted using FGENESH (http://sun1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind ...


Nucleic Acids Research,
2008, Vol. 36, Database issue D298-D302

ChromDB: The Chromatin Database

Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA

... In many cases, we have derived our own transcript models from genomic sequences using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...


Nature Biotechnology
26, 553 - 560 (2008)

Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)

Diego Martinez et al.,
Los Alamos National Laboratory/Joint Genome Institute, PO Box 1663, Los Alamos, New Mexico 87545, USA. Novozymes, Inc., 1445 Drew Ave., Davis, California 95618, USA.

... an ab initio gene predictor, Fgenesh 37 , specifically trained for this genome, and two homology-based gene predictors, Fgenesh+ (http://www.softberry.com) and ...


FGENESH 2007

Genome Res.
17:1389-1398, 2007

Conrad: Gene prediction using conditional random fields

David DeCaprio et al.,
The Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, USA

... data. Conrad was trained on the entire reference set and Fgenesh was trained by Softberry (Salamov and Solovyev 2000 Go). Results. ...


PNAS
July 10, 2007 | vol. 104 | no. 28 | 11844-11849

A GeneTrek analysis of the maize genome

Renyi Liu et al.,
Department of Genetics, University of Georgia, Athens, GA 30602; and Department of Agronomy, Iowa State University, Ames, IA 5001

... BAC sequences were first subject to ab initio gene prediction with FGENESH (www.softberry.com) using the matrix for monocot plants. ...


Antonie van Leeuwenhoek
Volume 91, Number 4 / May, 2007 pp. 373-391

Tagging target genes of the MAT1-2-1 transcription factor in Fusarium verticillioides ( Gibberella fujikuroi MP-A)

Anita Keszthelyi et al.,
Agricultural Biotechnology Center, Szent-Gyorgyi A. u. 4, H-2100 Godollo, Hungary

.. Sequence data were analyzed with the Lasergene (DNAStar Inc., Madison, Wisconsin, USA) software package and the FGENESH program (www.softberry.com). ...


Genome
Volume 50, Number 6, 1 June 2007 , pp. 595-609(15)

Diversity of the trifunctional histidine biosynthesis gene (his) in cereal Phaeosphaeria species

Wang, Chih-Li et al.,

... acc. No. DQ312266) using the FGENESH program (http://www.softberry.com) with As- pergillus as the organism parameter (Fig. 1). The ...


Current Genetics
Volume 52, Number 1 / July, 2007 pp. 11-22

Mating-type loci of heterothallic Diaporthe spp.: homologous genes are present in opposite mating-types

Satoko Kanematsu. Yoshihiko Adachi and Tsutae Ito
Apple Research Station, National Institute of Fruit Tree Science, NARO, Shimokuriyagawa, Morioka 020-0123, Japan , National Agricultural Research Center for Tohoku Region, NARO, Akahira, Morioka 020-0198, Japan

... Genes, introns, exons and transcription initiation sites of Diaporthe W- and G-types were predicted by analysis with FGENESH (http://www.softberry.com) on N ...


Plant Molecular Biology
Volume 65, Numbers 1-2 / September, 2007 pp. 189-203

Rapid evolution and complex structural organization in genomic regions harboring multiple prolamin genes in the polyploid wheat genome

Shuangcheng Gao et al.,
Key Laboratory of Crop Germplasm & Biotechnology, MOA, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, National Key Facility for Crop Gene Resources and Genetic Improvement, No. 12 South Street, Zhongguancun, Beijing, 100081, P.R. China

... FGENESH (http://www.softberry.com/ nucleo.html) and GENESCAN (http://genemark. mit.edu/ GENESCAN.htm) were used for gene prediction. ...


Plant Molecular Biology
Volume 65, Number 4 / November, 2007 pp. 439-451

Molecular cloning and expression analysis of a monosaccharide transporter gene OsMST4 from rice ( Oryza sativa L.)

Yongqin Wang et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Beijing, 100101, China

... Splice site prediction was per- formed with programs GENSCAN (http://www.genes.mit. edu/GENSCAN.html) and FGENESH (http://www. softberry.com/berry.phtml). ...


Plant Physiology
145:29-40 (2007)

Chlorophyll-Deficient Rice Mutant with Impaired Chlorophyllide Esterification in Chlorophyll Biosynthesis

Ziming Wu et al.,
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing 210095, China (Z.W., B.H., L.J., C.W., J.W.);

... 2, B and C). Within this region, two open reading frames (ORFs) were predicted using the program FGENESH 2.2 (www.softberry.com). ...


TAG Theoretical and Applied Genetics
Volume 115, Number 2 / July, 2007 pp. 159-168

Physical mapping and identification of a candidate for the leaf rust resistance gene Lr1 of wheat

Ji-Wen Qiu et al.,
State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 100101, China

... tauschii lines were translated into protein sequences using the online gene prediction program Fgenesh (http://sunl.Softberry.com/cgi-bin/programs/gWnd/ Fgenesh ...


Fungal Genetics and Biology
Volume 44, Issue 10, October 2007, Pages 1002-1010

Comparison of loline alkaloid gene clusters across fungal endophytes: Predicting the co-regulatory sequence motifs and the evolutionary history

Brandi L. Kutil et al.,
Department of Plant Pathology and Microbiology, Texas A&M University (2132), College Station, TX 77843-2132, USA

.. of coding sequences based on previously identified cDNAs ([Spiering et al., 2002] and [Spiering et al., 2005]) and FGENESH (http://www.softberry.com/berry.phtml ...


Peptides
Volume 28, Issue 6, June 2007, Pages 1282-1291

Neuropeptide precursors in Tribolium castaneum

Andinet Amare and Jonathan V. Sweedler
Department of Chemistry and The Institute of Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, United States

... The FGENESH version 2.5 (www.softberry.com) and Augustus version 1.8.2 (http://augustus.gobics.de/submission) gene prediction programs were used to predict ...


Mol. BioSyst.,
2007, 3, 794 - 802, DOI: 10.1039/b705803a

Distinctive expression and functional regulation of the maize (Zea mays L.) TOR kinase ortholog

Lourdes Teresa Agredano-Moreno, Homero Reyes de la Cruz, Leon Patricio Martinez-Castilla and Estela Sanchez de Jimenez

... OsTOR was obtained with the Gene Builder system (http://www.itba.mi.cnr.it/webgene) and confirmed with the FGENESH 2.4 program from the Softberry webpage (http ...


Plant Physiology and Biochemistry
Volume 45, Issue 1, January 2007, Pages 6-14

Computational identification and phylogenetic analysis of the MAPK gene family in Oryza sativa

Qingpo Liu and Qingzhong Xue
Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, No 268, Kaixuan Road, Hangzhou, Zhejiang 310029, China

... Redundant hits were removed by manual inspection. Gene structure prediction was performed using the online web server FGENESH (http://www.softberry.com). 2.2. ...


Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429

Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum

Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands

... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev, 2000) programs from the MOLQUEST software package (Softberry Inc. ...


Nucleic Acids Research
(2007), doi:10.1093/nar/gkm768

ChromDB: The Chromatin Database

Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA

... In many cases, we have derived our own transcript models from genomic sequences using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...


Microbiology
153 (2007), 3409-3416;

A 7-dimethylallyltryptophan synthase from Aspergillus fumigatus: overproduction, purification and biochemical characterization

Anika Kremer, Lucia Westrich and Shu-Ming Li
Heinrich-Heine-Universitat Dusseldorf, Institut fur Pharmazeutische Biologie und Biotechnologie, Universitatsstrasse 1, D-40225 Dusseldorf, Germany, Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, D-72076 Tubingen, Germany

... FGENESH (Softberry; www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used for intron prediction ...


General and Comparative Endocrinology
Volume 153, Issues 1-3, August-September 2007, Pages 59-63

Evolutionary conservation of bursicon in the animal kingdom

Tom Van Loy et al.,
Animal Physiology and Neurobiology, Laboratory for Developmental Physiology, Genomics and Proteomics, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000, Belgium

... ncbi.nih.gov/gorf) and, in addition, were conducted to the gene prediction program FGENESH based on hidden markov models, available on http://www.softberry.com ...


Fungal Genetics and Biology
Volume 44, Issue 2, February 2007, Pages 77-87

Extracellular oxidative systems of the lignin-degrading Basidiomycete Phanerochaete chrysosporium

Phil Kersten and Dan Cullen
Forest Products Laboratory, USDA, One Gifford Pinchot Drive, Madison, WI 53705, USA

... Predictions were based on ab initio methods Fgenesh (Salamov and Solovyev, 2000), homology-based methods, Fgenesh+ (www.softberry.com) and Genewise (Birney and ...


Molecular Plant Pathology
Volume 8 Issue 1 Page 111-120, January 2007

Isolation and characterization of the mating type locus of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana

LAURA CONDE-FERRAEZ et al.,
Centro de Investigacion Cientifica de Yucatan (CICY), Calle 43 no. 130, Chuburna de Hidalgo, C.P. 97200, Merida, Yucatan, Mexico

... Identification of open reading frames (ORFs) and gene predictions were performed using FGENESH and FGENESH+ software (SoftberryTM, http:/ / www.softberry.com ...


Chinese Science Bulletin
Volume 52, Number 7 / April, 2007 pp. 903-911

Genetic and physical mapping of AvrPi7 , a novel avirulence gene of Magnaporthe oryzae using physical position-ready markers

Feng ShuJie, Wang Ling, Ma JunHong, Lin Fei and Pan QingHua
Laboratory of Plant Resistance and Genetics, College of Natural Resources and Environmental Science, South China Agricultural University, Guangzhou, 510642, China
Laboratory of Plant Protection, College of Horticulture, South China Agricultural University, Guangzhou, 510642, China

... for fine mapping of the Avr gene locus based on the se- quence of the candidate genes predicted using the gene annotation system Softberry FGENESH (http://www. ...


Plant Molecular Biology
Volume 64, Number 5 / July, 2007 589-600

New insights into Oryza genome evolution: high gene colinearity and differential retrotransposon amplification

Shibo Zhang et al.,
(1) Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720, USA

... BLASTN, BLASTX, and TBLASTX against TIGR’s Rice Gene Indices database and NCBI’s nonredundant and dbEST databases; FGENESH (http:// www.softberry.com/nucleo ...


DNA AND CELL BIOLOGY
Volume 26, Number 6, 2007 Pp. 369-385

Genomics, Evolution, and Expression of TBPL2, a Member of the TBP Family

CINZIA DI PIETRO et al.,
Dipartimento di Scienze Biomediche-Unita` di Biologia Genetica e BioInformatica, Universita` di Catania, Catania, Italy, EU.

Genomic sequences were analyzed using several gene prediction tools (GPTs): Genescan (http://genes.mit.edu/GENSCAN.html), GeneMark (http://opal.biology.gatech.edu/GeneMark/index .html), FGENESH (http://www.softberry.com/berry.phtml?topic =gfind&prg=FGENESH),


Chinese Science Bulletin
Volume 52, Number 7 / April, 2007 912-921

Rapid genome evolution in Pms1 region of rice revealed by comparative sequence analysis

Yu JinSheng et al.,
National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan, 430070, China

... For gene prediction, the sequences were ana- lyzed with several gene prediction programs including FGENESH (monocot training set, http://www.softberry. ...


Journal of Integrative Plant Biology
Volume 49 Issue 5 Page 655-663, May 2007

The 6-phosphogluconate Dehydrogenase Genes Are Responsive to Abiotic Stresses in Rice

Fu-Yun Hou, Ji Huang, Shan-Lin Yu and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China

... One assembled cDNA sequence containing a complete ORF (opening reading frame) of 1 524 bp was obtained using the FGENESH program (http://www.softberry.com) and ...


Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007

Molecular and cytological responses of Medicago truncatula to Erysiphe pisi

DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA

... BAC sequences with > 98% identity were collected, corresponding coding regions were predicted using FGENESH software (http://www.softberry.com), and the 1.5-kb ...


Plant Science
Volume 172, Issue 4, April 2007, Pages 708-721

Genome-wide analysis and identification of genes related to potassium transporter families in rice (Oryza sativa L.)

R. Naga Amruthaa, P. Nataraj Sekhara, Rajeev K. Varshneyb and P.B. Kavi Kishora,
aDepartment of Genetics, Osmania University, Hyderabad 500007, India
bInternational Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru 502325, India

... and Karlin, 1997; http:// genes.mit.edu/GENSCAN.html), GenomeScan [30]; http://genes.mit.edu/ genomescan.html), FGENESH [31]; http://www.softberry.com/berry ...


Molecular Biology and Evolution, 2007, doi:10.1093/molbev/msm116

PIF-like Transposons Are Common in Drosophila and Have Been Repeatedly Domesticated to Generate New Host Genes

Claudio Casola, A. Michelle Lawing, Esther Betran and Cedric Feschotte
Department of Biology University of Texas, Arlington

... The structure of each DPLG coding sequence was initially predicted using FGENESH (http://www.softberry.com/berry.phtml) and refined by multialignment with ...


Journal of Virology,
June 2007, p. 6491-6501, Vol. 81, No. 12

Genomic and Morphological Features of a Banchine Polydnavirus: Comparison with Bracoviruses and Ichnoviruses

Renee Lapointe et al.,
Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du PEPS, Quebec, Quebec G1V 4C7, Canada

... html), the Gene Construction Kit 2 program (Texco Inc.), Genchek v. 2061 (Ocimum Biosolutions), and FGENESH, with the Apis mellifera settings (www.softberry.com ...


The Plant Journal
Volume 49 Issue 2 Page 173-183, January 2007

Characterization of the centromere and peri-centromere retrotransposons in Brassica rapa and their distribution in related Brassica species

Ki-Byung Lim et al.,
1School of Applied Biosciences, College of Agriculture and Life Sciences, Kyungpook National University, Daegu 702-701, Korea,
2Department of Plant Science, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea,

... Gene annotation was achieved using the web-based gene prediction program FGENE-SH Arabidopsis ( http:/ / www.softberry.com/ berry.phtml ). Sequence analysis. ...


Journal of Molecular Evolution
Volume 64, Number 3 / March, 2007 354-363

Molecular Phylogeny, Evolution, and Functional Divergence of the LSD1-Like Gene Family: Inference from the Rice Genome

Qingpo Liu 1 and Qingzhong Xue 1
(1) Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, 310029, P. R. China

... The FGENESH software (http://www.softberry.com) was used to predict the intron/exon structure of putative rice LSD1-like genes. ...


BMC Microbiology
2007, 7:61 doi:10.1186/1471-2180-7-61

Structure and evolution of a proviral locus of Glyptapanteles indiensis bracovirus

Christopher A Desjardins et al.,
The Institute for Genomic Research, a division of J. Craig Venter Institute, Rockville, Maryland, USA

...A combination of Softberry's FGENESH trained on the honey bee (Apis mellifera) and the Beijing Genome Institute's BGF trained on the silkmoth (Bombyx mori) were most accurate ...
...Gene models were generated with a variety of software: Softberry's FGENESH [77] using both the honey bee (Apis mellifera) and fruit fly (Drosophila melanogaster) training sets,...


PNAS
| May 1, 2007 | vol. 104 | no. 18 | 7705-7710

The tiny eukaryote Ostreococcus provides genomic insights into the paradox of plankton speciation

Brian Palenik et al.,
aScripps Institution of Oceanography, University of California at San Diego, La Jolla, CA 92093-0202; cJoint Genome Institute and Stanford Human Genome Center, Stanford University School of Medicine, 975 California Avenue, Palo Alto, CA 94304;

... Gene prediction methods used for annotation of two Ostreococcus genomes included ab initio Fgenesh (40), homology-based Fgenesh+ (SoftBerry), Genewise (41 ...


Nature Biotechnology
25, 319 - 326 (2007) Published online: 4 March 2007 | doi:10.1038/nbt1290

Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis

Thomas W Jeffries et al.,
US Department of Agriculture, Forest Service, Forest Products Laboratory, One Gifford Pinchot Drive, Madison, Wisconsin 53705, USA.
Department of Bacteriology, University of Wisconsin-Madison, 420 Henry Mall, Madison, Wisconsin 53706, USA.

... Gene prediction methods used for analysis of the P. stipitis genome include ab initio Fgenesh 44 , homology-based Fgenesh+ (http://www.softberry.com/) and ...


Functional & Integrative Genomics
Volume 7, Number 1 / January, 2007 17-35

Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes

Nagendra K. Singh et al.,
Rice Genome Laboratory, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India

... Gene prediction was performed on individual BAC/PAC clones using FGENESH trained for monocot species (http://www.softberry.com) (Salamov and Solovyev 2000). ...


Molecular Microbiology
Volume 64 Issue 3 Page 755-770, May 2007

Molecular analysis of the cercosporin biosynthetic gene cluster in Cercospora nicotianae

Huiqin Chen, Miin-Huey Lee, Margret E. Daub, Kuang-Ren Chung
Citrus Research and Education Center, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA.

... positions were deduced from comparisons of genomic and cDNA sequences and/or predicted using the fgenesh gene-finding software at http://www.softberry.com. ...


Plant Physiology
144:623-636 (2007)

Molecular Evolution of Lysin Motif-Type Receptor-Like Kinases in Plants

Xue-Cheng Zhang et al.,
Division of Plant Sciences and National Center for Soybean Biotechnology (X.-C.Z., X.W., S.F., J.W., M.L., H.T.N., G.S.) and Division of Biochemistry, Department of Molecular Microbiology and Immunology (G.S.), University of Missouri, Columbia, Missouri 65211; and United States Department of Agriculture-Agricultural Research Service and Department of Agronomy, Iowa State University, Ames, Iowa 50011 (S.B.C.)

... Center. BAC sequences were annotated using the dicot species model and Arabidopsis matrix of FGENESH (www.softberry.com). Annotated ...


FGENESH 2006

Nature
443, 931 - 949 (26 Oct 2006)

Insights into social insects from the genome of the honeybee Apis mellifera

The Honeybee Genome Sequencing Consortium

...to produce a master gene list: the Official Gene Set (OGS). The component gene sets were from NCBI, Ensembl, Softberry (Fgenesh), an evolutionarily conserved core set and a set based on Drosophila orthologues (Supplementary...


PNAS
| October 24, 2006 | vol. 103 | no. 43 | 15794-15799

Vitamin K-dependent proteins in Ciona intestinalis, a basal chordate lacking a blood coagulation cascade

John D. Kulman*, Jeff E. Harris*, Noriko Nakazawa, Michio Ogasawara, Masanobu Satake, and Earl W. Davie*,
*Department of Biochemistry, University of Washington, Seattle, WA 98195; Department of Biology, Faculty of Science, Chiba University, Chiba 263-8522, Japan; and Institute of Development, Aging, and Cancer, Tohoku University, Sendai 980-8575, Japan

... scaffolds. The resulting sequences were analyzed for probable intron/exon boundaries with FGENESH (Softberry, Mount Kisco, NY). ...


TAG Theoretical and Applied Genetics
Volume 113, Number 6 / October, 2006 1147-1158

The barley serine/threonine kinase gene Rpg1 providing resistance to stem rust belongs to a gene family with five other members encoding kinase domains

R. Brueggeman 1 , T. Drader 2 and A. Kleinhofs 1, 2
(1) Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA
(2) School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4234, USA

... gene struc- tures were predicted by sequence comparison with the Rpg1 cDNA sequence and using the FGENESH gene prediction program (http://www.softberry.com). ...


Annual Review of Phytopathology
Vol. 44: 337-366 (Volume publication date September 2006)

The Dawn of Fungal Pathogen Genomics

Jin-Rong Xu,1 ­ You-Liang Peng,2 ­ Martin B. Dickman,3 and ­ Amir Sharon4­
1Department of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907

... at the Broad Institute, gene structures are predicted using the Calhoun annotation system that is a combination of FGENESH (http://www.softberry.com), FGENESH+ ...


Insect Molecular Biology
Volume 15 Issue 5 Page 597-602, October 2006

Expression of insulin pathway genes during the period of caste determination in the honey bee, Apis mellifera

D. E. Wheeler, N. Buck, J. D. Evans
Department of Entomology, University of Arizona, Tucson AZ USA, USDA ARS, Bee Research Laboratory, Beltsville, MD 20705 USA

... Primers were designed based on cDNA sequences from the official gene list or on the basis of FGENESH ( http:/ / www.softberry.com ) predictions of genomic ...


BMC Genomics.
2006; 7: 321

Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri

Ghazaleh Nematollahi,#1 Arash Kianianmomeni,#1 and Armin Hallmann1
1Department of Cellular and Developmental Biology of Plants, University of Bielefeld, Universitatsstr. 25, D-33615 Bielefeld, Germany

...Exon-intron prediction of Volvox genes was done using FGENESH software (Softberry, Mount Kisco, NY) and by polypeptide sequence comparisons with homologs from other organisms using ...


Developmental Biology
300 (2006) 2-8

Shedding genomic light on Aristotle's lantern

Erica Sodergren et al.,
Human Genome Sequencing Center, Baylor College of Medicine, One Baylor Plaza, Alkek N1519, Houston, TX 77030, USA

...using software developed at Ensembl (Potter et al., 2004; Sea Urchin Genome Sequencing Consortium, 2006) and installed at BCM-HGSC, NCBI (gnomon software; Souvorov et al., 2004), Softberry (FgenesH software; Salamov and Solovyev, 2000; Solovyev, 2001),...


Genetics.
2006 November; 174(3): 1493 - 1504.

Types and Rates of Sequence Evolution at the High-Molecular-Weight Glutenin Locus in Hexaploid Wheat and Its Ancestral Genomes

Yong Qiang Gu et al.,
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California 94710

...FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark.mit.edu/GENESCAN.htm) were used for gene prediction...


DNA Sequence,
Volume 17, Issue 3 June 2006 , pages 223 - 230

Isolation and characterization of the RanGAP gene in the mosquito Aedes aegypti

Sung-Jae Cha a; Neil Lobo b; Becky Debruyn b; David W. Severson b
a Department of Molecular Microbiology and Immunology, Johns Hopkins School of Public Health, Malaria Research Institute. Baltimore, MD. USA
b Department of Biological Sciences, Center for Tropical Disease Research and Training, University of Notre Dame. Notre Dame, IN. USA

... submitted to two gene finding programs: GENSCAN (http://genes.mit.edu/ GENSCAN.html) using the vertebrate database and FGENESH (http://www.softberry.com/berry ...


Molecular Plant Pathology
Volume 7 Issue 6 Page 485-497, November 2006

The global nitrogen regulator, FNR1, regulates fungal nutrition-genes and fitness during Fusarium oxysporum pathogenesis

HEGE HVATTUM DIVON, CARMIT ZIV, OLGA DAVYDOV, ODED YARDEN, ROBERT FLUHR
1Department of Plant Science, Weizmann Institute of Science, 76100 Rehovot, Israel

... The sequence was, in the Softberry gene prediction database ( http:/ / www.softberry.com/ berry.phtml ; FGENESH), predicted to contain an open reading ...


Genetics.
2006 October; 174(2): 1017-1028.

Sequence Conservation of Homeologous Bacterial Artificial Chromosomes and Transcription of Homeologous Genes in Soybean (Glycine max L. Merr.)

Jessica A. Schlueter,* Brian E. Scheffler, Shannon D. Schlueter,* and Randy C. Shoemaker‡1
*Department of Genetics, Developmental and Cellular Biology, Iowa State University, Ames, Iowa 50011, USDA-ARS MSA Genomics Laboratory, Stoneville, Mississippi 38776 and ‡USDA-ARS-CICGR, Ames, Iowa 50011

... Genscan with Arabidopsis thaliana-based parameters (Burge and Karlin 1997), FgeneSH with Medicago truncatula-based parameters (http://www.softberry.com) and ...


Applied and Environmental Microbiology,
October 2006, p. 6527-6532, Vol. 72, No. 10

The Homologue of het-c of Neurospora crassa Lacks Vegetative Compatibility Function in Fusarium proliferatum

Zoltan Kerenyi,1 Brigitta Olah,1,2 Apor Jeney,1 Laszlo Hornok,1,2 and John F. Leslie3*
Agricultural Biotechnology Center, Szent-Gyorgyi A. u. 4., H-2100 Godoll, Hungary,
1 Department of Agricultural Biotechnology and Microbiology, Mycology Group, Hungarian Academy of Sciences, Szent Istvan University, Pater K. u. 1., H-2103 Godoll, Hungary,
2 Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, Kansas 66506-55023

... Sequence data were analyzed with the Lasergene software package (DNAStar Inc., Madison, Wis.) and the FGENESH program (http://www.softberry.com). ...


Genetics
2006 November; 174(3): 1671 - 1683

Genetic Dissection of Intermated Recombinant Inbred Lines Using a New Genetic Map of Maize

Yan Fu et al.,
*Interdepartmental Genetics Graduate Program, Iowa State University, Ames, Iowa 50011, Department of Agronomy, Iowa State University, Ames, Iowa 50011

... 2004) alignments between genomic and EST sequences or predicted using FGENESH (http://www.softberry.com) as described (Yao et al. 2005). ...


ChemBioChem
2006 Volume 7, Issue 1 , Pages 158 - 164

Reverse Prenyltransferase in the Biosynthesis of Fumigaclavine C in Aspergillus fumigatus: Gene Expression, Purification, and Characterization of Fumigaclavine C Synthase FGAPT1

Inge A. Unsold, Shu-Ming Li, Priv. Doz. Dr. *
Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, 72076 Tubingen, Germany,

... FGENESH (Softberry, Inc., www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1: Hitachi Software Engineer- ing, San Bruno, CA) were used ...


Fungal Genetics and Biology
43 (2006) 316-325

Development of a Fusarium graminearum AVymetrix GeneChip for proWling fungal gene expression in vitro and in planta

Ulrich Guldener et al.,
Technische Universität Munchen, Chair of Genome Oriented Bioinformatics, Center of Life and Food Science, D-85350 Freising-Weihenstephan, Germany

... to the automatically pre- dicted set from the Broad Institute, a second automatic gene call set was developed at MIPS using FGENESH (www.softberry.com) with a ...


The Journal of Clinical Endocrinology & Metabolism
2006 Vol. 91, No. 11 4587-4592

Identification of Three Novel Mutations in the GATA3 Gene Responsible for Familial Hypoparathyroidism and Deafness in the Chinese Population

Wei-Yih Chiu, Huan-Wen Chen, Hwei-Wen Chao, Lee-Tzong Yann and Keh-Sung Tsai
Departments of Laboratory Medicine (W.-Y.C., H.-W.Cha, K.-S.T.) and Internal Medicine (W.-Y.C., L.-T.Y, K.-S.T.), National Taiwan University Hospital, Taipei 100, Taiwan; and Department of Internal Medicine (H.-W.Che), Lo-Tung Pohai Hospital, Ilan 256, Taiwan

... is useful. We used the FGENESH program (www.softberry.com) based on the consensus sequence of exon-intron junctions (ag ... gt rule ...


CURRENT SCIENCE
VOL. 91, NO. 4, 25 AUGUST 2006 510-515

Bioinformatics approach toward identification of candidate genes for zinc and iron transporters in maize

R. S. Chauhan
Bioinformatics Centre, Advanced Centre of Hill Bioresources and Biotechnology, CSK HP Agricultural University, Palampur 176 062, India

... using gene prediction algorithms of FGenesH 18 (http://www.softberry.com/ berry.phtml? topic= fgenesh&group=programs&subgroup=gfind ...


Acta Biochimica et Biophysica Sinica
Volume 38, Number 11, November 2006 , pp. 812-820(9)

Sequencing and Analysis of a Genomic Fragment Provide an Insight into the Dunaliella viridis Genomic Sequence

SUN, Xiao-Ming et al.,
Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444, China

... Gene prediction was carried out using GENSCAN (http://genes.mit.edu/GENSCAN. html) and FGENESH (http://www.softberry.com/berry.html). ...


Functional & Integrative Genomics
Volume 6, Number 4 / October, 2006 pp. 338-341

Drought tolerance genes in rice

Huazong Zeng, Yang Zhong and Lijun Luo
Institute of Biodiversity Science, School of Life Sciences, Fudan University, Shanghai, 200433, People’s Republic of China
Shanghai Agro-Biological Gene Center, Shanghai, 201106, People’s Republic of China

... ncbi.nih.gov/) through BLAST. After this, Fgenesh soft- ware (http://www. softberry.com) was used to predict candidate genes. All ...


Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)

Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene

Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming

... softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind; Salamov and Solovyev 2000) and GeneScan (http://genes.mit.edu/GENSCAN. ...


Nucleic Acids Research
2006 34(17):4685-4701

Organization of chromosome ends in the rice blast fungus, Magnaporthe oryzae

Cathryn Rehmeyer et al.,
Department of Plant Pathology, University of Kentucky Lexington, KY 40546 USA

... The masked sequences were then used for gene prediction with Fgenesh (67) trained on M.oryzae sequences (Softberry, www.softberry.com). ...


TAG Theoretical and Applied Genetics
Volume 113, Number 5 / September, 2006 pp.875-883

Identification and fine mapping of AvrPi15, a novel avirulence gene of Magnaporthe grisea

Jun-Hong Ma et al.,
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China

... out with the CAG markers, which were developed based on the sequence of the candidate genes predicted using the gene annotation system, Softberry FGENESH ...


The Plant Cell
18:1339-1347 (2006)

Sequence-Level Analysis of the Diploidization Process in the Triplicated FLOWERING LOCUS C Region of Brassica rapa

Yang et al.,
Brassica Genomics Team, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441-707, Korea

... Gene annotation was achieved using the web-based gene prediction program FGENESH Arabidopsis (http://www.softberry.com/berry.phtml). ...


Genome Research
16:618-626, 2006

Haplotype variation in structure and expression of a gene cluster associated with a quantitative trait locus for improved yield in rice

He et al.,
State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China

... 1997 Go) programs. Sequence analysis and gene prediction were performed by using the gene-finding programs FGENESH (http://www.softberry.com/berry.phtml). ...


Molecular Genetics and Genomics
Volume 275, Number 5 / May, 2006 pp. 450-459

Master: a novel family of PIF/Harbinger-like transposable elements identified in carrot (Daucus carota L.)

Dariusz Grzebelus, Yuan-Yeu Yau and Philipp W. Simon
Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, 31-425 Krakow, Poland
USDA-ARS Vegetable Crops Research Unit and Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI 53706, USA

... ORF and exon/intron localization were predicted using GenScan (URL: http://www.genes. mi- t.edu/GENSCAN.html) and FGenesh (URL: http:// www.softberry.com). ...


Planta
Volume 223, Number 6 / May, 2006 pp. 1134-1144

Identification and characterization of an Arabidopsis homogentisate phytyltransferase paralog

Venkatesh et al.
Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, MO 63167, USA

... http://hmmer.wustl.edu/). Gene prediction software FGENESH was procured from Softberry Inc., NY, USA. Dicot model provided with ...


Development Genes and Evolution
Volume 216, Number 4 / April, 2006 pp. 198-208

A comparative study of sperm morphology, cytology and activation in Caenorhabditis elegans, Caenorhabditis remanei and Caenorhabditis briggsae

Geldziler et al.
Department of Genetics, Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA

... The genome sequence around the sequence thus identified was used as an input for the gene prediction algorithms FGeneSH (http://www.softberry.com/berry. ...


Mol. Ecol.
Volume 15 Issue 5 Page 1367 -1378. April 2006

Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa

Gilchrist et al.
Department of Botany, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

... Gene models were predicted using fgenesh (Salamov & Solovyev 2000) through the Softberry website ( http:/ / www.softberry.com ). ...


Genome Research
16:618-626, 2006

Haplotype variation in structure and expression of a gene cluster associated with a quantitative trait locus for improved yield in rice

Guangming He et al.
1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China;

... 1997 Go) programs. Sequence analysis and gene prediction were performed by using the gene-finding programs FGENESH (http://www.softberry.com/berry.phtml). ...


The Plant Cell
18:1339-1347 (2006)

Sequence-Level Analysis of the Diploidization Process in the Triplicated FLOWERING LOCUS C Region of Brassica rapa[W],[OA]

Tae-Jin Yanga et al.
a Brassica Genomics Team, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441-707, Korea

... Gene annotation was achieved using the web-based gene prediction program FGENESH Arabidopsis (http://www.softberry.com/berry.phtml). ...


Medical Mycology
Publisher: Taylor & Francis Issue: Volume 44, Number 3 / May 2006 Pages: 211 - 218

The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus

Chen Du A1, Jacqueline Sarfati A2, J-P Latge A2, Richard Calderone A1
A1 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA A2 Aspergillus Unit, Institut Pasteur, Paris, France

... tcsB gene and phenotype of the deletion mutant DNA sequence analysis of tcsB (gene-finding software FGENESH. WWW.softberry.com) revealed a long Fig. ...


Molecular Genetics and Genomics
Issue: Volume 275, Number 5 Date: May 2006 Pages: 504 - 511

A complete physical map of a wild beet (Beta procumbens) translocation in sugar beet

Daniela Schulte1, Daguang Cai1, Michael Kleine1, 2, Longjiang Fan1, 3, Sheng Wang1, 3 and Christian Jung1
(1) Plant Breeding Institute, Christian-Albrechts-University Kiel, Olshausenstr. 40, 24098 Kiel, Germany (2) Present address: PLANTON GmbH, Am Kiel-Kanal 44, 24106 Kiel, Germany (3) Institute of Bioinformatics and Institute of Crop Science, Zhejiang University, 310029 Hangzhou, China

... An ab initio ORF-analysis with the FgeneSH program on http://www.sun1.softberry. com was performed to iden- tify putative coding regions using the A. thaliana ...


Molecular Genetics and Genomics
Issue: Volume 275, Number 5 Date: May 2006 Pages: 450 - 459

Master: a novel family of PIF/Harbinger-like transposable elements identified in carrot (Daucus carota L.)

Dariusz Grzebelus1, Yuan-Yeu Yau2, 3, 4 and Philipp W. Simon2
(1) Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, 31-425 Krakow, Poland

... ORF and exon/intron localization were predicted using GenScan (URL: http://www.genes. mi- t.edu/GENSCAN.html) and FGenesh (URL: http:// www.softberry.com). ...


Development Genes and Evolution
Issue: Volume 216, Number 4 Date: April 2006 Pages: 198 - 208

A comparative study of sperm morphology, cytology and activation in Caenorhabditis elegans, Caenorhabditis remanei and Caenorhabditis briggsae

Brian Geldziler1, Indrani Chatterjee1, Pavan Kadandale1, Emily Putiri1, Rajesh Patel2 and Andrew Singson1
(1) Department of Genetics, Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA (2) Department of Pathology, Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA

... The genome sequence around the sequence thus identified was used as an input for the gene prediction algorithms FGeneSH (http://www.softberry.com/berry. ...


Planta
Issue: Volume 223, Number 6 Date: May 2006 Pages: 1134 - 1144

Identification and characterization of an Arabidopsis homogentisate phytyltransferase paralog

Tyamagondlu V. Venkatesh1, Balasulojini Karunanandaa1, Daniel L. Free2, Jeannie M. Rottnek2, Susan R. Baszis2 and Henry E. Valentin3
(1) Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, MO 63167, USA

... http://hmmer.wustl.edu/). Gene prediction software FGENESH was procured from Softberry Inc., NY, USA. Dicot model provided with ...


TAG Theoretical and Applied Genetics
Issue: Volume 112, Number 6 Date: April 2006 Pages: 1179 - 1191

Molecular cytogenetics and DNA sequence analysis of an apomixis-linked BAC in Paspalum simplex reveal a non pericentromere location and partial microcolinearity with rice

Ornella Calderini1, Song B. Chang2, 6, Hans de Jong2, Alessandra Busti1, Francesco Paolocci1, Sergio Arcioni1, Sacco C. de Vries3, Marleen H. C. Abma-Henkens4, Rene M. Klein Lankhorst4, Iain S. Donnison5 and Fulvio Pupilli1
(1) Institute of Plant Genetics CNR, Perugia via della madonna alta 130, 06128 Perugia, Italy

... Gene structure and predicted protein sequences were obtained from assembled contigs using the FGENESH program at the SoftBerry site (http://www.softberry.com ...


ChemBioChem
2006, Volume 7, Issue 1 , Pages 158 - 164

Reverse Prenyltransferase in the Biosynthesis of Fumigaclavine C in Aspergillus fumigatus: Gene Expression, Purification, and Characterization of Fumigaclavine C Synthase FGAPT1

Inge A. Unsold, Shu-Ming Li, Priv. Doz. Dr.
Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, 72076 Tubingen, Germany, Fax: (+49) 7071-29-5250;

... FGENESH (Softberry, Inc., www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1: Hitachi Software Engineer- ing, San Bruno, CA) were used ...


Genetics
Genetics, Vol. 173, 131-149, May 2006

Searching for neuronal left/right asymmetry: Genome wide analysis of nematode receptor-type guanylyl cyclases

Christopher O. Ortiz et.al.,
Howard Hughes Medical Institute Department of Biochemistry and Molecular Biophysics Columbia University Medical Center 701 W.168th Street New York, NY 10032

... Wormbase WS149), we suspected that C. briggsae genes may have been incorrectly predicted. We therefore ran the FGENESH program at www.softberry.com (S ALAMOV ...


Genome Biology
2006, 7:R16 doi:10.1186/gb-2006-7-2-r16

The role of transposable element clusters in genome evolution and loss of synteny in the rice blast fungus Magnaporthe oryzae

Michael R Thon et al.,
Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843, USA

The gene prediction program FGENESH (Softberry Corporation, Mount Kisco, NY, USA) trained to predict M. oryzae genes [3] was used to identify 1,151 putative gene coding sequences.


Genetics
Published Articles Ahead of Print, published on February 19, 2006 as 10.1534/genetics.105.054791

Distribution of microsatellites in the genome of Medicago truncatula: A resource of genetic markers that integrate genetic and physical maps.

Jeong-Hwan Mun et al.,
Department of Plant Pathology, University of California, Davis, CA, USA.

... Gene-coding regions were predicted in M. truncatula using the eudicot version of FGENESH (www.softberry.com). BAC-end sequences were divided into gene- ...


Theor Appl Genet
(2006) DOI 10.1007/s00122-005-0201-2

Development of four phylogenetically-arrayed BAC libraries and sequence of the APA locus in Phaseolus vulgaris

James Kami, Vale´ rie Poncet, Vale´ rie Geffroy, Paul Gepts
Department of Plant Sciences, Section of Crop and Ecosystem Sciences, University of California, Mailstop 1, 1 Shields Avenue, Davis, CA 95616-8780, USA

... www.genes.cs.wustl.edu/), and FGENESH (http:// www.softberry.com/; trained with Nicotiana tabacum, Medicago truncatula, Dicot or Monocot). ...


Molecular Ecology
15 (5), 1367-1378. - April 2006

Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa

ERIN J. GILCHRIST et al.,
Department of Botany, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

... Gene models were predicted using fgenesh (Salamov & Solovyev 2000) through the Softberry website ( http:/ / www.softberry.com ). ...


Applied and Environmental Microbiology
, March 2006, p. 1793-1799, Vol. 72, No. 3

Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae

Iffa Gaffoor1 and Frances Trail1,2
Departments of Plant Biology,1 Plant Pathology, Michigan State University, East Lansing, Michigan 488242

... portions of the sequence. Using this complete sequence, FGENESH software (http://www. softberry. com) with organism-specific parameters ...


Medical Mycology
Volume 44, Number 3 / May 2006 Pages: 211 - 218

The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus

Chen Du A1, Jacqueline Sarfati A2, J-P Latge A2, Richard Calderone A1
A1 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA A2 Aspergillus Unit, Institut Pasteur, Paris, France

... tcsB gene and phenotype of the deletion mutant DNA sequence analysis of tcsB (gene-finding software FGENESH. WWW.softberry.com) revealed a long Fig. ...


Genetics
Vol. 172, 2491-2499, April 2006

Tracing Nonlegume Orthologs of Legume Genes Required for Nodulation and Arbuscular Mycorrhizal Symbioses

Hongyan Zhu1, Brendan K. Riely2, Nicole J. Burns3, Jean-Michel Ané3
1Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546

... GenBank database. Gene prediction was performed by FGENESH (http://www. softberry.com/berry.phtml?topic=gfind). Sequence alignments ...


TAG Theoretical and Applied Genetics
Issue: Volume 112, Number 4 Date: February 2006 Pages: 618 - 626

Structural variation and evolution of a defense-gene cluster in natural populations of Aegilops tauschii

Steven A. Brooks1, 3, Li Huang2, Marie N. Herbel2, Bikram S. Gill2, Gina Brown-Guedira1 and John P. Fellers1
(1)Plant Science and Entomology Unit, Department of Plant Pathology, USDA-ARS, Manhattan, KS 66506, USA

... FGENESH 1.1 (http:// www.softberry.com) was used for coding sequence (CDS) prediction with monocot genomic DNA param- eters. Putative ...


Plant Physiology
, March 2006, Vol. 140, pp. 998-1008

Point Mutations with Positive Selection Were a Major Force during the Evolution of a Receptor-Kinase Resistance Gene Family of Rice

Xinli Sun, Yinglong Cao and Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... 1997 Go). The gene prediction programs used were GENSCAN (Burge and Karlin, 1997 Go) and FGENESH (http://www.softberry.com). The ...


Mol Gen Genomics
Volume 275, Number 5 / May, 2006 pp. 504-511

A complete physical map of a wild beet ( Beta procumbens) translocation in sugar beet

Daniela Schulte, Daguang Cai, Michael Kleine, Longjiang Fan, Sheng Wang, Christian Jung
Plant Breeding Institute, Christian-Albrechts-University Kiel, Olshausenstr. 40, 24098 Kiel, Germany

... An ab initio ORF-analysis with the FgeneSH program on http://www.sun1.softberry. com was performed to iden- tify putative coding regions using the A. thaliana ...


Molecular Microbiology
2006, 60 (1), 67-80

Lost in the middle of nowhere: the AvrLm1 avirulence gene of the Dothideomycete Leptosphaeria maculans

Lilian Gout 1 et al.,
Phytopathologie et Methodologies de la Detection, INRA, F-78026 Versailles, France.

... genscan ( http:/ / genes.mit.edu/ GENSCAN.html ) was used with vertebrate and Arabidopsis settings and fgenesh ( http:/ / www.softberry.com ) was set with N ...


J Gen Virol
87 (2006), 311-322

Characterization and transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the parasitized host

D. E. Gundersen-Rindal and M. J. Pedroni
US Department of Agriculture, Agricultural Research Service, Insect Biocontrol Laboratory, Bldg 011A, Room 214, BARC West, Beltsville, MD 20705, USA

... nih.gov/gorf/gorf.html (only large ORFs are shown)], FGENESH [ab initio ... gambiae and Apis mellifera insect gene parameters; http://www.softberry.com (Salamov & ...


FGENESH 2005

Current Biology
2005, Volume 15, Issue 16, Pages 1508-15

Select a website below to get this article

Causier et al.,

... 25], GeneMark.hmm (http://opal.biology.gatech.edu/genemark/eukhmm.cgi) [26] (each with the Arabidopsis dataset), and FGENESH (http://www.softberry.com/) (with ...


Plant Molecular Biology
Volume 58, Number 6 / August, 2005, pp. 809-822

The Medicago truncatula SUNN Gene Encodes a CLV1-like Leucine-rich Repeat Receptor Kinase that Regulates Nodule Number and Root Length

Elise et al.,
(1) Department of Genetics, Biochemistry and Life Science Studies, Clemson University, 100 Jordan Hall, Clemson, SC 29634, USA (2) Laboratoire des Interactions Plantes-Microorganismes, Unité Mixte de Recherche, CNRS-INRA, 31326 Castanet-Tolosan cédex, France

... Genes in this region were predicted using FGENESH (http:// www.softberry.com) (Salamov and Solovyev, 2000) using parameters for the M. truncatula genome, the ...


TAG Theoretical and Applied Genetics
Volume 111, Number 3 / August, 2005, pp. 467-478

Toward closing rice telomere gaps: mapping and sequence characterization of rice subtelomere regions

Yang et al.,
(1) Brassica Genomics Team, National Institute of Agricultural Biotechnology, RDA, Suwon, 441-707, Korea (2) Arizona Genomics Institute, University of Arizona, 303 Forbes building, Tucson, AZ 85721, USA

... while the detection of putative genes was analyzed using sev- eral web-based gene prediction programs including: FGENE-SH MONOCOT (http://www.softberry.com/ber ...


Chromosoma
Volume 114, Number 2 / July, 2005, pp. 103-117

In-depth sequence analysis of the tomato chromosome 12 centromeric region: identification of a large CAA block and characterization of pericentromere retrotranposons

Yang et al.,
(1) Brassica Genomics Team, National Institute of Agricultural Biotechnology (NIAB), RDA, Suwon, 441-707, South Korea (2) Arizona Genomics Institute, 303 Forbes building, University of Arizona, Tucson, AZ 85721, USA

... Gene an- notation was achieved using several web-based gene pre- diction programs such as FGENE-SH Arabidopsis (http:// www.softberry.com/berry.phtml ...


Journal of Molecular Evolution
Volume 61, Number 4 / October, 2005, pp. 559-569

Plant Photoreceptors: Phylogenetic Overview

Patricia Lariguet1 and Christophe Dunand1
(1) Department of Plant Biology, University of Geneva, Quai Ernest Ansermet 30, Geneva 4, CH-1211, Switzerland

... quences were analyzed for the presence of the gene with different programs such as FGenesh (http://www.softberry.com/ber- ry.phtml) and GenScan (http://genes ...


Journal of Molecular Evolution
Volume 60, Number 5 / May, 2005, pp. 615-634

Structure, Evolution, and Expression of the Two Invertase Gene Families of Rice

Xuemei Ji1, 2, Wim Van den Ende3, Andre Van Laere3, Shihua Cheng2 and John Bennett 1
1) Plant Breeding, Genetics and Biochemistry Division, International Rice Research Institute, DAPO, 7777, Metro Manila, Philippines (2) Chinese National Rice Research Institute, 359 Tiyuchang Road, Hangzhou, Zhejiang, 310006, China

... supplemented the above methods with the use of Genscan (http://genes.mit.edu/ GENSCAN.html) (Burge and Karlin 1997) and FGENESH (http://www.softberry.ru/berry ...


Genetics
Published Articles Ahead of Print: May 6, 2005, Copyright © 2005 doi:10.1534/genetics.105.041616

Centric regions of soybean (Glycine max L. Merr.) chromosomes consist of retroelements and tandemly repeated DNA and are structurally and evolutionarily labile

Lin et al.,
1 Purdue University 2 USDA-ARS-CICGR, and Department of Agronomy 3 University of Minnesota

... Fifteen potential genes were found on the BAC using FGENESH (http://www.softberry. com/berry.phtml) (Table 2). Three of the fifteen (4-6) ...


TAG Theoretical and Applied Genetics
Volume 111, Number 6 / October, 2005, pp. 1080-1086

Delimitation of the rice wide compatibility gene S5n to a 40-kb DNA fragment

Qiu et al.,
(1) National Key Laboratory of Crop Genetic Improvement, and National Center of Plant Gene Research-Wuhan, Huazhong Agricultural University, Wuhan, 430070, China

... Gene prediction analysis of the 40-kb DNA fragment using FGENSH (http://www.softberry. com) identified five putative open reading frames (ORFs; Fig. 2). Both ...


Molecular Genetics and Genomics
Volume 274, Number 6 / December, 2005, pp. 569-578

High-resolution mapping, cloning and molecular characterization of the Pi-k h gene of rice, which confers resistance to Magnaporthe grisea

Sharma et al.,
(1) National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India

... The 143,537 bp region of Nipponbare identified by physical mapping was then analysed with FGENESH software (http://www.softberry.com) to detect putative genes. ...


Genetics
2005 July; 170(3): 1221–1230. doi: 10.1534/genetics.105.041616.

Pericentromeric Regions of Soybean (Glycine max L. Merr.) Chromosomes Consist of Retroelements and Tandemly Repeated DNA and Are Structurally and Evolutionarily Labile

Lin et al.,
*Department of Agronomy, Purdue University, West Lafayette, Indiana 47907 †Purdue University Genomics Core, Department of Horticulture, Purdue University, West Lafayette, Indiana 47907

... Fifteen potential genes were found on the BAC using FGENESH (http://www.softberry. com/berry.phtml) (Table 2). Three of the 15 (4-6) were derived from either ...


Genomics
Volume 85, Issue 6, June 2005, Pages 666-678

Biosilica formation in spicules of the sponge Suberites domuncula: Synchronous expression of a gene cluster

Schroder et al.,
aInstitut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Johannes Gutenberg-Universitat, Duesbergweg 6, D-55099 Mainz, Germany

... Four open reading frames (ORFs) were predicted using the program FGENESH ("softberry"): putative ankyrin repeat protein ANKrp_SUBDO (SDANKrp), silicatein ...


Genetics
2005 February; 169(2): 891–906. doi: 10.1534/genetics.104.034629.

Structure and Evolution of the r/b Chromosomal Regions in Rice, Maize and Sorghum

Zuzana Swigonova,* Jeffrey L. Bennetzen,†1 and Joachim Messi
*Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854-8020 †Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907-1392

... Finnzyme, Helsinki). Sequence analysis: Genes predicted by FGENESH (http://www.softberry.com/berry.phtml? topic=gfind&prg=FGENESH ...


Genetics
2005 March; 169(3): 1403–1414. doi: 10.1534/genetics.104.035972.

Gene Clusters for Insecticidal Loline Alkaloids in the Grass-Endophytic Fungus Neotyphodium uncinatum

Martin J. Spiering,* Christina D. Moon,*1 Heather H. Wilkinson,† and Christopher L. Schardl*2
*Department of Plant Pathology, University of Kentucky, Lexington, Kentucky 40546-0312 †Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas 77843-2132

... with the search parameters for the N. crassa genome, genomic DNA sequences were entered into the FGENESH gene prediction program (http://www.softberry.com/berry ...


Genetics
2005 July; 170(3): 1209–1220. doi: 10.1534/genetics.105.040915.

DNA Rearrangement in Orthologous Orp Regions of the Maize, Rice and Sorghum Genomes

Jianxin Ma,*† Phillip SanMiguel,‡ Jinsheng Lai,§ Joachim Messing,§ and Jeffrey L. Bennetzen*†1
Department of Genetics, University of Georgia, Athens, Georgia 30602 †Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907

... Sequence analysis and annotation: Gene-finding programs FGENESH (http://www.softberry. com/berry.phtml?topic=gfind&prg=FGENESH) with the monocot training set ...


PNAS
August 23, 2005 vol. 102 no. 34 12282-12287

Quality assessment of maize assembled genomic islands (MAGIs) and large-scale experimental verification of predicted genes

Yan Fu et al.,
*Interdepartmental Genetics Graduate Program, §Interdepartmental Bioinformatics and Computational Biology Graduate Program, **L. H. Baker Center for Bioinformatics and Biological Statistics

... fgenesh (Softberry, Mount Kisco, NY) was used for ab initio gene prediction with monocot parameters and the GC option that uses all potential GC donor splice ...


PNAS
December 27, 2005 vol. 102 no. 52 19243-19248

Analysis and mapping of randomly chosen bacterial artificial chromosome clones from hexaploid bread wheat

Devos et al.,
Departments of *Crop and Soil Sciences, †Plant Biology, and §Genetics, University of Georgia, Athens, GA 30602

... The gene prediction program fgenesh, with the monocot (maize, rice, wheat, and barley) training set (www.softberry.com), was used to predict genes. ...


Eukaryotic Cell
November 2005, p. 1926-1933, Vol. 4, No. 11

Functional Analysis of the Polyketide Synthase Genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum)

Gaffoor et al.,
Department of Plant Biology, Michigan State University, East Lansing, Michigan 48824,1 Mycotoxin Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, Peoria, Illinois 61604,2

... Ab initio gene identification was accomplished using FGENESH (http://www.softberry. com) with organism-specific parameters for Neurospora crassa (12). ...


Cytokine
Volume 32, Issue 5, 7 December 2005, Pages 219-225

Expression of nine-banded armadillo (Dasypus novemcinctus) interleukin-2 in E. coli

Adams et al.,
Laboratory Research Branch National Hansen's Disease Programs, Louisiana State University, School of Veterinary Medicine, Skip Bertman Drive, Baton Rouge, LA 70803, USA

... The genomic sequence was submitted to FGENESH (http://www.softberry.com) to derive a putative cDNA and a corresponding translation for the putative amino acid ...


Comparative and Functional Genomics
Volume 6 (2005), Issue 3, Pages 138-146doi:10.1002/cfg.465

The Korea Brassica Genome Project: a Glimpse of the Brassica Genome Based on Comparative Genome Analysis With Arabidopsis

Tae-Jin Yang et al.,
1National Institute of Agricultural Biotechnology (NIAB), 224 Suinro Gwonseon-gu, Gyeonggi-do, Suwon 441–707, Korea 2Chungnam National University, Gungdong 220, Chungnam, Daejeon 305–764, Korea

... Gene annotation was achieved using several web based gene prediction programs, eg FGENE-SH Arabidopsis (http://www.softberry.com/berry. ...


Plant Molecular Biology
Volume 59, Number 1 / September, 2005, pp.191-203

Transcription Factors in Rice: A Genome-wide Comparative Analysis between Monocots and Eudicots

Xiong et al.,
(1) Present address: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 100101 Beijing, China

... BGI) (Yu et al., 2002) (http://www.genomics.org.cn/) and the genes were predicted using FGENESH (Salamov and Solovyev, 2000) (http://www.softberry.com/). ...


Molecular Biology and Evolution
2005 22(10):2084-2089; doi:10.1093/molbev/msi202

MUSTANG Is a Novel Family of Domesticated Transposase Genes Found in Diverse Angiosperms

Rebecca K. Cowan, Douglas R. Hoen, Daniel J. Schoen and Thomas E. Bureau
McGill University, Biology Department, Montreal, Quebec H3A 1B1, Canada

... through AP006877 and National Center for Biotechnology Information [NCBI] accession number AE016959), predicted using FGENESH (http://www.softberry.com/berry ...


Plant Molecular Biology
Issue: Volume 57, Number 3 Date: February 2005 Pages: 445 - 460

Evaluation of five ab initio gene prediction programs for the discovery of maize genes

Hong Yao1, 4 et al
Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, 50011-3650, USA.

ABSTRACT
Five ab initio programs (FGENESH, GeneMark.hmm, GENSCAN, GlimmerR and Grail) were evaluated for their accuracy in predicting maize genes. Two of these programs, GeneMark.hmm and GENSCAN had been trained for maize; FGENESH had been trained for monocots (including maize), and the others had been trained for rice or Arabidopsis. Initial evaluations were conducted using eight maize genes (gl8a, pdc2, pdc3, rf2c, rf2d, rf2e1, rth1, and rth3) of which the sequences were not released to the public prior to conducting this evaluation. The significant advantage of this data set for this evaluation is that these genes could not have been included in the training sets of the prediction programs. FGENESH yielded the most accurate and GeneMark.hmm the second most accurate predictions. The five programs were used in conjunction with RT-PCR to identify and establish the structures of two new genes in the a1-sh2 interval of the maize genome. FGENESH, GeneMark.hmm and GENSCAN were tested on a larger data set consisting of maize assembled genomic islands (MAGIs) that had been aligned to ESTs. FGENESH, GeneMark.hmm and GENSCAN correctly predicted gene models in 773, 625, and 371 MAGIs, respectively, out of the 1353 MAGIs that comprise data set 2.


Nature
434, 980-986 (21 April 2005)

The genome sequence of the rice blast fungus Magnaporthe grisea

Dean et al.,
Center for Integrated Fungal Research, North Carolina State University, Raleigh, North Carolina 27695, USA School of Biological and Chemical Sciences, University of Exeter, Washington Singer Laboratories, Exeter EX4 4QG, UK

...Gene predictions were performed using FGENESH/FGENESH1 + trained on M. grisea sequences (SoftBerry) and GENEWISE (Sanger Center) and validated against 65 characterized M. grisea genes. Additional information and gene identification...


Nature
436, 793 - 800 (11 Aug 2005)

The map-based sequence of the rice genome

International Rice Genome Sequencing Project


...the remaining centromere gaps. Annotation and bioinformatics Gene models were predicted using FGENESH (http://www.softberry.com/berry.phtml?topic = fgenesh) using the monocot trained matrix on the native and repeat-masked...


Nature Genetics
37 997 - 1002 (01 Sep 2005) Letters

Gene duplication and exon shuffling by helitron-like transposons generate intraspecies diversity in maize

Morgante et al.,
1 Dipartimento di Scienze Agrarie ed Ambientali, Universita' di Udine, Via delle Scienze 208, 33100 Udine, Italy. 2 DuPont Crop Genetics Research, DuPont Experimental Station Building E353, Wilmington, Delaware 19880-353, USA.

...at http://www.girinst.org/~vladimir/RC/Data1.htm. We obtained FGENSH splicing site predictions from http://www.softberry.com/berry.phtml. Primer3 is available at http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi. Note:...


European Journal of Plant Pathology
Issue: Volume 112, Number 1 Date: May 2005 Pages: 23 - 29

Leptosphaeria maculans, a fungal pathogen of Brassica napus, secretes a subtilisin-like serine protease

Leanne M. Wilson and Barbara J. Howlett
1 School of Botany, The University of Melbourne, Parkville, Victoria, 3010, Australia

... DNA and cDNA sequences were compared to identify intron positions, which confirmed those predicted by FGENESH gene prediction software (www.softberry.com). ...


Current Genetics Issue: Volume 47, Number 5 Date: May 2005 Pages: 307 - 315

During attachment Phytophthora spores secrete proteins containing thrombospondin type 1 repeats

Andrea V. Robold1 and Adrienne R. Hardham1
(1) Plant Cell Biology Group, Research School of Biological Sciences, The Australian National University, Canberra, ACT 2601, Australia

... info.html). The DNA sequence was searched for introns using the soft- ware program FGENESH (http://www.softberry. com/berry.phtml ...


Microbiology
151 (2005), 1499-1505

Overproduction, purification and characterization of FgaPT2, a dimethylallyltryptophan synthase from Aspergillus fumigatus

Inge A. Unsold and Shu-Ming Li
Pharmazeutische Biologie, Pharmazeutisches Institut, Eberhard-Karls-Universitat Tubingen, Auf der Morgenstelle 8, 72076 Tubingen, Germany

... FGENESH (Softberry; www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used for intron prediction ...


Eukaryotic Cell
March 2005, p. 526-535, Vol. 4, No. 3

Sex-Specific Homeodomain Proteins Sxi1a and Sxi2a Coordinately Regulate Sexual Development in Cryptococcus neoformans

Christina M. Hull,1, Marie-Josee Boily,1 and Joseph Heitman1,2*
Department of Molecular Genetics and Microbiology,1 the Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina2

... Sequence manipulations. Splice predictions of candidate gene sequences for SXI2a were facilitated with a Softberry algorithm (www.softberry.com). ...


New Phytologist
167 (1), July 2005, 239-247.

Identification of perennial ryegrass (Lolium perenne (L.)) and meadow fescue (Festuca pratensis (Huds.)) candidate orthologous sequences to the rice Hd1(Se1) and barley HvCO1 CONSTANS-like genes through comparative mapping and microsynteny

P. Armstead, L. Skot, L. B. Turner, K. Skot, I. S. Donnison, M. O. Humphreys and I. P. King

... Predictions of mRNA and protein sequences were carried out using FGENESH and FGENESH+ software ( http:/ / www.softberry.com/ berry.phtml ). ...


Plant Physiology
May 2005, Vol. 138, pp. 38-46

BIOINFORMATICS-PLANT DATABASES
Databases and Information Integration for the Medicago truncatula Genome and Transcriptome1

Steven B. Cannon et al
Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota 55108 (S.B.C., X.W., E.K.S.C., J.V., J.M., N.D.Y.)

... Annotation involves a multi-institution pipeline, relying on Medicago-trained FGENESH (Salamov and Solovyev, 2000 ) predictions, the EuGene (Foissac et al ...


Plant Physiology
May 2005, Vol. 138, pp. 18-26

BIOINFORMATICS-PLANT DATABASES
The Institute for Genomic Research Osa1 Rice Genome Annotation Database1

Qiaoping Yuan et al
The Institute for Genomic Research, Rockville, Maryland 20850

... The ab initio gene finders used in the rice EGC pipeline include FGENESH (monocot matrix; Salamov and Solovyev, 2000 ), GeneMark.hmm (rice matrix; Lukashin and ...


Genome Research
15:577-582, 2005

Closing in on the C. elegans ORFeome by cloning TWINSCAN predictions

Chaochun Wei1 et al.
1 Laboratory for Computational Genomics and Department of Computer Science and Engineering, Washington University, St. Louis, Missouri 63130, USA

... Finally, we compared TWINSCAN with two other gene-prediction systems that have recently been developed for nematodes-FGENESH (Salamov and Solovyev 2000 ...


Plant Physiology
April 2005, Vol. 137, pp. 1174-1181

UPDATE ON SEQUENCING MEDICAGO TRUNCATULA AND LOTUS JAPONICUS
Sequencing the Genespaces of Medicago truncatula and Lotus japonicus1

Nevin D. Young et al
Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota 55108 (N.D.Y., S.B.C.)

... (These estimates are based on FGENESH predictions [Salamov and Solovyev, 2000] using a Mt-trained matrix, retaining peptides with a BLASTP match at 10e-4 to the UniProt NREF100 database of peptides [Apweiler et al., 2004]. This estimate for Lj differs from the published value of 1 gene per 10.1 kb [Asamizu et al., 2003a] due to the use here of the FGENESH gene-calling algorithm so Mt and Lj could be compared directly.)...
...This estimate increases to 6,500 when Lj genes are predicted by the Mt-trained FGENESH algorithm described earlier...


International Journal of Cancer
Volume 109, Issue 1 , Pages 71 - 75

Candidate regions of tumor suppressor locus on chromosome 9q31.1 in gastric cancer

Naoto Kakinuma 1 et al
1Novartis Pharma Tsukuba Research Institute, Ibaraki, Japan
2Laboratory of Molecular and Genetic Information, Institute for Molecular and Cellular Biosciences, University of Tokyo, Tokyo, Japan
3Second Department of Surgery, Gunma University School of Medicine, Gunma, Japan

... predict the genes between D9S277 and D9S127 in 9q31.1, the gene prediction tools also in the UCSC Genome Browser having Acembly, Ensembl, FGENESH , GenScan and ...


Genome Research
15:54-66, 2005

Gene and alternative splicing annotation with AIR

Liliana Florea1,4,5 et al
1 Informatics Research, Applied Biosystems, Rockville, Maryland 20850, USA;

... Ab initio prediction programs such as GenScan (Burge and Karlin 1997 ), FGENESH (Salamov and Solovyev 2000 ), Genie (Kulp et al. ...


Nucleic Acids Research
2005, Vol. 33, Database issue D399-D402

SilkDB: a knowledgebase for silkworm biology and genomics

Jing Wang1 et al
1 College of Life Sciences, Peking University, Beijing 100871, China,

... BGF is a self-developed ab initio program based on GenScan (9) and FGENESH (10), and was successfully utilized for our rice genome annotation (11). ...


Clinical Cancer Research
Vol. 11, 4029-4036, June 1, 2005

A Molecular Signature in Superficial Bladder Carcinoma Predicts Clinical Outcome

Lars Dyrskjot1 et al
Authors' Affiliations: 1 Molecular Diagnostic Laboratory, Department of Clinical Biochemistry

... array comprising 59,619 probe sets representing 46,000 unique sequences, including known genes, expressed sequence tag clusters, and FGENESH-predicted exons ...


BMC Evolutionary Biology
2005, 5:1

The WRKY transcription factor superfamily: its origin in eukaryotes and expansion in plants

Yuanji Zhang* and Liangjiang Wang
Address: Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK 73402, USA

... Despite minor differences in the gene structure prediction, both gene prediction programs FGENESH and GENSCAN agree on the major features of the protein ...


PLoS Biol.
2005 June; 3(6): e181.

RAG1 Core and V(D)J Recombination Signal Sequences Were Derived from Transib Transposons

Vladimir V Kapitonov1 and Jerzy Jurka1
1Genetic Information Research Institute, Mountain View, California, United States of America David Nemazee, Academic Editor

... Using FGENESH [33], we detected that the RAG1 core-like open reading frame (ORF) in the contig 29068 forms a terminal exon (positions 1154-2947) of an ...


Genetics
Published Articles Ahead of Print, published on February 16, 2005 as 0.1534/genetics.104.036327

Identification and Characterization of Regions of the Rice Genome Associated with Broad- Spectrum, Quantitative Disease Resistance

Randall J. Wisser R.J * et al.
*Department of Plant Breeding and Genetics, Institute for Genomic Diversity, Cornell University, Ithaca, New York 14853

... GENSCAN (B URGE and K ARLIN 1997) and FGENESH (S ALAMOV and S OLOVYEV 2001) to predict open reading frames. Further searches against ...


Plant Physiology
January 2005, Vol. 137, pp. 176-189

Annotations and Functional Analyses of the Rice WRKY Gene Superfamily Reveal Positive and Negative Regulators of Abscisic Acid Signaling in Aleurone Cells1,[w]

Zhen Xie2 et al
Department of Biological Sciences, University of Nevada, Las Vegas, Nevada 89154

... First of all, three genes (OsWRKY41, -43, and -44) were reannotated using FGENESH (www.softberry.com), because the first introns of these genes were too small ...


PLoS Biol
3(6): e181 (2005)

RAG1 Core and V(D)J Recombination Signal Sequences Were Derived from Transib Transposons.

Vladimir V. Kapitonov1*, Jerzy Jurka1*
1 Genetic Information Research Institute, Mountain View, California, United States of America

... Using FGENESH [33], we detected that the RAG1 core-like open reading frame (ORF) in the contig 29068 forms a terminal exon (positions 1154-2947) of an ...


Plant and Cell Physiology 2005 46(1):3-13; doi:10.1093/pcp/pci503

From Mapping to Sequencing, Post-sequencing and Beyond

Takuji Sasaki1, Takashi Matsumoto, Baltazar A. Antonio and Yoshiaki Nagamura
National Institute of Agrobiological Sciences, 2-1-2 Kannondai, Tsukuba, Ibaraki 305-8602, Japan

... The gene predictions by programs such as Genescan (Burge and Karlin 1997 ), FGENESH [see Appendix 1 (4)] and Genemark [see Appendix 1 (5)], BLAST (Altschul et ...


Nature Biotechnology, 2005


Improving the nutritional value of Golden Rice through increased pro-vitamin A content

JA Paine, CA Shipton, S Chaggar, RM Howells, MJ ...

... Arabidopsis thaliana psy and rice psy (AY024351) genes identified genomic sequences of similarity in which genes were predicted using FGENESH algorithm with ...


Genetics
Published Articles Ahead of Print, published on January 16, 2005 as 10.1534/genetics.104.035543

THE GENETIC BASIS FOR INFLORESCENCE VARIATION BETWEEN FOXTAIL AND GREEN MILLET (POACEAE)

Andrew N. Doust*, Katrien M. Devos1, Mike D. Gadberry*, Mike D. Gale, & Elizabeth A. Kellogg*
*University of Missouri-St. Louis, Department of Biology, One University Boulevard, St. Louis, MO 63121, USA

... Each of these contigs was scanned using FGENESH (S ALAMOV and S OLOVYEV 2000), and open reading frames (ORFs) were translated and ...


PLoS Biol
3(1): e13 January 2005

Sorghum Genome Sequencing by Methylation Filtration

Joseph A. Bedell et al.
Bioinformatics, Orion Genomics, Saint Louis, Missouri, United States of America,

... additional parameters: wordmask=seg; lcmask; M=1; N=-1; Q=3; R=3; kap; E=1e-10; hspmax=0. To look for potentially novel genes, we used FGENESH (http://www ...


BMC Genomics
2005, 6:11 doi:10.1186/1471-2164-6-11

FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells

Demet Nalbant et al.
Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas 79430, USA

... These results were compared against genes assembled by two gene prediction programs, FGENESH: http://www.softberry.com/berry.phtml and GENSCAN: http://genes.mit ...


Plant Physiology
July 2005, Vol. 138, pp. 1205-1215

Complex Organization and Evolution of the Tomato Pericentromeric Region at the FER Gene Locus1,[w]

Romain Guyot et al.
Institute of Plant Biology, University of Zurich, 8008 Zurich, Switzerland (R.G., E.S., B.K., H.-Q.L.); and Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Chaoyang District, Beijing 100101, China (X.C., Y.S., Z.C., H.-Q.L.)

... Putative genes were determined by a combination of coding region prediction software (GENSCAN, FGENESH, and MZEF with Arabidopsis and/or monocot matrix ...


J Gen Virol
86 (2005), 973-983; DOI 10.1099/vir.0.80833-0

Cloning, characterization and analysis by RNA interference of various genes of the Chelonus inanitus polydnavirus

Marianne Bonvin et al
Institute of Cell Biology, University of Berne, Baltzerstrasse 4, CH-3012 Bern, Switzerland

... 12g1forw (5'-GAGTCCATGCCGAATGTCAC-3') and 12g1rev (5'-CTTCTTGCACAGCGACGAAC-3') were set to amplify the middle region of 12g1, as predicted with FGENESH 1.0 and ...


BMC Plant Biol.
2005, 5:15

Highly syntenic regions in the genomes of soybean, Medicago truncatula, and Arabidopsis thaliana

Mudge et al.,
1Dept of Plant Pathology, 495 Borlaug Hall, University of Minnesota, St. Paul, MN 55108 USA

... Genes were predicted in G. max and M. truncatula genomic sequences using the dicot (Arabidopsis) matrix of FGENESH [59,60]http://www.softberry.com webcite. ...


PNAS
February 1, 2005 vol. 102 no. 5 1566-1571

A computational and experimental approach to validating annotations and gene predictions in the Drosophila melanogaster genome

Mark Yandell et al
Howard Hughes Medical Institute and Department of Molecular and Cell Biology, University of California, Life Sciences Addition, Berkeley, CA 94720-3200; and Department of Genome Sciences, Lawrence Berkeley National Laboratory, One Cyclotron Road, Mailstop 64-121, Berkeley, CA 94720

... genes, based on a microarray-based approach that involved hybridizing randomly primed cDNA against probes corresponding to a large set of FGENESH predictions. ...


Insect Molecular Biology
Volume 14 Issue 2 Page 113 - 119 April 2005

Detection and analysis of alternative splicing in the silkworm by aligning expressed sequence tags with the genomic sequence

X.-F. Zha et al
Correspondence: Dr Qing-You Xia, The Key Sericultural Laboratory of Agricultural Ministry, Southwest Agricultural University, Chongqing 400716, China.

... previously predicted silkworm genes in the genomic sequences by BGF, a newly developed program based on GENSCAN (Burge & Karlin, 1997) and FGENESH (Salamov & ...


Microbiology
151 (2005), 2199-2207; DOI 10.1099/mic.0.27962-0

Overproduction, purification and characterization of FtmPT1, a brevianamide F prenyltransferase from Aspergillus fumigatus

Alexander Grundmann and Shu-Ming Li
Pharmazeutische Biologie, Pharmazeutisches Institut, Eberhard-Karls-Universitat Tubingen, Auf der Morgenstelle 8, 72076 Tubingen, Germany

... FGENESH (Softberry, Inc., http://www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used for ...


FGENESH 2002-2004

Fungal Genetics and Biology
Volume 41, Issue 1, January 2004, Pages 23-32

Contig assembly and microsynteny analysis using a bacterial artificial chromosome library for Epichloe festucae, a mutualistic fungal endophyte of grasses

Brandi L Kutil a, Gang Liu a, 1, Julia Vrebalov b and Heather H Wilkinson
aDepartment of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77845-2132, USA bBoyce Thompson Institute for Plant Research, Ithaca, NY 14853-1801, USA

... Contigs were also submitted to FGENESH (http://www.softberry.com/berry.phtml) to predict ORFs using N. crassa as the training set. ...


Eukaryotic Cell
April 2004, p. 420-429, Vol. 3, No. 2

Cryptococcus neoformans Virulence Gene Discovery through Insertional Mutagenesis

Alexander Idnurm, Jennifer L. Reedy, Jesse C. Nussbaum, and Joseph Heitman
Department of Molecular Genetics and Microbiology, Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 27710

... FGENESH software (SoftBerry) was used to search for coding regions within the sequence, and BLAST searches were conducted against the GenBank database to infer ...


Breeding Science
Vol. 54 (2004) , No. 2 165-175

Molecular Characterization of a 313-kb Genomic Region Containing the Self-incompatibility Locus of Ipomoea trifida, a Diploid Relative of Sweet Potato

Rubens Norio Tomita et al.,
1) Faculty of Bioresources, Mie University 2) Division of Natural Science, Osaka Kyoiku University 3) Life Science Research Center, Mie University

... gatech.edu/GeneMark), GENE- SCAN (http://genes.mit.edu/GENESCAN), GlimmerM (http:// www.tigr.org/tdb.glimmerm/glmr) and FGENESH (http:// softberry.com/berry ...


J. Biol. Chem
Vol. 279, Issue 18, 18550-18558, April 30, 2004

The Two-pore Domain K+ Channel, TRESK, Is Activated by the Cytoplasmic Calcium Signal through Calcineurin

Gabor Czirjak, Zsuzsanna E. Toth, and Peter Enyedi
From the Department of Physiology and Laboratory of Neuromorphology, Semmelweis University, H-1444 Budapest, Hungary

... The conceptual coding region of the new channel was calculated from the neighboring genomic sequences by the FGENESH program at the Softberry site on the World ...


Genome Res.
2004. 14: 1916-1923 doi: 10.1101/gr.2332504

Close Split of Sorghum and Maize Genome Progenitors

Swigonova et al.,
1Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854, USA 2Department of Biological Sciences and Genetics Program, West Lafayette, Indiana 47907, USA

... Genes predicted by FGENESH (www.softberry.com) and GENSCAN (http://genes.mit.edu/ GENSCAN.html) programs were further analyzed by homology searches using BLAST ...


PNAS
October 26, 2004 vol. 101 no. 43 15289-15294

Estimating genome conservation between crop and model legume species

Choi et al.,
Department of Plant Pathology and §College of Agricultural and Environmental Sciences Genomics Facility, University of California, One Shields Avenue, Davis, CA 95616; ¶Department of Plant Pathology, University of Minnesota, St. Paul, MN 55108

... NCBI (18). Ab initio gene prediction involved the eudicot version of fgenesh (www.softberry.com/berry.phtml?topic=gfind). Gene prediction ...


PNAS
January 20, 2004 vol. 101 no. 3 700-707

Pattern of diversity in the genomic region near the maize domestication gene tb1

Richard M. Clark†, Eric Linton‡,§, Joachim Messing‡, and John F. Doebley†
†Laboratory of Genetics, University of Wisconsin, Madison, WI 53706; and ‡Waksman Institute, Rutgers University, Piscataway, NJ 08854

... default" and DNA source set to "Grasses." Nonrepetitive DNA was analyzed for genes by using the fgenesh gene prediction software (www.softberry.com/berry ...


Eukaryotic Cell
October 2004, p. 1088-1100, Vol. 3, No. 5

Introns and Splicing Elements of Five Diverse Fungi

Kupfer et al.,
Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City,2 Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma,1

... Translation of the DNA sequences was done by using FGENSH at the Softberry website (http://www.softberry.com/) with either the S. pombe or the N. crassa matrix ...


Journal of Experimental Biology
207, 4573-4586 (2004)

Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor

Jonathan C. Radford, Selim Terhzaz, Pablo Cabrero, Shireen-A. Davies and Julian A. T. Dow
Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, UK

... This region plus the surrounding 20 kb of genomic sequence either side was then analysed with the Softberry FgenesH gene prediction program (www.softberry.com ...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 4 Date: August 2004 Pages: 681 - 689

Linkage disequilibrium and sequence diversity in a 500-kbp region around the adh1 locus in elite maize germplasm

Mark Jung et al
(1) DuPont Crop Genetics, Experimental Station, P.O. Box 80353, Wilmington, DE 19880-0353, USA

... 1). Gene locations were defined by several methods. Annotations provided in Tikhonov et al. (1999) were first used, then FGENESH gene-finding software ...


DNA Sequence - The Journal of Sequencing and Mapping
Issue: Volume 15, Number 4 / August, 2004 Pages: 269 - 276

Isolation, Characterization and Expression Analysis of a Leaf-specific Phosphoenolpyruvate Carboxylase Gene in Oryza sativa

Chang-Fa Lin et al
State Key Laboratory of Genetic Engineering Institute of Genetics, School of Life Sciences, Fudan University Shanghai 200433 P.R.China

... tools of GeneMark (http://opal. biology.gatech.edu/geneMark/) and Softberry (http://www.softberry.com). For the isolation of putative ...


Nature Genetics
36, 40 - 45 (01 Jan 2004)

Complete sequencing and characterization of 21,243 full-length human cDNAs

Ota et al.


...PSORT II, http://psort.ims.u-tokyo.ac.jp/; DIGIT, http://digit.ims.u-tokyo.ac.jp; FGENESH, http://www.softberry.com/berry.phtml; GENSCAN, http://genes.mit.edu/GENSCAN.html; HMMGENES, http://www.cbs.dtu.dk/services/HMMgene/; HUNT...


Plant Molecular Biology
Issue: Volume 54, Number 4 Date: March 2004 Pages: 519 - 532

Genome-Wide Analysis of the GRAS Gene Family in Rice and Arabidopsis

Chaoguang Tian1, Ping Wan1, Shouhong Sun1, Jiayang Li1 and Mingsheng Chen1*
(1) Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 100101, China

... database. FGENESH (Salamov and 90 Solovyev, 2000) was used for gene prediction. ... pre- 207 dicted by FGENESH (minor discrepancies exist due 208 ...


Mycological Research
(2004), 108: 853-857 Cambridge University Press

Combining transcriptome data with genomic and cDNA sequence alignments to make confident functional assignments for Aspergillus nidulans genes

Andrew H. SIMS a1, Manda E. GENT a1, Geoffrey D. ROBSON a1, Nigel S. DUNN-COLEMAN a2 and Stephen G. OLIVER a1c1
a1 School of Biological Sciences, University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, UK.

... Kingdom. Page 2. Genewise, FGENESH, FGENESH+) consisting of 9541 putative open reading frames (ORFs) was released in June 2003. We ...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 1 Date: June 2004 Pages: 129 - 139

Gene content and density in banana (Musa acuminata) as revealed by genomic sequencing of BAC clones

R. Aert1, 2, L. Sagi2 and G. Volckaert1
(1) Laboratory of Gene Technology, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, 3001 Leuven, Belgium Present address: Laboratory of Tropical Crop Improvement, Katholieke Universiteit Leuven, (2) Kasteelpark Arenberg 13, 3001 Leuven, Belgium

... gsc.riken.go.jp), FGENESH version 1.1 (Salamov and Solovyev 2000; http://www.softberry. com), genemark.hmm version 2.2a (Lukashin and Borodovsky 1998; http ... Genome Research 14:2503-2509, 2004


EAnnot: A genome annotation tool using experimental evidence


Li Ding et al
Genome Sequencing Center, Washington University School of Medicine, St. Louis, Missouri 63110, USA

...Some ab initio programs, such as Genscan (Burge and Karlin 1997 ) and FGENESH (Salamov and Solovyev 2000 ) are based on intrinsic characteristics of coding sequence (e.g., codon usage, consensus splice sites, etc.) and require training on known genes from the organism...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 7 Date: November 2004 Pages: 1434 - 1447

Full-genome analysis of resistance gene homologues in rice

B. Monosi1, R. J. Wisser2, L. Pennill1 and S. H. Hulbert1
(1) Department of Plant Pathology, Kansas State University, Manhattan, KS 66506-5502, USA
(2) Department of Plant Pathology, Cornell University, Ithaca, NY 14853, USA


... DNA sequences were analyzed using the gene prediction programs GENSCAN (Burge and Karlin 1997; http://genes.mit.edu/GENSCAN.html) and FGENESH (Salamov and ...


arXiv:q-bio.GN/0402046 v1 27 Feb 2004


Sublinear growth of Information in DNA sequences

Giulia Menconi
Dipartimento di Matematica Applicata and C.I.S.S.C. Centro Interdisciplinare per lo Studio dei Sistemi Complessi Universit`a di Pisa Via Bonanno Pisano 25/b 56126 PISA - Italy

...As a result, four putative genes G1, G2, G3 and G4 have been located by means of Hidden Markov Model-based program FGENESH2 that has been created for predicting multiple genes and their structure in genomic DNA sequences. The analysis via FGENESH has been exploited with respect to known genes in Arabidopsis thaliana. Their predicted position is illustrated in Figure 13. ...2This program is available at the website www.softberry.com to which we refer con-cerning the reliability and e_ciency of the algorithm....


Current Opinion in Plant Biology
2004, 7:732-736

Consistent over-estimation of gene number in complex plant genomes

Jeffrey L Bennetzen1,4, Craig Coleman2,7, Renyi Liu1,5, Jianxin Ma1,6 and Wusirika Ramakrishna3,8
1 Department of Genetics, University of Georgia, Athens, Georgia 30602, USA

...We have found that the standard gene-discovery programs FGENESH, GeneMark and GENSCAN annotate segments of most retrotransposons and many invertedrepeat transposable elements as genes. Using FGENESH to annotate maize BAC clones, for instance, 70-100% of the predicted genes are actually from transposable elements...


The Plant Cell
16:2795-2808 (2004)

Spotted leaf11, a Negative Regulator of Plant Cell Death and Defense, Encodes a U-Box/Armadillo Repeat Protein Endowed with E3 Ubiquitin Ligase Activity

Li-Rong Zeng et al
a Department of Plant Pathology, Ohio State University, Columbus, Ohio 43210

... in spl11. Exons predicted in G3 by the programs GENSCAN and FGENESH using different matrixes are displayed in dark gray. (D) RFLP ...


Human Genomics,
Volume 1, Number 2, January 2004, pp. 146-149(4)

The truth about mouse, human, worms and yeast

Authors: David R. Nelson1; Daniel W. Nebert2
1: Department of Molecular Sciences and The UT Center of Excellence in Genomics and Bioinformatics, University of Tennessee, Memphis, Tennessee 38163, USA 2: Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, Ohio 45267-0056, USA

... unpublished data, 2003; see also Ref. [7]), FGENESH, 21 TWINSCAN 22 and the Ensembl annotation pipeline. 23 The output of the four ...


Genome Biology
2004, 5:R73 doi:10.1186/gb-2004-5-10-r73

A comprehensive transcript index of the human genome generated using microarrays and computational approaches

Eric E Schadt et al
1Rosetta Inpharmatics LLC, 12040 115th Avenue NE, Kirkland, WA 98034, USA

...GrailEXP 4.0 [47], GENSCAN 1.0 [48], FGENESH [49], and FGENESH+ [49]ab initio gene-prediction algorithms were run independently across the entire genome assembly to augment alignment-based gene identification methods...


Genome Research
14:988-995, 2004

GeneWise and Genomewise

Ewan Birney1,3, Michele Clamp2 and Richard Durbin2
1 The European Bioinformatics Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK; 2 The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK


...There has been a long history of successful ab initio programs which do not use any additional evidence to predict genes on genomic DNA, of which Genscan (Burge and Karlin 1997 ) and FGENESH (Solovyev and Salamov 1997 ) are two of the most successful cases....
...Another class of evidence-based gene prediction programs are ones which use external evidence to influence the scoring of potential exons, including SGP-2 (Parra et al. 2003 ), Genie (Kulp et al. 1996 ), Genomescan (Yeh et al. 2001 ), HMMGene (Krogh 2000 ), and FGENESH++ (Solovyev and Salamov 1997 )...


PNAS
February 17, 2004 vol. 101 no. 7 1910-1915

Type I MADS-box genes have experienced faster birth-and-death evolution than type II MADS-box genes in angiosperms

Jongmin Nam et al
Institute of Molecular Evolutionary Genetics and Department of Biology, Pennsylvania State University, University Park, PA 16802

...Because annotation of rice gene was still in progress at the time of this study, we ourselves conducted gene annotation by using the computer program FGENESH (www.softberry.com) from the genome sequences obtained from TIGR and the Rice Genome Database (China) (25).


Functional & Integrative Genomics
Issue: Volume 4, Number 2 Date: May 2004 Pages: 102 - 117

Sequence analysis of the long arm of rice chromosome 11 for rice-wheat synteny

Nagendra K. Singh et al.,
Indian Initiative for Rice Genome Sequencing, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India

... Wherever RiceGAAS data were not available, the genes were predicted by FGENESH trained for monocot plant species (http:// www.softberry.com/berry.phtml). ...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 1 Date: June 2004 Pages: 10 - 22

Annotation of a 95-kb Populus deltoides genomic sequence reveals a disease resistance gene cluster and novel class I and class II transposable elements

M. Lescot et al
1. Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology, Ghent University, Technologiepark 927, 9052 Gent, Belgium

... 1999; http://www.tigr.org/tdb/glimmerm/glmr_form.html), and FGENESH for dicots or monocots (Salamov and Solovyev 2000; http://www.softberry.com/). ...


BIOINFORMATICS,
2004 vol.20 N.9 p.1416-1427
J Yuan, B Bush, A Elbrecht, Y Liu, T Zhang, W Zhao ... -

... suchasGRAIL(Lopezetal., 1994; Roberts, 1991; Uberbacher et al., 1996), GENESCOPE (Murakami and Takagi, 1998), FGENESH (Salamov and Solovyev, 2000), GeneMark ...


Molecular Plant Pathology
Volume 5 Issue 6 Page 515 - November 2004

Heading for disaster: Fusarium graminearum on cereal crops

RUBELLA S. GOSWAMI AND H. CORBY KISTLER

... This pipeline uses a combination of the programs FGENESH and FGENESH+ (Salamov and Solovyev, 2000) modified by Softberry ( http:/ / www.softberry.com ) with ...


Nucleic Acids Research
2004, Vol. 32, Database issue D41-D44

MIPS: analysis and annotation of proteins from whole genomes

H. W. Mewes et al
1 Institute for Bioinformatics (MIPS), GSF National Research Center for Environment and Health, Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany and 2 Technische Universitat Munchen, Chair of Genome Oriented Bioinformatics, Center of Life and Food Science, D-85350 Freising-Weihenstephan, Germany

... The genome of 40 Mb encodes 10 000 proteins automatically predicted by the program FGENESH (http://softberry. com), specifically trained for Neurospora. ...


Annual Review of Genomics and Human Genetics
Vol. 5: 15-56 (Volume publication date September 2004)

COMPARATIVE GENOMICS


Webb Miller, Kateryna D. Makova, Anton Nekrutenko, and Ross C. Hardison
The Center for Comparative Genomics and Bioinformatics, The Huck Institutes of Life Sciences, and the Departments of Biology, Computer Science and Engineering, and Biochemistry and Molecular Biology, Pennsylvania State University, University Park, Pennsylvania

... These algorithms include Genscan, the most popular gene prediction tool (24), GenMark (117), FGENESH (155), GeneID (144), and others (for an excellent overview ...


DNA and Cell Biology
May 2004, Vol. 23, No. 5: 311-324

Harbinger Transposons and an Ancient HARBI1 Gene Derived from a Transposase

Vladimir V. Kapitonov , Jerzy Jurka
Genetic Information Research Institute, Mountain View, California.

... We used FGENESH (Salamov and Solovyev, 2000) and GeneScan (Burge and Karlin, 1997) for the identification of exons and introns. The d N /d S ratio, ...


Nucleic Acids Research
2004, Vol. 32, Database issue D377-D382

BGI-RIS: an integrated information resource and comparative analysis workbench for rice genomics

Wenming Zhao et al
1 Beijing Genomics Institute (BGI), Chinese Academy of Sciences (CAS), Beijing Airport Industrial Zone-B6, Beijing 101300, China

... The contig sequences were annotated for gene content by using automated processes that involve ab initio gene finders, such as FGENESH (http://www.softberry.com ...


Genome Research
14:1932-1937, 2004

Characterization of the Maize Endosperm Transcriptome and Its Comparison to the Rice Genome

Jinsheng Lai et al
1 Waksman Institute, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854, USA;

... A total of 54,397 putative genes could be predicted for the rice genome from this data set (Table 3) using the FGENESH program with the default setting for ...


Plant Molecular Biology
Issue: Volume 54, Number 1 Date: January 2004 Pages: 55 - 69

Dynamics of the evolution of orthologous and paralogous portions of a complex locus region in two genomes of allopolyploid wheat

Xiu-Ying Kong1, 2, Yong Qiang Gu3, Frank M. You4, Jorge Dubcovsky4 and Olin D. Anderson3
1. Genetic Resources Conservation Program, University of California, Davis, CA 95616, USA
2. Institute of Crop Germplasm Resources, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
3. U.S. Dept. of Agriculture, Western Regional Research Center, Agricultural Research Service, 800 Buchanan Street, Albany, CA 94710, USA
4. Department of Agronomy and Range Sciences, University of California, Davis, CA 95616, USA

... FGENESH (http://www.softberry.com/berry.phtml) and GENES- CAN (http://genemark. mit.edu/GENESCAN.html) were used for gene prediction. ...


Current Genetics
Issue: Volume 44, Number 6 Date: January 2004 Pages: 329 - 338

Chromosome rearrangements in isolates that escape from het-c heterokaryon incompatibility in Neurospora crassa

Qijun Xiang1 and N. Louise Glass1
Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720-3102, USA

... Hypothetical proteins are predicted from FGENESH calls with overlapping Blastx hits (but not with trusted homology), while Predicted ...


Molecular Genetics and Genomics
Issue: Volume 271, Number 4 Date: May 2004 Pages: 402 - 415

Genome-wide identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR NBS-LRR genes

T. Zhou et al
1. State Key Laboratory of Pharmaceutical Biotechnology, Department of Biology, Nanjing University, 210093 Nanjing, China

... to 5000-10,000 bp from both ends of the hits, and then the expanded nucleotide fragments were reannotated using the gene-finding programs FGENESH (http:// www ...


Proc Natl Acad Sci U S A.
2004 June 15; 101(24): 9045-9050.

Genetic control of branching in foxtail millet

Andrew N. Doust et al
*Department of Biology, University of Missouri, 8001 Natural Bridge Road, St Louis, MO 63121; and ‡John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom

... Each of these contigs was scanned by using FGENESH (28), and identified ORFs were translated and compared with ORFs from other contigs from the same QTL region ...


Mol. Biol. Evol.
21(9):1769-1780. 2004

Merlin, a New Superfamily of DNA Transposons Identified in Diverse Animal Genomes and Related to Bacterial IS1016 Insertion Sequences

Cedric Feschotte1
Departments of Plant Biology and Genetics, The University of Georgia, Athens

... coding sequences were assembled by removing introns predicted with more than 85% confidence by NetGene2 (http://www.cbs.dtu.dk) and/or FGENESH (http://genomic ...


Genome Research
14:1924-1931 ©2004

Gene Loss and Movement in the Maize Genome

Jinsheng Lai et al
1Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854-8020, USA; 2Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907-1392, USA

... The FGENESH program predicted four, of which three (gene 1d in the maize orp1 region; gene 5a, 5b in the rice r1 region) would produce truncated proteins ...


Internal Medicine Journal
Volume 34 Issue 3 Page 79 -90 - March 2004

Systematic genome-wide approach to positional candidate cloning for identification of novel human disease genes

H. Kiyosawa et al
Affiliations: 1Technology and Development team for Mammalian Cellular Dynamics, Bioresource Center, RIKEN Tsukuba Institute, Tsukuba, Ibaraki

...Page 1. Internal Medicine Journal 2004; 34: 79-90. O RIGINAL A RTICLE. Systematic genome-wide approach to positional candidate. cloning ...


Molecular Microbiology
Volume 54 Issue 2 Page 407 - October 2004

Cryptococcus neoformans Kin1 protein kinase homologue, identified through a Caenorhabditis elegans screen, promotes virulence in mammals

Eleftherios Mylonakis et al
1Division of Infectious Diseases, Massachusetts General Hospital, Boston, MA 02114, USA.

... Sequences were compared with the H99 genome database at Duke University, and genes predicted in these regions by FGENESH software ( http:/ / www.softberry.com ...


TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 5 Date: March 2004 Pages: 903 - 913

Characterization of soybean genomic features by analysis of its expressed sequence tags

Ai-Guo Tian et al
1. Plant Biotechnology Laboratory, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, 100101 Beijing, China

... six BAC-contig sequences of M. truncatula were analyzed and the results based on the gene prediction program FGENSH (Arabidopsis match/FGENESH prediction) (http ...


Current Proteomics,
Volume 1, Number 1, January 2004, pp. 41-48(8)

Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins

McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK

... The polymorphic 'hypothetical transcriptome' was cons- tructed from transcripts predicted by FGENES, FGENESH (Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...


Chinese Science Bulletin
2004 Vol. 49 No. 4 355-362

The VER2 promoter contains repeated sequences and requires vernalization for its activity in winter wheat (Triticum aestivum L.)

XU Wenzhong et al
1. Research Center for Molecular Developmental Biology, Key Lab of Photosynthesis and Environmental Molecular Physiology, Institute of Botany, Chinese Academy of Sciences (CAS), Beijing 100093, China;

... Sequence analyses were finished using biological softwares on Internet, such as FGENESH 1.0 (Prediction of potential genes in Plant (Dct) genomic DNA). ...


TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 3 Date: February 2004 Pages: 392 - 400

Sequence variations of simple sequence repeats on chromosome-4 in two subspecies of the Asian cultivated rice

Can Li1, Yu Zhang1, Kai Ying1, Xiaolei Liang1 and Bin Han1
(1) National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China

... To characterize the possible relationship between SSRs and genes predicted by using FGENESH, we investigated the distribution of SSRs in the rice chromosome-4 ...


Proc Natl Acad Sci U S A.
2004 June 29; 101(26): 9885-9890.

Long-range patterns of diversity and linkage disequilibrium surrounding the maize Y1 gene are indicative of an asymmetric selective sweep

Kelly Palaisa,* Michele Morgante, Scott Tingey, and Antoni Rafalski*
DuPont Crop Genetics, Molecular Genetics Group, 1 Innovation Way, Newark, DE 19711; *Department of Plant and Soil Sciences and Delaware Biotechnology Institute, University of Delaware, Newark, DE 19716

... The Y1 gene comprises a small uninterrupted gene island consisting of the Y1, an MLO homolog lying immediately downstream of Y1, and an FGENESH-predicted gene ...


TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 8 Date: May 2004 Pages: 1449 - 1457

Positional cloning of the rice Rf-1 gene, a restorer of BT-type cytoplasmic male sterility that encodes a mitochondria-targeting PPR protein

H. Akagi et al
1. Laboratory of Plant Breeding and Genetics, Department of Biological Production, Faculty of Bioresource Sciences, Akita Prefectural University, Kaidoubata-Nishi 241-7, Shimoshinjyo-Nakano, 010-0195 Akita, Japan

... Software Develop- ment, Tokyo). Genomic sequences were also analyzed using gene prediction programs, genescan and FGENESH. Table 1 DNA ...


Genome Research
14:942-950, 2004

The Ensembl Automatic Gene Annotation System

Val Curwen et al
1 The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK; 2 EMBL European Bioinformatics Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UK; 3 The Broad Institute, Cambridge, Massachusetts 02141, USA

... Commonly, we use Genscan for ab initio prediction in human, mouse, and rat, but the system is equally applicable to other methods such as FGENESH (Solovyev et ...


Gene
324 (2004) 105-115

Transcript abundance of rml1, encoding a putative GT1-like factor in rice, is up-regulated by Magnaporthe grisea and down-regulated by light

Rong Wang a,b, Guofan Honga,b, Bin Hana,*
National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China

... 1A and 2A). The structure of rml1 _ a is as same as that predicted by FGENESH software. The 3V UTR of rml1 _ a is confirmed with the length of 596 bp. ...


Genome Biology
2004, 5:R46 doi:10.1186/gb-2004-5-7-r46

Identification of conserved gene structures and carboxy-terminal motifs in the Myb gene family of Arabidopsis and Oryza sativa L. ssp. Indica

Cizhong Jiang1, Xun Gu1, 2 and Thomas Peterson1
1Department of Genetics, Development and Cell Biology, and Department of Agronomy, Iowa State University, Ames, IA 50011, USA
2LHB Center for Bioinformatics and Biological Statistics, Iowa State University, Ames, IA 50011, USA

... FGENESH has been used successfully to predict genes in rice [9], and GenScan was used together with it to predict genes by taking rice genomic sequences as ...


Molecular Microbiology
53 (5), 1307-1318. - September 2004

The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans

Donald M. Gardiner et al
1School of Botany, The University of Melbourne, Victoria, Australia 3010.

... http:/ / www.tigr.org . Putative genes were predicted using FGENESH software at http:/ / www.softberry.com. Fungal culture. The wild type ...


Journal of Molecular Evolution
Issue: Volume 59, Number 6 Date: December 2004 Pages: 761 - 770

Analysis of the Molecular Evolutionary History of the Ascorbate Peroxidase Gene Family: Inferences from the Rice Genome

Felipe Karam Teixeira1, Larissa Menezes-Benavente1, Rogerio Margis1, 2 and Marcia Margis-Pinheiro1
(1) Laboratorio de Genetica Molecular Vegetal, Departamento de Genetica, UFRJ, 21944-970 Rio de Janeiro, Brasil
(2) Departamento de Bioquimica, Instituto de Quimica, UFRJ, 21944-970 Rio de Janeiro, Brasil

... Genomic se- quences were also analyzed in the FGENESH gene structure pre- diction program (http://www.softberry.com/) (Solovyev 2001) and GeneMark program (http ...


Journal of Biotechnology
109 (2004) 217-226

Preparation of single rice chromosome for construction of a DNA library using a laser microbeam trap

Xiaohui Liu et al
A National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200233, China

... ers. These sequences were further annotated using gene-prediction software FGENESH to give the pos- sible protein-coding region. ...


Science
2004, 303: 1364-1367.

Medicago truncatula DMI1 Required for Bacterial and Fungal Symbioses in Legumes

Ane et al. (2004).

... 17. HK Choi et al., Genetics, in press. 18. FGENESH, see www.softberry.com/berry. phtml. 19. E. Bornberg-Bauer, E. Rivals, M. Vingron, Nucleic Acids Res. ...


Proc Natl Acad Sci U S A.
2004 August 24; 101(34): 12404-12410.

Inaugural Articles
Rapid recent growth and divergence of rice nuclear genomes

Jianxin Ma and Jeffrey L. Bennetzen*
Department of Genetics, University of Georgia, Athens, GA 30602

... Almost all LTR-retrotransposons, including solo LTRs, identified in our studies were predicted as genes by the gene-finding program FGENESH (data not shown). ...


The Plant Journal
Volume 37 Issue 4 Page 517 -527 - February 2004

Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein

Xinli Sun, Yinglong Cao, Zhifen Yang, Caiguo Xu, Xianghua Li, Shiping Wang* and Qifa Zhang
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China

... al., 1997). Gene prediction programs used were genscan (Burge and Karlin, 1997) and FGENESH (http://www.softberry.com). Promoter ...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 3 Date: August 2004 Pages: 515 - 522

Physical mapping and putative candidate gene identification of a quantitative trait locus Ctb1 for cold tolerance at the booting stage of rice

K. Saito1 , Y. Hayano-Saito1, W. Maruyama-Funatsuki1, Y. Sato1 and A. Kato1
(1) National Agricultural Research Center for Hokkaido Region, Hitsujigaoka 1 , Toyohira, Sapporo, Hokkaido, 062-8555, Japan

... GENSCAN , RICEHMM , FGENESH , MZEF ), a splice prediction program ( SPLICEPREDIC- TOR ), homology search analysis programs ( BLAST , HMMER , ...


TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 4 Date: August 2004 Pages: 690 - 699

The anthracnose resistance locus Co-4 of common bean is located on chromosome 3 and contains putative disease resistance-related genes

M. Melotto1, 4 , M. F. Coelho1, A. Pedrosa-Harand2, J. D. Kelly3 and L. E. A. Camargo1
1. Departamento de Fitopatologia, Laboratorio de Genetica Molecular, ESALQ, Universidade de Sao Paulo, Piracicaba, SP, C.P. 9, 13418-900, Brazil

... and Karlin 1997; http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www. softberry.com/)-using Arabidopsis as the model or- ganism. ...


Journal of Genetics,
Vol. 83, No. 1, P. 79-99, April 2004

Structural and functional analysis of rice genome

Tyagi A. K. et al
Department of Plant Molecular Biology, University of Delhi South Campus, Benito Juarez Road, New Delhi 110 021, India

... It inte- grates results from several gene prediction software such as GENSCAN (Burge and Karlin 1997), FGENESH (Sala- mov and Solovyev 2000), RiceHMM (Sakata ...


The Plant Cell
16:1220-1234 (2004)

Comparative Analysis of the Receptor-Like Kinase Family in Arabidopsis and Rice

Shin-Han Shiua, et al
a Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637

... a permissive E value cutoff of 1. The rice genes from the indica subspecies was predicted using the whole genome shotgun assembly with FGENESH (Solovyev, 2002 ...


Genome Research
14:1474-1482 (2004) © by Cold Spring Harbor Laboratory Press ISSN 1088-9051/04;

Incongruent Patterns of Local and Global Genome Size Evolution in Cotton

Corrinne E. Grover,1 HyeRan Kim,2 Rod A. Wing,2 Andrew H. Paterson,3 and Jonathan F. Wendel1,4
1Department of Ecology, Evolution, and Organismal Biology, Iowa State University, Ames, Iowa 50011, USA; 2Arizona Genomics Institute, University of Arizona, Tucson, Arizona 85721, USA; 3Plant Genome Mapping Laboratory, University of Georgia, Athens, Georgia 30602, USA

... Potential genes were predicted by three independent programs: FGENESH (http://www.softberry.com/), ...


Plant Physiology,
May 2004, Vol. 135, pp. 459-470

Rapid Genome Evolution Revealed by Comparative Sequence Analysis of Orthologous Regions from Four Triticeae Genomes

Yong Qiang Gu*, Devin Coleman-Derr, Xiuying Kong and Olin D. Anderson
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California 94710 (Y.Q.G., D.C.-D., O.D.A.); and Institute of Crop Germplasm Resources, Chinese Academy of Agricultural Sciences, Beijing 100081 China (X.K.)
... FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark. mit.edu/GENESCAN.htm) were used for gene prediction. ...


Plant Physiology,
October 2004, Vol. 136, pp. 3177-3190

Comparative Sequence Analysis of the Region Harboring the Hardness Locus in Barley and Its Colinear Region in Rice1

Katherine S. Caldwell2, Peter Langridge and Wayne Powell*
Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, United Kingdom (K.S.C., W.P.); and School of Agriculture and Wine (K.S.C., P.L.) and Australian Centre for Plant Functional Genomics (P.L.), University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia

... jp/; Sakata et al., 2002 ), which couples the integration of several programs for the prediction of open reading frames (GENSCAN, RiceHMM, FGENESH, MZEF) with ...


GENES & DEVELOPMENT
18:687-699, 2004

pyramus and thisbe: FGF genes that pattern the mesoderm of Drosophila embryos

Angelike Stathopoulos1, Bergin Tam1, Matthew Ronshaugen1, Manfred Frasch2 and Michael Levine1
1 Department of Molecular and Cell Biology, Division of Genetics & Development, University of California, Berkeley, California 94720-3204, USA; 2 Brookdale Department of Molecular Cell and Developmental Biology, Mount Sinai School of Medicine, New York, New York 10029, USA

... FGF protein sequences used in alignment and phylogenetic reconstruction were gathered from GenBank or inferred from genomic sequence using GENESCAN (Burge and Karlin 1997) and FGENESH...


Genome Research
14:1888-1901, 2004

Organization and Evolution of a Gene-Rich Region of the Mouse Genome: A 12.7-Mb Region Deleted in the Del(13)Svea36H Mouse

Ann-Marie Mallon et al
1 Medical Research Council Mammalian Genetics Unit, Harwell, Oxfordshire, United Kingdom; 2 Wellcome Trust Sanger Institute, Hinxton Genome Campus, United Kingdom; 3 Medical Research Council Rosalind Franklin Centre for Genomics Research, Hinxton Genome Campus, United Kingdom

... Ab initio gene structures were predicted using FGENESH (Salamov and Solovyev 2000) and GENSCAN...


Current Proteomics,
January 2004, vol. 1, no. 1, pp. 41-48(8)

Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins

Authors: McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
Affiliations: 1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK.

... The polymorphic 'hypothetical transcriptome' was cons- tructed from transcripts predicted by FGENES, FGENESH ( Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...


Plant Physiology
, 2004

A Genome-Wide Screen Identifies Genes Required for Centromeric Cohesion

JJ Doyle, J Denarie, F Debelle, JC Prome, BB Amor, ...

... 17. HK Choi et al., Genetics, in press. 18. FGENESH, see www.softberry.com/berry.phtml. 19. E. Bornberg-Bauer, E. Rivals, M. Vingron, Nucleic Acids Res. ...


Proc Natl Acad Sci U S A.
2003 July 22; 100(15): 9055-9060.

Gene expression of a gene family in maize based on noncollinear haplotypes

Rentao Song and Joachim Messing*
Waksman Institute, Rutgers, The State University of New Jersey, 190 Frelinghuysen Road, Piscataway, NJ 08854-8020

.. The FGENESH program (Softberry, Mount Kisco, NY) was used for gene prediction analysis.


Fungal Genetics and Biology
Volume 39, Issue 1, June 2003, Pages 31-37

Analysis of loss of pathogenicity mutants reveals that repeat-induced point mutations can occur in the Dothideomycete Leptosphaeria maculans

Alexander Idnurm and Barbara J. Howlett
School of Botany, The University of Melbourne, Vic. 3010, Australia

... A 6088 bp sequence was obtained (GenBank AF525231) and an open reading frame of 529 amino acids was predicted with FGENESH software (www.softberry.com) with no ...


The Journal of Experimental Biology
206, 1275-1289 (2003) doi: 10.1242/jeb.00261

Conservation of ecdysis-triggering hormone signalling in insects

Zitnan et al.,
1 Institute of Zoology, Slovak Academy of Sciences, Dubravska cesta 9, 84206 Bratislava, Slovakia 2 Institute of Medical Chemistry and Biochemistry, School of Medicine, Comenius University, Sasinkova 2, 81108 Bratislava, Slovakia

... The complete genomic sequence of the putative Anopheles eth gene was identified using the Softberry FGENESH gene prediction program (Salamov and Solovyev, 2000 ...


BMC Genomics.
2003; 4: 22.

Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

Sreedhar Oduru et al
1Department of Cell Biology & Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas. USA

... Two gene prediction programs were used FGENESH http://www.softberry.com/berry.phtml and GENEMARK http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi?org=H ...


Insect Molecular Biology
Volume 12 Issue 4 Page 319 - August 2003

Expression of an Aedes aegypti cation-chloride cotransporter and its Drosophila homologues

V. Filippov, K. Aimanova and S. S. Gill
Affiliations. Department of Cell Biology and Neuroscience, University of California, Riverside, USA

... significant similarity to the Drosophila genes were used for gene structure prediction with the FGENESH program available on site http:/ / www.softberry.com . ...


Developmental Biology
256 (2003) 276-289

tcl-2 encodes a novel protein that acts synergistically with Wnt signaling pathways in C. elegans

Xiaojun Zhao,a Hitoshi Sawa,b and Michael A. Hermana,*
a Program in Molecular, Cellular and Developmental Biology, Division of Biology, Kansas State University, Manhattan, KS, 66506, USA
b Laboratory for Cell Fate Decision, RIKEN, Center for Developmental Biology 2-2-3 Minatojima-minamimachi Chuo-ku, Kobe 650-0047, Japan

...CbTCL-2 is conceptually translated from a gene predicted by the FGENSH (Salamov and Solovyev, 2000; http://www.softberry.com) using defaults for C. elegans genomic sequences.


Proc Natl Acad Sci U S A.
2003 May 27; 100(11): 6569-6574.

Molecular paleontology of transposable elements in the Drosophila melanogaster genome

Vladimir V. Kapitonov* and Jerzy Jurka*
Genetic Information Research Institute, 2081 Landings Drive, Mountain View, CA 94043

...We used FGENESH (ref. 18; www.softberry.com) for identifying genes encoded by TEs.


Genetics and Molecular Biology
ISSN 1415-4757 version impresa Genet. Mol. Biol. v.26 n.4 Sao Paulo dic. 2003

Iron homeostasis related genes in rice

Jeferson GrossI, II; Ricardo Jose SteinII; Arthur Germano Fett-NetoI, II; Janette Palma FettI, II
IUniversidade Federal do Rio Grande do Sul, Centro de Biotecnologia, Porto Alegre, RS, Brazil

...The prediction algorithms were GenScan (Burge and Karlin, 1997; http://genes.mit.edu/GENSCAN.html), GenomeScan (Burge and Karlin, 1997; http://genes.mit.edu/genomescan.html), FGENESH (Salamov and Solovyev, 2000; http://www.softberry.com/berry.phtml?topic= gfind), GeneMark.hmm (Borodovsky and Lukashin, unpublished; http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi) and GrailEXP (Xu and Uberbacher, 1997; http://compbio.ornl.gov/grailexp/)...


BMC Plant Biology
2003, 3:6

Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L)

Qian-Hao Zhu1,2, Mohammad Shamsul Hoque1,2, Elizabeth S Dennis1,2 and Narayana M Upadhyaya*1,2
Address: 1CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia and 2NSW Agricultural Genomics Centre, Wagga Wagga, Australia

... Analyses of 10-kb sequence of the ~30-kb contig 239 from the China Rice Genome database harboring the BFL1 locus by gene prediction programs FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN... ..The ORF was identified by using FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html.


Australasian Plant Pathology
Volume 32 Number 4 2003 pp. 511-519

Small scale functional genomics of the blackleg fungus, Leptosphaeria maculans: analysis of a 38 kb region

Alexander Idnurm, Janet L. Taylor, M. Soledade C. Pedras and Barbara J. Howlett

... vertebrate and Arabidopsis settings; Burge and Karlin 1997) and FGENESH on Neurospora crassa and Schizosaccharomyces pombe settings (www.softberry.com), as ...


Barley Genetics Newsletter
Volume 32 Hard-copy edition pages 34 - 37

MAPPING AND SEQUENCING OF THE BARLEY PUTATIVE HYPERSENSITIVE INDUCED REACTION GENES

Nils Rostoks1, David Kudrna1 and Andris Kleinhofs1,2
1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164
2 School of Molecular Biosciences, Washington State University, Pullman, WA 99164

The full length coding sequence was reconstructed using a combination of FGENESH gene prediction program (http://www.softberry.com/) and alignment with cDNAs from the other barley HIR groups.


TAG Theoretical and Applied Genetics
Issue: Volume 43, Number 5 Date: August 2003 Pages: 351 - 357

Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans

Anton J. Cozijnsen A1 and Barbara J. Howlett A1
A1 School of Botany The University of Melbourne 3010 Victoria Australia

...Genes, introns, exons and transcription initiation sites were predicted by analysis with FGENESH (www.softberry.com) on Neurospora crassa and...


BMC Plant Biol.
2003; 3: 6.

Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L)

Qian-Hao Zhu et al
1CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia
2NSW Agricultural Genomics Centre, Wagga Wagga, Australia

...Analyses of 10-kb sequence of the ~30-kb contig 239 from the China Rice Genome database harboring the BFL1 locus by gene prediction programs FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html identified a single-exon gene capable of encoding a protein with the DNA binding domain of the EREBP/AP2 family of plant transcription factors [26,36], 1515 bp downstream from the Ds insertion. .. The ORF was identified by using FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html. Alignment of EREBP/AP2 domains was performed using programs of Genetics Computer Group Wisconsin software suit [11].


Genetics,
Vol. 164, 655-664, June 2003, Copyright © 2003

Map-Based Cloning of Leaf Rust Resistance Gene Lr21 From the Large and Polyploid Genome of Bread Wheat

Li Huang et al
a Wheat Genetics Resource Center, Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506-5502

...In addition, FGENSH 1.1 (http://www.softberry.com) was used for gene prediction (with monocot genomic DNA parameters).


Nucleic Acids Research,
2003, Vol. 31, No. 1 229-233

The TIGR rice genome annotation resource: annotating the rice genome and creating resources for plant biologists

Qiaoping Yuan et al
The Institute for Genomic Research, 9712 Medical Center Dr., Rockville, MD 20850, USA

...The rice sequences were processed with multiple ab initio gene finders including FGENESH (http://www.softberry.com),... ... Working models were generated using the FGENESH output and putative identification for the gene was obtained from the most significant database match while models with no significant database match were labeled as hypothetical proteins.


Journal of Experimental Botany
, Vol. 54, No. 389, pp. 1995-1996, August 1, 2003

OsSET1, a novel SET-domain-containing gene from rice

Yun-Kuan Liang et al
PKU-Yale Joint Research Center of Agricultural and Plant Molecular Biology, National Key Laboratory of Protein Engineering and Plant Gene Engineering, College of Life Sciences, Peking University, 5 Yiheyuan Road, Beijing 100871, PR China

... It localizes at chromosome three in rice genome at the contig 1300 (http://www.softberry.com/berry.phtml?topic=gfind&prg=FGENESH; GenBank accession number ...


BMC Genomics
2003, 4:22

Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

Sreedhar Oduru et al
Address: 1Department of Cell Biology & Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas. USA

...Two gene prediction programs were used FGENESH http://www.softberry.com/berry.phtml and GENEMARK http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi?org=H.sapiens


TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 5 Date: March 2004 Pages: 903 - 913

Characterization of soybean genomic features by analysis of its expressed sequence tags

Ai-Guo Tian et al
Plant Biotechnology Laboratory, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, 100101 Beijing, China Beijing Genomics Institute, Chinese Academy of Sciences, 101300 Beijing, China

... prediction of these BAC-contig sequences was based on the gene-prediction program FGENSH (Arabidopsis match/FGENESH


Nucleic Acids Research
2002, Vol. 30, No. I 31-34

MIPS: a database for genomes and protein sequences

 Morgenstern, M Munsterkotter, S Rudd,  Weil

... mewes@gsf.de. ACKNOWLEDGEMENTS We thank V. Solovyev (Softberry Inc., NY) for providing and tuning the FGENSH program. This work was ...


Molecular Plant-Microbe Interactions
February 2002, Volume 15, Number 2 Pages 120-128 DOI: 10.1094/MPMI.2002.15.2.120

CPR1: A Gene Encoding a Putative Signal Peptidase That Functions in Pathogenicity of Colletotrichum graminicola to Maize

M. R. Thon, E. M. Nuckles, J. E. Takach, and L. J. Vaillanc
Department of Plant Pathology, S-305 Agricultural Sciences Center-North, University of Kentucky, Lexington 40546-0091, U.S.A.

... on-line from The Sanger Center's Computational Genomics Group); and a version of FGENESH trained on N. crassa sequences (available on-line from Softberry, Inc ...


Fungal Genetics and Biology
Volume 36, Issue 3, August 2002, Pages 234-241

Size and complexity of the nuclear genome of the ectomycorrhizal fungus Paxillus involutus

Quere, Tomas Johansson and Anders Tunlid
Department of Microbial Ecology, Lund University, Ecology Building, S-223 62, Lund, Sweden

... gatech.edu/GeneMark/), the GlimmerM (www.tigr.org/softlab/glimmerm/), the ORF finder (www.ncbi.nlm.nih.gov/gorf/), and the FgeneSH (www.softberry.com/nucleo ...


Drug discovery today
Vol. 7, No. 11 (Suppl.), 2002, S70-S76 www.drugdiscoverytoday.com

Genome annotation techniques: new approaches and challenges

Alistair G. Rust Emmanuel Mongin and *Ewan Birney
European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus Hinxton Cambridge UK CB10 1SD

... Examples of such prediction programs include Genscan [14] (used by Celera, ORNL and Ensembl), FGENESH [15] (used in the Softberry and UCSC browsers as well as ...
Box 1. Useful human genome annotation and browser URLs Human genome browsers
o UCSC Human Genome Browser: http://genome.cse.ucsc.edu/cgi-bin/hgGateway/
o Softberry Genome Explorer: http://www.softberry.com/berry.phtml?topic=genomexp
Ab initio gene prediction programs. Ab initio gene predictors rely on the statistical qualities of exons rather than on homologies. Examples of such prediction programs include Genscan [14] (used by Celera, ORNL and Ensembl), FGENESH [15] (used in the Softberry and UCSC browsers as well as Celera's pipeline) and GrailEXP [16] (ORNL).


Proc Natl Acad Sci U S A.
2002 August 20; 99(17): 11423-11428.

Identification of G protein-coupled receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-receptor coevolution

Yoonseong Park,* Young-Joon Kim*, and Michael E. Adams*,
Departments of *Entomology and Cell Biology and Neuroscience, 5429 Boyce Hall, University of California, Riverside, CA 92521

...For each Drosophila GPCR, prediction of gene structure was made in FGENESH (www.softberry.com; ref. 21) by using about 20 kb of genomic sequence surrounding highly conserved regions, particularly for 5 prime and 3 prime ends of ORFs. Putative Drosophila GPCRs in the database were amplified by RT-PCR using primers based on gene predictions in the FGENESH gene finder (www.softberry.com; ref. 21). 21. Salamov A. A. & Solovyev, V. V. (2000) Genome Res. 10, 516-522....


Eukaryotic Cell,
October 2002, p. 719-724, Vol. 1, No. 5

Isocitrate Lyase Is Essential for Pathogenicity of the Fungus Leptosphaeria maculans to Canola (Brassica napus)

Alexander Idnurm and Barbara J. Howlett*
School of Botany, The University of Melbourne, Melbourne, Victoria 3010, Australia

... The DNA sequence obtained was compared to those in the GenBank database by using BLAST (1), and genes were predicted by using FGENESH software (http://www.softberry.com) and GENSCAN (www.bionavigator.com).


Biotech Software & Internet Report
November 2002, 3(5-6): 151-153. doi:10.1089/152791602321105834.

News

... sequence data. The genes are identified with the FGENESH11 gene modeling software exclusively li- censed from Softberry, Inc. Automatic ...


Genome
2002 Oct;45(5):963-72.
Analysis of 106 kb of contiguous DNA sequence from the D genome of wheat reveals high gene density ...

SA Brooks, L Huang, BS Gill, JP Fellers
Department of Plant Pathology, Kansas State University, Manhattan 66506, USA.

... trix. In addition, FGENESH 1.1 (http://www.softberry.com) was used for CDS prediction with monocot genomic DNA parameters. Both ...


Molecular Genetics and Genomics
Issue: Volume 267, Number 6 Date: August 2002 Pages: 713 - 720

Genome sequencing of a 239-kb region of rice chromosome 10L reveals a high frequency of gene duplication and a large chloroplast DNA insertion

Q. Yuan, J. Hill, J. Hsiao, K. Moffat, S. Ouyang, Z. Cheng, J. Jiang, C. Buell
A1 The Institute for Genomic Research, 9712 Medical Center Drive, Rockville, MD 20850, USA
A2 Department of Horticulture, University of Wisconsin, Madison, WI 53706, USA

... The sequences were analyzed with several gene prediction programs, including FGENESH (http://www.softberry.com), Genemark.hmm (rice matrix; http://opal.biology ...


Genetics,
Vol. 162, 1389-1400, November 2002, Copyright © 2002

Different Types and Rates of Genome Evolution Detected by Comparative Sequence Analysis of Orthologous Segments From Four Cereal Genomes

Wusirika Ramakrishna et al
a Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907,

FGENESH (http://www.softberry.com/nucleo.html) with the maize training set was used for gene prediction in addition to GENSCAN (http://genes.mit.edu/GENSCAN.html) and GeneMark.hmm (http://genemark.biology.gatech.edu/Gene Mark/).


Nature
420, 316 - 320 (21 November 2002) | doi:10.1038/nature01183

Sequence and analysis of rice chromosome 4

Feng et al
National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China Chinese National Human Genome Center at Shanghai, 351 Guo Shoujing Road, Shanghai 201203, China

FGENESH used for annotation of rice chromosome 4.


Functional & Integrative Genomics
Issue: Volume 2, Numbers 1-2 Date: May 2002 Pages: 51 - 59

Genomic sequencing reveals gene content, genomic organization, and recombination relationships in barley

Nils Rostoks et al
A1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164, USA

... version 1.0 with maize parameters. The FGENESH predictions were run at http://www.softberry.com/. BAC genomic regions were defined ...


Genome
2003 Dec;46(6):1084-97
Structural organization of the barley D-hordein locus in comparison with its orthologous regions of wheat genomes
Gu et al.,
United States Department of Agriculture, Agriculture Research Service, Western Regional Research Center, Albany, CA 94710, USA

... et al. 1997) to search for additional genes. In addition, FGENESH (http://www.softberry.com/berry.phtml) and. GENESCAN (http://genes ...


PNAS
July 9, 2002 vol. 99 no. 14 9328-9333

The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases

R. Brueggeman et al
* Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420; Department of Plant Pathology, 495 Borlaug Hall, 1991 Upper Buford Circle, St. Paul, MN 55108-6030; and School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4234

.. The gene prediction programs GENSCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com), as well as NEURAL NETWORK PROMOTER PREDICTION (http://www.fruitfly.org/seq_tools/promoter.html) localized the putative transcription start site of the gene about 400 bp upstream of the translation start site.


Plant Physiol.
2002 December; 130(4): 1626-1635.

Contiguous Genomic DNA Sequence Comprising the 19-kD Zein Gene Family from Maize1

Rentao Song and Joachim Messing*
Waksman Institute, Rutgers, The State University of New Jersey, 190 Frelinghuysen Road, Piscataway, New Jersey 08854-8020

.. Draft sequences generated from high-throughput DNA sequencing (phase II) were subjected to gene prediction programs with FGENESH (Softberry, Inc., Mount Kisco, NY).


The Plant Cell,
Vol. 14, 3213-3223, December 2002,

Structural Analysis of the Maize Rp1 Complex Reveals Numerous Sites and Unexpected Mechanisms of Local Rearrangement

Wusirika Ramakrishnaa, John Embertona, Matthew Ogdena, Phillip SanMiguelb and Jeffrey L. Bennetzen1,a
a Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907
b Purdue University Genomics Core, Purdue University, West Lafayette, Indiana 47907

... FGENESH (http://www.softberry.com/berry.phtml) with the monocot training set was used for gene prediction, in addition to GENSCAN (http://genes.mit.edu/GENSCAN ...


Plant Physiol.
2002 December; 130(4): 1728-1738.

Comparative Sequence Analysis of the Sorghum Rph Region and the Maize Rp1 Resistance Gene Complex

Wusirika Ramakrishna, John Emberton, Phillip SanMiguel, Matthew Ogden, Victor Llaca, Joachim Messing, and Jeffrey L. Bennetzen
Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907 (W.R., J.E., M.O., J.L.B.); Purdue University Genomics Core, Purdue University, West Lafayette, Indiana 47907 (P.S.M.); and Waksman Institute, Rutgers University, Piscataway, New Jersey 08854 (V.L., J.M.)

...Annotation and sequence analysis were performed as described earlier (Dubcovsky et al., 2001 ; Song et al., 2001 ; Ramakrishna et al., 2002a ). FGENESH (http://www.softberry.com/berry.phtml) with the monocot training set was used for gene prediction in addition to GENSCAN (http://genes.mit.edu/GENSCAN.html) and GeneMark.hmm (http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi).


Rapid Genome Evolution Revealed by Comparative Sequence Analysis of Orthologous Regions from Four ...

YQ Gu, D Coleman-Derr, X Kong, OD Anderson

... FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark. mit.edu/GENESCAN.htm) were used for gene prediction. ...


Nature
419, 755 - 755 (17 Oct 2002) Technology Feature

Putting a name on it

Marina Chicurel

...used in the landmark publications of the draft human genome sequence. FGENESH, produced by software firm Softberry of Mount Kisco, New York, proved particularly useful for the Syngenta-led annotation of the rice genome sequence. Good...


FGENESH_GC

PLoS ONE
2012, 7(9): e44264. doi:10.1371/journal.pone.0044264

Identification and Sequence Analysis of Metazoan tRNA 3?-End Processing Enzymes tRNase Zs.

Wang et al.,
Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, Nanjing, China

... The splicing pattern was verified using the Fgenesh and Fgenesh_GC programs provided at the Softberry website (http://linux1.softberry.com/berry.phtml??topic=fgenesh). ...


BMC Evolutionary Biology
2011, 11:219 doi:10.1186/1471-2148-11-219

A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2

Fan et al.,
1 Laboratory of Yeast Genetics and Molecular Biology, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China 2 Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China

...The splicing pattern was verified using the FGENESH and FGENESH_GC programs provided at the Softberry website...


Gene
Volume 451, Issues 1-2, 1 February 2010, Pages 6-14 doi:10.1016/j.gene.2009.08.018

Expression and regulation of IL-22 by bovine peripheral blood g/d T cells

Shi-Dong Ma, Cheryl A. Lancto, Shinichiro Enomoto, Mitchell S. Abrahamsen and Mark S. Rutherford
Department of Veterinary and Biomedical Sciences, University of Minnesota, 1988 Fitch Avenue, Room 295 AS/VM, St. Paul, MN 55108, USA

.. Genomic structure was deduced using FGENSH_GC program at http://www.softberry.com/berry. phtml?topic=fgeneshgc&group=programs&subgroup=gfind, and cDNA-genomic nucleotide sequences were aligned using Blast2 at http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2 ..


FGENES

Nucleosides, Nucleotides and Nucleic Acids
Volume 32, Issue 10, 2013 pages 529-554 DOI:10.1080/15257770.2013.832773

Gene Identification Programs in Bread Wheat: A Comparison Study

Nasiri et al.,
a Department of Agronomy and Plant Breeding, Division of Molecular Plant Genetics, College of Agricultural & Natural Resources , University of Tehran , Karaj , Tehran , Iran b Department of Plant Biotechnology, College of Agricultural & Natural Resources , University of Tehran , Karaj , Tehran , Iran

... Ab initio gene finding in Drosophila genomic DNA. Genome Res., 10: 391–393. [CrossRef], [PubMed] View all references ] is an HMM-based variant of Fgenes that can be easily utilized online at softberry web server (http://linux1.softberry.com/berry.phtml). ...


Developmental & Comparative Immunology
Volume 34, Issue 2, February 2010, Pages 114-122 doi:10.1016/j.dci.2009.08.011

Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes

Francisco Gambon-Deza a, b, Christian Sanchez-Espinelb, 1, and Susana Magadan-Mompoc, 2,
a Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain b Shared Unity of Immunology, University of Vigo - Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As Lagoas-Marcosende, Vigo 36310, Pontevedra, Spain

... immunoglobulin mRNAs. Limits of antibodies that were not yet published were deduced following the instructions in the software FGENES (www.softberry.com) and Augustus (http://augustus.gobics.de/submission). The results ... 


J Mol Diagn.
2010 Jul;12(4):520-4. Epub 2010 May 27

Comprehensive characterization of a novel intronic pseudo-exon inserted within an e14/a2 BCR-ABL rearrangement in a patient with chronic myeloid leukemia

Sorel et al.,
Service Service d'Hematologie et Oncologie Biologique - INSERM U935, Centre Hospitalier Universitaire de Poitiers, 2, rue de la Miletrie, 86021 Poitiers Cedex, France.

... Georgia Institute of Technology, Atlanta, GA; version 3.0; 2005; available at http://exon.gatech. edu/GeneMark/; accessed October 14, 2009), 6 and FGENES (SoftBerry, Mount Kisco, NY; 2007; available at http://linux1.softberry.com/berry.phtml; accessed October 14, 2009 ... 


Molecular Immunology
Volume 46, Issue 13, August 2009, Pages 2515-2523

The immunoglobulin heavy chain locus in the platypus (Ornithorhynchus anatinus)

F. Gambon-Deza, C. Sanchez-Espinel and S. Magadan-Mompo
aUnity of Inmunology, Vigo University Hospital Complex (CHUVI), Carretera de Madrid s/n., 36210 Vigo, Pontevedra, Spain bArea of Immunology, Faculty of Biology, University of Vigo, Department of Biochemistry, Genetics and Immunology, Rua das Abeleiras, Campus As Lagoas-Marcosende, 36310 Vigo, Pontevedra, Spain

... Limits of antibodies that were not yet published (IGHD and IGHY) were deduced following the instructions in the software FGENES (www.softberry.com) and Augustus (http://augustus.gobics. de/submission) together with the results obtained upon comparison with the reptilian ...


Developmental & Comparative Immunology
Volume 34, Issue 2, February 2010, Pages 114-122

Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes

F. Gambon-Deza, C. Sanchez-Espinel and S. Magadan-Mompo
a Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain

... immunoglobulin mRNAs. Limits of antibodies that were not yet published were deduced following the instructions in the software FGENES (www.softberry.com) and Augustus (http://augustus.gobics.de/submission). The results ...


Food and Chemical Toxicology
Volume 46, Issue 4, April 2008, Pages 1249-1256

SULT1C3, an orphan sequence of the human genome, encodes an enzyme activating various promutagens

Walter Meinl, Claudia Donath, Heiko Schneider Yasmin Sommer and Hansruedi Glat
German Institute of Human Nutrition (DIfE) Potsdam-Rehbru"cke, Department of Nutritional Toxicology, Arthur-Scheunert-Allee 114-116, 14558 Nuthetal, Germany

... SULT1 genes. No BLAST hit was observed for exon 4. It was found with the FGENES algorithm (hosted by http://www.softberry.com). Its ...


Acta Phytopathologica et Entomologica Hungarica
Volume 43, Number 1/June 2008 pp. 1-13

Cloning and characterization of a HOG-type MAP kinase encoding gene from Fusarium proliferatum

A. L. Adam, G. Kohut, L. Hornok
Szent Istvan University Agricultural Biotechnology Center, Mycology Group of the Hungarian Academy of Sciences, Institute of Plant Protection Pater K. u. 1 H-2103 Godollo Hungary

... Se- quence data were analyzed with the Lasergene (DNAStar Inc., USA) software package and the FGENES program (http://www.softberry.com). ...


Plant Pathology
Volume 57 Issue 5, Pages 861 - 869 Published Online: 21 Mar 2008

Peroxidases in the early responses of different potato cultivars to infection by Potato virus YNTN

M. Milavec, K. Gruden, M. Ravnikar, M. Kovac
National Institute of Biology, Vecna pot 111, 1000 Ljubljana, Slovenia

... Intron/exon structure of the gene was determined using FGENES 1·0, available online from SoftBerry (http://www.softberry.com/berry.phtml). ...


J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006

Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*

Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and INSERM, U784, 75230 Paris, France

... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify potential first exons and/or splice donor sites. Signal ...


Cellular & Molecular Biology Letters
Volume 11, Number 2 / June, 2006 pp. 214-229

En/Spm-like transposons in Poaceae species: Transposase sequence variability and chromosomal distribution

Ahu Altinkut, Olga Raskina, Eviatar Nevo and Alexander Belyayev
Institute of Evolution, University of Haifa, Mt. Carmel, Haifa, 31905, Israel

... The TPase open reading frame was assembled by removing introns using the FGENES 2.0 Program (http://www.softberry.com/berry.phtml?topic=fgenesh&group ...


Neuron
Volume 50 (2006), Issue 5, Pages 683-695

The Myotomal diwanka (lh3) Glycosyltransferase and Type XVIII Collagen Are Critical for Motor Growth Cone Migration

V. Schneider, M. Granato
University of Pennsylvania School of Medicine, Department of Cell and Developmental Biology, Philadelphia, Pennsylvania 19104

... Open reading frames within the diwanka interval were predicted with Genscan (http://genes.mit.edu/GENSCAN.html) and Fgenes (http://www.softberry.com/berry.phtml ...


Bioinformatics
2005 21(9):1776-1781; doi:10.1093/bioinformatics/bti283

Gene finding for the helical cytokines

Darrell Conklin 1,*, Betty Haldeman 2 and Zeren Gao 2
1Department of Computing, City University London, United Kingdom
2ZymoGenetics Inc. Seattle, USA

... For comparison purposes, three other gene finding methods were also run on the same dataset: Fgenes v1.6 (Solovyev et al., 1994), Genscan v1.0 (Burge and Karlin ...


Genes, Chromosomes and Cancer
Volume 43, Issue 1 , Pages 83 - 94 Published Online: 18 Feb 2005

Molecular cloning and characterization of FBXO47, a novel gene containing an F-box domain, located in the 17q12 band deleted in papillary renal cell carcinoma

Barbara Simon-Kayser et al
1Laboratoire d'Etude du Polymorphisme de l' ADN, Faculte de Medecine, Nantes, France

... html), GrailExp (http://grail.Isd.ornl.gov/grailexp), Fgenes (http://genomic.sanger. ac.uk/gf/gf.shtml), and Genmark (http://www2.ebi.ac.uk/genemark). ...


Journal of Neurobiology
Volume 63, Issue 3 , Pages 235 - 254 Published Online: 4 Mar 2005

Shaw potassium channel genes in Drosophila

James J. L. Hodge 1 2, James C. Choi 2, Cahir J. O'Kane 1 *, Leslie C. Griffith 2
1Department of Genetics, University of Cambridge, Downing Site, Cambridge CB2 3EH, United Kingdom
2Department of Biology and Volen Center for Complex Systems, Brandeis University MS008, 415 South Street, Waltham, Massachusetts 02454-9110

... Intron/exon structure of Shawl was initially predicted using the Fgenes program (Salamov and Solovyev, 2000) on the Baylor College of Medicine Genefinder ...


Current Proteomics,
January 2004, vol. 1, no. 1, pp. 41-48(8)

Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins

Authors: McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
Affiliations: 1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK.

... The polymorphic 'hypothetical transcriptome' was cons- tructed from transcripts predicted by Fgenes, FGENESH (Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...


Nature Biotechnology
22, 1146 - 1149

5'-end SAGE for the analysis of transcriptional start sites

Hashimoto et al. (2004)..

...from expressed sequence tag (EST) maps, analysis of full-length cDNAs and computational annotation by Genscan, Genie, Fgenes and other programs.


Hemoglobin
Volume 28, Number 3 / 2004 255 - 259

An a-Thalassemia Phenotype in a Dutch Hindustani, Caused by a New Point Mutation that Creates an Alternative Splice Donor Site in the First Exon of the a2-Globin Gene

Cornelis L. Harteveld A1, Pierre W. Wijermans A2, Peter van Delft A1, Ellen Rasp A2, Hans L. Haak A2, Piero C. Giordano A1
A1 Hemoglobinopathies Laboratory, Leiden University Medical Center, PO Box 9503, 2300, Leiden, The Netherlands
A2 Leyenburg Hospital, The Hague, The Netherlands

... and GRAIL/ gap2 (Gene Recognition and Assembly Internet Link, Sequence exploration and gene discovery Version 1.3), Genefinder, GENSCAN, Fgenes and HMMGene ...


Journal of Medical Genetics
2004;41:e52

Genomic organisation of the UDP-N-acetylglucosamine-1-phosphotransferase gamma subunit (GNPTAG) and its mutations in mucolipidosis III

A Raas-Rothschild et al
1 Department of Human Genetics, Hadassah University Medical Center, Jerusalem, Israel

... third intron is 9 kb. This structure was consistent with the exon prediction of fgenes and Genscan. Each splice donor and acceptor ...


Current Biology
2004, Volume 14, Issue 19, Pages R832-R833

Dual capacity of a human olfactory receptor

M. Spehr, K. Schwane, S. Heilmann, G. Gisselmann, T. Hummel, H. Hatt

... (B) RT-PCR with intron spanning primers. Candidates for 5'UTR exons were identified using FGENES and FEX software (SoftBerry, Mount Kisco, NY). ...


FGENES-M

Molecular Biology Reports
Volume 40, Issue 2 , pp 1201-1210 DOI: 10.1007/s11033-012-2162-2

Characterization of a vacuolar zinc transporter OZT1 in rice (Oryza sativa L.)

Lan et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, People’s Republic of China

... genome database in GenBank with tblastn program. The identified homologous sequence was further analyzed for predicting the complete ORF with FGENES-M program (http://www.softberry.com). To verify the accuracy of gene ...


Molecular Biology Reports
Volume 36, Number 2 / February, 2009, pp. 281-287, DOI:10.1007/s11033-007-9177-0

Cloning and functional identification of two members of the ZIP (Zrt, Irt-like protein) gene family in rice (Oryza sativa L.)

Xia Yang 1, Ji Huang 1, Yan Jiang 1 and Hong-Sheng Zhang 1
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China

... of China through tBLASTn algorithm program. The cDNA sequences of two putative rice ZIP genes with a complete ORF were assembled using FGENES-M program (http://www.softberry.com). Accord- ing to the predicted sequence ...


Molecular Biology Reports
Volume 35, Number 2 / June 2008 pp. 145-152

Molecular cloning and characterization of a novel SNAP25-type protein gene OsSNAP32 in rice ( Oryza sativa L.)

Yong-Mei Bao, Jian-Fei Wang, Ji Huang and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China

... The genome organization and chromo- some mapping of the OsSNAP32 were investigated by the software FGENES-M at Softberry (http://www.softberry. ...


Molecular Genetics and Genomics
Volume 279, Number 3 / March, 2008 Pages 291-301

Cloning and characterization of three genes encoding Qb-SNARE proteins in rice

Yong-Mei Bao1, Jian-Fei Wang1, Ji Huang1 and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China

... The genome organization of three OsNPSNs were investigated using FGENES-M software (http://www.softberry.com/berry.phtml) by comparing the cloned cDNAs with ...


Gene
Volume 415, Issues 1-2, 31 May 2008, Pages 1-12

Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses

Zhimin Gu et al.,
State key lab of crop genetics and germplasm enhancement, Nanjing Agricultural University, Nanjing, 210095, PR China College of Chemistry and Life Science, Zhejiang Normal University, Jinhua, 321004, PR China

... Fgenes-M (http://www.softberry.com), Genscan (http://genes.mit.edu/GENSCAN.html), BlastP (http://www.ncbi.nlm.nih.gov/BLAST/), National Centre for ...


Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 4, April 2007, Pages 220-227

A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a role in salt tolerance

Ji Huang1, a, Xia Yang1, a, Mei-Mei Wang2, a, Hai-Juan Tanga, Ling-Yun Dinga, Yin Shena and Hong-Sheng Zhang, a,
aState Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China

... probe sequence. The putative ORFs for these sequences were predicted with FGENES-M program (http://www.softberry.com). ZFP182, one ...


BMC Bioinformatics.
2005; 6: 25.

Integrating alternative splicing detection into gene prediction

Sylvain Foissac1 and Thomas Schiex1
1Unite de Biometrie et Intelligence Artificielle, INRA, 31326 Castanet Tolosan, France

..This approach has been applied eg. in HMMgene or in FGENES-M (unpub.)...


Molecular Biology Reports
Volume 32, Number 3 / September, 2005 pp.177-183

Rice ZFP15 Gene Encoding for a Novel C2H2-type Zinc Finger Protein Lacking DLN box, is Regulated by Spike Development but not by Abiotic Stresses

Ji Huang1, Jianfei Wang1 and Hongsheng Zhang1
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Rice Research Institute, Nanjing Agricultural University, Nanjing, 210095, China

... sequence. These sequences were analyzed with FGENES-M program (http://www. softberry.com) for predict- ing the complete ORFs. The ...


DNA Sequence - The Journal of Sequencing and Mapping
Volume 15, Number 1 / February 2004 39 - 43

Isolation and Characterization of Two cDNAs Encoding Translation Initiation Factor 1A from Rice(Oryza sativa L.)

Ji Huang, Jianfei Wang, Shengping Qiu, Hongsheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement Rice Research Institute Nanjing Agricultural University 210095 Nanjing People's Republic of China

... Then the ORF without introns was assembled based on the sequence of each scaffold using the program FGENES-M (http://www. softberry.com). ...


Plant Science
Volume 169, Issue 3, September 2005, Pages 470-477

Cloning and characterization of a novel rice gene family encoding putative dual-specificity protein kinases, involved in plant responses to abiotic and biotic stresses

Zhimin Gu, Jianfei Wang, Ji Huang and Hongsheng Zhang
National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Department of Agronomy, Nanjing 210095, China

... genomic contigs having higher homology with the probe were obtained for prediction and assembling of putative ORFs by FGENES-M program (http://www.softberry.co


FGENESH-M

BMC plant biology
(2013). 13(1), 176. DOI:10.1186/1471-2229-13-176

An apple MYB transcription factor, MdMYB3, is involved in regulation of anthocyanin biosynthesis and flower development

Vimolmangkang, S., Han, Y., Wei, G., & Korban, S. S.
1 Department of Natural Resources and Environmental Sciences, University of Illinois, 1201 W. Gregory, Urbana, IL 61801, USA 2 Department of Pharmacognosy, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand

... Recovery of cDNA sequence encoding MdMYB3 in apple The genomic sequences encoding MdMYB3 were analyzed using FGENESH-M program (http://www. softberry. com), and an open reading frame (ORF) was predicted. ...


J. Exp. Bot.
(2012) 63 (1): 471-488. doi: 10.1093/jxb/err295

Two SERK genes are markers of pluripotency in Cyclamen persicum Mill.

Savona et al.,
1‘Sapienza’ University of Rome, Dept. of Environmental Biology, Rome, Italy 2‘Sapienza’ University of Rome, Dept. of Biology and Biotechnology, Rome, Italy

... programs (http://www.expasy.org/prosite/). ORFs were found with FGENESH-M (fgenesh-m; http://linux1.softberry.com/berry.phtml?topic=fgenesh-m&group= programs&subgroup=gfind). Phylogenetic analysis was performed by ...


Med. Chem. Commun.
2012,3, 987-996 DOI: 10.1039/C2MD20029E

Comparative analysis of the biosynthetic systems for fungal bicyclo[2.2.2]diazaoctane indole alkaloids: the (+)/(?)-notoamide, paraherquamide and malbrancheamide pathways

Shengying Li et al.,

... Phq protein). a Genes were predicted using the FGENESH-M tool from http://www.softberry.com; functions of gene products were predicted using BLAST search.b -: Homology cannot be calculated due to unrelatedness. NotA ...


J. Proteome Res.
2011, 10 (10), pp 4478–4504 DOI: 10.1021/pr200284e

Genomics, Transcriptomics, and Peptidomics of Daphnia pulex Neuropeptides and Protein Hormones

Dircksen et al.,
Department of Zoology, Stockholm University, Sweden Institute of Zoology, University of Cologne, Cologne, Germany Department of Biology, K.U. Leuven, Belgium

... More detailed analyses and novel annotations of genes, their exon-intron boundaries were performed usually with aid of Fgenesh-M gene finding tools (Softberry Inc., Mount Kisco, NY; http://linux1.softberry.com/berry.phtml?topic=fgenesh-m&group=programs&subgroup=gfind ...


Biochemical and Biophysical Research Communications
Volume 354, Issue 3, 16 March 2007, Pages 668-675

Sp-tetraKCNG: A novel cyclic nucleotide gated K+ channel

Blanca Estela Galindo, Jose Luis de la Vega-Beltran, Pedro Labarca, Victor D. Vacquier and Alberto Darszon
Depto. de Genetica del Desarrollo y Fisiologia Molecular del Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo Postal 510-3, Cuernavaca, Morelos 62271, Mexico

... 3?-RACE was performed to obtain the 3?-end, and the 5?-end (684 nucleotides) was predicted by FGENESH-M, a program at the Softberry website (http://www ...


DNA Sequence - The Journal of Sequencing and Mapping
Volume 17, Number 1 / February 2006 pp. 24 - 30

Isolation and characterization of a new Na+/H+ antiporter gene OsNHA1 from rice (Oryza sativa L.)

Zhou et al.,
Nanjing Agricultural University, State key laboratory of crop genetics and germplasm enhancement, Nanjing, 210095, China

... An expected cDNA sequence containing a complete open reading frame (ORF) was predicted using FGENESH-M program (http://www.softberry. ...


BESTORF

BMC Genomics
2013, 14:695 doi:10.1186/1471-2164-14-695

Histoplasma yeast and mycelial transcriptomes reveal pathogenic-phase and lineage-specific gene expression profiles

Edwards et al.,
1 The Department of Microbiology, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA 2 The Department of Microbial Infection and Immunity, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA

... Separately, the RNA-seq short reads were assembled into transcript contigs de novo (ie, independent of the reference genome sequence) using Inchworm [39] and open reading frames extracted from the transcripts with BestORF (Molquest package, Softberry). ...


PloS one
September 02, 2013DOI: 10.1371/journal.pone.0073560

Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

Vanessa Rodrigues Paixao-Cortes, Francisco Mauro Salzano, Maria Catira Bortolini
Departamento de Genetica and Programa de Pos-Graduacao em Genetica e Biologia Molecular, Instituto de Biociencias, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil

... The genomic sequences of possible unannotated orthologs were verified using three programs that can predict open reading frames (ORF): BESTORF (http://linux1.softberry.com/berry.phtml?? topic=bestorf&group=programs&subgroup=gf?ind), GeneWise (http://www.ebi.ac.uk ...


Nature Biotechnology
30, 549–554 (2012) doi:10.1038/nbt.2195

Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential

Zhang et al.,
BGI-Shenzhen, Chinese Ministry of Agriculture, Key Lab of Genomics, Shenzhen, China.

... Open reading frames (ORFs) were predicted using BESTORF (http://linux1.softberry.com/berry.phtml?topic=bestorf&group=programs&subgroup=gfind) with parameters trained on monocot genes without filtering of UTRs. ...


Phytopathology
August 2012, Volume 102, Number 8 Pages 741-748 http://dx.doi.org/10.1094/PHYTO-02-12-0021-R

Role of the Pathotype-Specific ACRTS1 Gene Encoding a Hydroxylase Involved in the Biosynthesis of Host-Selective ACR-Toxin in the Rough Lemon Pathotype of Alternaria alternata

Izumi et al.,
Faculty of Agriculture, Kagawa University, Miki, Kagawa 761-0795 Japan; Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430.

... Shimadze, Tsukuba, Japan). Putative open reading frames (ORFs) were identified using BESTORF (http://linux1.softberry. com/berry.phtml) from the sequence of the respective contigs by mass sequencing. Transcripts of ACRTS1 ...


Fungal Genetics and Biology
Volume 49, Issue 6, June 2012, Pages 470–482 DOI: 10.1016/j.fgb.2012.04.001

Transcriptome analysis of enriched Golovinomyces orontii haustoria by deep 454 pyrosequencing

We?ling et al.,
a Max-Planck-Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, Carl-von-Linne-Weg 10, 50829 Cologne, Germany b Max-Planck-Institute for Molecular Genetics, Ihnestrasse 63-73, D-14195 Berlin-Dahlem, Germany

... Open reading frames were predicted from these contigs using BestORF with the Sclerotinia sclerotiorum matrix (Softberry, Mount Kisco, NY, USA). Predicted proteins were then annotated by Blast2Go (Conesa et al. 2005) using default parameters. ...


PLoS Pathog
8(4): e1002643. doi:10.1371/journal.ppat.1002643

Sequential Delivery of Host-Induced Virulence Effectors by Appressoria and Intracellular Hyphae of the Phytopathogen Colletotrichum higginsianum.

Kleemann et al.,
Department of Plant-Microbe Interactions, Max-Planck-Institute for Plant Breeding Research, Cologne, Germany Central Microscopy Max-Planck-Institute for Plant Breeding Research, Cologne, Germany

...ORFs were predicted from EST contigs with the Fusarium matrix of BESTORF (Molquest package, Softberry). ...


Nature
479, 529–533 (24 November 2011) doi:10.1038/nature10553

Ascaris suum draft genome

Jex et al.,
Faculty of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia BGI-Shenzhen, Shenzhen, 518083, China

...The open reading frame of each gene was predicted using BestORF (http://www.softberry.com). ...


PLoS ONE
2011, 6(2): e14697. doi:10.1371/journal.pone.0014697

ENCODE Tiling Array Analysis Identifies Differentially Expressed Annotated and Novel 5? Capped RNAs in Hepatitis C Infected Liver.

Folkers et al.,
Department of Medicine, University of Utah, Salt Lake City, Utah, United States of America Huntsman Cancer Institute, University of Utah, Salt Lake City, Utah, United States of America

...The use of a sequence analysis tool (BESTORF, www.softberry.com) to predict potential coding fragments in these unannotated sequences,...


MAKARA OF SCIENCE SERIES,
VOL 15, NO 2 (2011)

ISOLATION, CLONING AND CHARACTERIZATION OF ACTIN-ENCODING CDNAS FROM JATROPHA CURCAS L. IP-2P

Ratna Yuniati, Utut Widyastuti, Didy Sopandie, Akiho Yokota, Suharsono

... tool) (http://www.ncbi.nlm.nih. gov/BLAST/) program. The analysis of open reading frame (ORF) was carried out by using BESTORF program (http://www.softberry/bestorf/ htm). Phylogenetic analyses were conducted using MEGA ...


Appl. Comput. Math.
V.9, Special Issue, 2010, pp. 19-33

POSSIBLE FUNCTIONAL AND EVOLUTIONARY ROLE OF PLASTID DNA INSERTIONS IN RICE GENOME

YAGUT YU. AKBAROVA 1,2, VICTOR V. SOLOVYEV 3, ILHAM A. SHAHMURADOV 1
1 Bioinformatics Laboratory, Institute of Botany, Baku AZ1073, Azerbaijan 2 College of Medicine and Health Sciences, Sultan Qaboos University, Muscat, Sultanate of Oman 3 Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20, UK

... of amino acid sequences has been carried out by BLAST program [1]. Search for statistically significant open reading frames (ORFs) and putative target compartments of proteins were done by BESTORF and ProtComp programs, respectively (http://www.softberry.com). ... 


BMC Genomics.
2010 Jul 8;11:422

Comparative analysis of secreted protein evolution using expressed sequence tags from four poplar leaf rusts (Melampsora spp.)

Joly DL, Feau N, Tanguay P, Hamelin RC.
Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du PEPS, P,O, Box 10380, Stn, Sainte-Foy, Quebec, QC, G1V 4C7, Canada.

... gene models. Initial ORF prediction for Melampsora spp. was generated with the bestORF algorithm (Softberry) using Ustilago parameters. Sequence analysis Similarity searches for full length sequences and conserved domains were performed ...


Molecular Vision
2009; 15:2544-2553

Phenotypic characterisation and ZEB1 mutational analysis in posterior polymorphous corneal dystrophy in a New Zealand population

Vincent et al.,
1Department of Ophthalmology, New Zealand National Eye Centre, Faculty of Medical and Health Science, University of Auckland, Auckland, New Zealand; 2Ophthalmology Department, Greenlane Clinical Centre, Auckland District Health Board, Auckland, New Zealand

... Prediction of potential coding fragment in the reference mRNA (NM_0030751.4) sequence containing the c.1A?G was performed using the BESTORF program (Softberry.Inc, Mount Kisco, NY), and predicted translation initiation at nucleotide 788 which encodes the methionine ...


BMC Evolutionary Biology
2009, 9:97 doi:10.1186/1471-2148-9-97

Identification, distribution and molecular evolution of the pacifastin gene family in Metazoa

Bert Breugelmans, Gert Simonet, Vincent van Hoef, Sofie Van Soest, Jozef, Vanden Broeck
Department of Animal Physiology and Neurobiology, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000 Leuven, Belgium

... presence of a signal peptide were predicted using BESTORF (http://www.softberry.com) and SignalP (http://www.cbs.dtu.dk/services/SignalP/), respectively. ... If no complete ORF was found, the Softberry splice finder tool (FSPLICE) was used to search the missing ...


FEBS Journal
Volume 275 Issue 6 Page 1103-1117, March 2008

Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae– involvement of the mitochondrial FAD transporter, Flx1p

Teresa A. Giancaspero 1, Robin Wait 2, Eckhard Boles 3, Maria Barile
1 Dipartimento di Biochimica e Biologia Molecolare "E. Quagliariello", Universita degli Studi di Bari, Italy 2 Kennedy Institute of Rheumatology Division, Faculty of Medicine, Imperial College London, UK 3 Institut fu"r Molekulare Biowissenschaften, J.W. Goethe-Universitat, Frankfurt am Main, Germany

... Both the NCBI tool orf finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and the bestorf gene prediction program from Softberry Inc. ...


Microbiology
154 (2008), 1204-1217; DOI 10.1099/mic.0.2007/014944-0

Identification of soluble secreted proteins from appressoria of Colletotrichum higginsianum by analysis of expressed sequence tags

Jochen Kleemann, Hiroyuki Takahara, Kurt Stu"ber and Richard O'Connell
Max-Planck-Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, D-50829 Koln, Germany

... different reading frame. BESTORF (Softberry) was used to confirm the ORF of selected unique sequences. Proteins were considered ...


GENES & DEVELOPMENT
21:708-718, 2007

Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay

Julie Z. Ni et al.,
Center for Molecular Biology of RNA and Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz, Santa Cruz, California 95064, USA

... Once the transcripts are predicted, an ORF finder (BESTORF from Softberry, http://www.softberry.com) is used to find the best ORF. ...


Eukaryotic Cell, March 2005,
p. 526-535, Vol. 4, No. 3

Sex-Specific Homeodomain Proteins Sxi1 and Sxi2a Coordinately Regulate Sexual Development in Cryptococcus neoformans

Christina M. Hull,1, Marie-Josee Boily,1 and Joseph Heitman1,2*
Department of Molecular Genetics and Microbiology,1 the Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina2

... Sequence manipulations. Splice predictions of candidate gene sequences for SXI2a were facilitated with a Softberry algorithm (www.softberry.com). ...
...We utilized the BESTORF gene prediction algorithm from Softberry, Inc., to electronically produce predicted spliced cDNA products encoded by a 10-kb region....


SPL

Molecular and Cellular Endocrinology
Volume 348, Issue 1, 2 January 2012, Pages 313–321

Two novel mutations in the thyroglobulin gene as cause of congenital hypothyroidism: Identification a cryptic donor splice site in the exon 19

Hector M. Targovnik et al.,
a Laboratorio de Biologia Molecular, Catedra de Genetica y Biologia Molecular, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires, 1113 Buenos Aires, Argentina b Unidad de Medicina Molecular, Departamento de Medicina, Facultad de Medicina, Universidad de Salamanca, 37007 Salamanca, Spain c Service d’Endocrinologie Pediatrique, Hopital des Enfants, Centre Hospitalier Universitaire de Toulouse, 31059 Toulouse Cedex 9, France

... Searching for potential 5?ss sequences in the TG gene spanning exon 19 and intron 19 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html), Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind), SPL ...


Genome
2011, 54(12): 1041-1044, DOI: 10.1139/g11-068

Isolation of a strawberry gene fragment encoding an actin depolymerizing factor-like protein from genotypes resistant to Colletotrichum acutatum

Marta Ontivero, a Gustavo Martinez Zamor a,b Sergio Salazar, c Juan Carlos Diaz Ricci, b Atilio Pedro Castagnaro a
Seccion Biotecnologia, Estacion Experimental Agroindustrial Obispo Colombres-Unidad Asociada al INSIBIO, Av. William Cross 3150, 4101 Las Talitas, Tucuman, Argentina. bInstituto Superior de Investigaciones Biologicas (INSIBIO; CONICET- UNT) and Instituto de Quimica Biologica “Dr. Bernabe Bloj”, Universidad Nacional de Tucuman. Chacabuco 461, 4000 Tucuman. Argentina.

... The deduced amino acid sequence showed identity scores ranging between 93% and 60%, with E values comprised between 1 ? 10 –37 and 6 ? 10 –44 . The gene prediction programs SPL and FGENESH 2.6 (www.softberry.com) (Solovyev et al. ...


J Med Genet
2010 47: 8-21 originally published online July 1, 2009 doi: 10.1136/jmg.2009.067249

Mutations in 3 genes (MKS3, CC2D2A and RPGRIP1L) cause COACH syndrome (Joubert syndrome with congenital hepatic fibrosis)

Doherty et al.,
1University of Washington, Seattle, Washington, USA 2National Institutes of Health, Bethesda, Maryland, USA

... the likelihood that missense mutations would be deleterious was made using the PolyPhen program.42 NetGene2 (www.cbs.dtu.dk/services/NetGene2/), Genie (www.fruitfly.org/seq_tools/ splice.html), Human Splicing Finder (www.umd.be/HSF/), SPL (linux1.softberry.com), and ... 


Molecular breeding
2010, vol. 25, no4, pp. 699-722

Development of SSR markers and construction of a consensus genetic map for chicory (Cichorium intybus L.)

Cadalen et al.,
1) GIS CARTOCHIC, USTL, 59655, Villeneuve d’Ascq, France (2) UMR USTL/INRA 1281 «Stress Abiotiques et Differenciation des Vegetaux Cultives», ERT 1067, Universite de Lille 1, 59655, Villeneuve d’Ascq, France

... Intron positions were determined and then compared to predictions by models for intron/exon boundaries determination with RNA SPL tool, http://www.softberry.com/berry.phtml or GeneMark cDNA, http://opal.biology.gatech.edu/Gene Mark/genemark_cDNA_all.cgi. ... 


J Med Genet
doi:10.1136/jmg.2009.067249

Mutations in 3 genes (MKS3, CC2D2A and RPGRIP1L) cause COACH syndrome (Joubert syndrome with congenital hepatic fibrosis)

Doherty et al.,
University of Washington, United States

... likelihood that missense mutations would be deleterious was made using the PolyPhen program.[42] NetGene2 (www.cbs.dtu.dk/services/NetGene2/), Genie (www.fruitfly.org/seq_tools/ splice.html), Human Splicing Finder (www.umd.be/HSF/), SPL (linux1.softberry.com), and ...


European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21

Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda

Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China 2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China

...to search for cDNA and genomic DNA of SEDL-related splice variants.7 The FSPLICE 1.0 and SPL platforms (http://www.softberry.com/) were used to predict potential splice sites in genomic DNA. SPLM was implemented to substitute for SPL..


Blood Coagulation & Fibrinolysis.
19(3):240-242, April 2008.

Four novel FXI gene mutations in three factor XI- deficient patients

de Raucourt, Emmanuelle, de Mazancourt, Philippe, Quelin, Florence
Laboratory of Haematology, Poissy-Saint-Germain-en-Laye Hospital, France.

... exon 7, but an exon prediction software did not show an effect on the probability of splicing (website: http://www.softberry.com/cgi-bin/programs/gfind/spl.pl ...


Annals of Human Genetics
Volume 71 Issue 3 Page 325-335, May 2006

Common Polymorphisms in the CACNA1H Gene Associated with Childhood Absence Epilepsy in Chinese Han Population

J. Liang et al.,
Department of Pediatrics, Peking University, First Hospital, Beijing, 100034, P. R. China

... cmpharm.ucsf.edu/ ), transcription factor binding sites (NIH, http:/ / thr.cit.nih.gov/ molbio/ ), potential splicing sites (SPL, http:/ / softberry.com/ ...


J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006

Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*

Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and ¶INSERM, U784, 75230 Paris, France

... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify potential first exons and/or splice donor sites. Signal ...


The National Academy of Sciences Proc Natl Acad Sci U S A.
2003 November 25; 100(Suppl 2): 14537-14542.

Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster

Hugh M. Robertson,* Coral G. Warr,and John R. Carlson

*Department of Entomology, University of Illinois, 505 South Goodwin Avenue, Urbana, IL 61801; School of Biological Sciences, Monash University, Clayton VIC 3800, Australia; and Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06520

The genes were reconstructed manually in the PAUP editor (23) by using the expected exon/intron structures as guides and the SPL program (Softberry, www.softberry.com/berry.phtml) to locate predicted introns.


SPLM

Hum. Mol. Genet.
(2012) 21 (16): 3647-3654. doi: 10.1093/hmg/dds194

Deep intronic mutation in OFD1, identified by targeted genomic next-generation sequencing, causes a severe form of X-linked retinitis pigmentosa (RP23)

Webb et al.,
1UCL Institute of Ophthalmology, 11-43 Bath Street, London EC1V 9EL, UK, 2Jules Stein Eye Institute, University of California, 200 Stein Plaza, CA 90095-7000, USA

... SplicePredictor, http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi. FSplice, http://linux1.softberry. com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind. SPLM, http://linux1.softberry. com/berry.phtml?topic=splm&group=programs&subgroup=gfind. ...


European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21

Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda

Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China 2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China

... 7 The FSPLICE 1.0 and SPL platforms (http://www.softberry.com/) were used to predict potential splice sites in genomic DNA. SPLM was implemented to substitute ...


Fex

Journal of plant physiology
2016, 195, 31-38. doi:10.1016/j.jplph.2016.03.004

In silico characterization of DNA motifs associated with the differential expression of the ornithine decarboxylase gene during in vitro cystocarp development in the red seaweed Grateloupia imbricata

Montero-Fernandez, M., Robaina, R. R., Garcia-Jimenez, P.
Departamento de Biologia, Facultad de Ciencias del Mar, Universidad of Las Palmas de Gran Canaria, E-35017 Las Palmas de Gran Canaria, Canary Islands, Spain

... FEX: http://linux1.softberry.com/berry.phtml?topic=fex&group= programs&subgroup=gfind, Finding potential 5?-, internal and 3'-coding exons. ...


IUBMB Life
2015, Volume 68, Issue 2, pages 122–135, February 2016 DOI: 10.1002/iub.1464

Identification of differentially expressed three novel transcript variants of mouse ARNT gene

Ishqi, H. M., Ur Rehman, S., Sarwar, T., Husain, M. A., Tabish, M.
Institute

... finding tools. Gene finding tools used in our study were HMM gene (http://www.cbs. dtu.dk/services/HMMgene/), Genebuilder (http://www.itba.mi.cnr.it/webgene/) and FGENESH (http://linux1.softberry.com/berry.phtml). "Fex" available ...


International Journal of Bioinformatics Research and Applications
Volume 9, Number 6/2013, pp. 557-575 DOI: 10.1504/IJBRA.2013.056630

In–silico analysis for RNA–interference mechanism of a–synuclein to treat Parkinson's disease

S. Seema 1, R. Seenivasagam 2, K. Hemavathi 3
1Department of Bioinformatics, University of East London, Docklands Campus, University Way, London E16 2RD, UK 2Division of Drug Discovery and Development, Center of Molecular and Computational Biology, Department of Botany, St. Joseph's College, P.B. 27094, 36, Langford Road, Bangalore, Karnataka 560027, India 3Department of Bioinformatics, School of Chemical and Biotechnology, SASTRA University, Thanjavur - 613 402, Tamil Nadu, India

... 2009). The FEX program (Find EXon) (http://www.softberry.com/berry.phtml) predicts internal exons by linear discriminate function, evaluating ORFs flanked by GT and AG base pairs (the 5? and 3? ends of typical introns). ...


Plant Molecular Biology Reporter
April 2013, Volume 31, Issue 2, pp 303-313, DOI: 10.1007/s11105-012-0499-2

Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid

Seok Yien Christina Yong 1 and Ratnam Wickneswari 2
(1)Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia (2)School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor Darul Ehsan, Malaysia

... cgi /iprscan.cgi). Promoter sequence was analyzed using Prediction of Plant Promoter (http:// www.softberry.com/berry.phtml) and Neural Network Pre- diction (http://www.fruitly.org/seq_tools/promoter.html) software. The cDNA ... The software “Finding 5?, internal and 3? coding exons” (http://linux.softberry.com/cgi-bin/progrmas/gfind/fex.pl) was applied to predict exon–intron boundaries.


Cell Biology International.
(2013), doi: 10.1002/cbin.10080

Computational prediction and characterisation of ubiquitously expressed new splice variant of Prkaca gene in mouse.

Banday, A. R., Azim, S., Hussain, M. A., Nehar, S. and Tabish, M.
1Faculty of Life Sciences, Department of Biochemistry, A.M. University, Aligarh, Uttar Pradesh, India 2P.G. Department of Zoology, Ranchi University, Ranchi, Jharkhand, India

... (http://cbcb.umd.edu/software/GeneSplicer/) (Pertea et al., 2001), FGENESH (http://www.softberry. com/berry.phtml) and FEX (http://www.softberry.com/berry.phtml) and Augustus (http://augustus. gobics.de/) (Stanke et al., 2004). Alignment analysis was carried out using ...


Molecular Immunology
Volume 46, Issues 8-9, May 2009, Pages 1679-1687

The immunoglobulin heavy chain locus in the reptile Anolis carolinensis

Francisco Gambon Deza, Christian Sanchez Espinel and Susana Magadan Mompo
aUnidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n°, Vigo 36210, Pontevedra, Spain bInstituto Superior de Saude do Alto Ave (ISAVE), Quinta de Matos, Geraz do Minho, 4830-31 PVL, Portugal

... The constant region genes and exons were obtained by comparison with those already described for E. macularius. A dotplot was made with E. macularius and A. carolinensis sequences using the DNASTAR (lasergene), FGENESH and FEX software (http://www.softberry.com). ...


Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429

Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum

Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands

... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev, 2000) programs from the MOLQUEST software package (Softberry Inc. ...


J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006

Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*

Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and ¶INSERM, U784, 75230 Paris, France

... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify potential first exons and/or splice donor sites. Signal ...


The Journal of Immunology,
2006, 176: 4221-4234.

Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region

Colette M. Johnston2, Andrew L. Wood, Daniel J. Bolland and Anne E. Corcoran3
Laboratory of Chromatin and Gene Expression, Babraham Institute, Babraham Research Campus, Cambridge CB2 4AT, United Kingdom

... and databases, thereby providing optimal consensus for gene predictions: GRAIL ( http://compblo.ornl.gov/Grail-1.3/ ), Fex ( http://www.softberry.com ), Hexon ...


Biochemical and Biophysical Research Communications
Volume 313, Issue 3, 16 January 2004, Pages 765-770

p73: in silico evidence for a putative third promoter region

A.Emre Sayana, Mario Rossia, Gerry Melinoa, b and Richard A Knight
Medical Research Council Toxicology Unit, Hodgkin Building, Lancaster Road, Leicester LE1 9HN, UK

... exons in these introns. Three out of six programs are the part of Softberry package [24] having different algorithms. FEX is looking ...


Current Biology
2004, Volume 14, Issue 19, Pages R832-R833

Dual capacity of a human olfactory receptor

M. Spehr, K. Schwane, S. Heilmann, G. Gisselmann, T. Hummel, H. Hatt

... (B) RT-PCR with intron spanning primers. Candidates for 5'UTR exons were identified using FGENES and FEX software (SoftBerry, Mount Kisco, NY). ...


RNASPL

BMC Genomics
2011, 12:110 doi:10.1186/1471-2164-12-110

Strain-specific copy number variation in the intelectin locus on the 129 mouse chromosome 1

Lu et al.,
The Roslin Institute and Royal (Dick) School of Veterinary Sciences, University of Edinburgh, Roslin, Midlothian, UK

... Pseudogenes were only annotated when their exons share at least 70% identity to the coding sequences. In addition, the exon-exon junctions of the predicted transcripts were predicted with the RNASPL program of the Softberry web server [61] to check for alternative splicing. ...


General and Comparative Endocrinology
Volume 169, Issue 3, 1 December 2010, Pages 192-196 doi:10.1016/j.ygcen.2010.09.014

Molecular cloning and characterization of preproorexin in winter skate (Leucoraja ocellata)

Erin E. MacDonald and Helene Volkoff
a Department of Biology, Memorial University of Newfoundland, St. John’s, NL, Canada A1B 3X9 b Department of Biochemistry, Memorial University of Newfoundland, St. John’s, NL, Canada A1B 3X9

... Possible exon-exon locations were predicted using RNASPL (Softberry.com) and the most probable location was chosen based on the location of intron in known fish species (Faraco et al., 2006) and the fact that (A/C)AG is the most common exon sequence at the donor site ... 


FSPLICE

Molecular and cellular endocrinology
2016, 419, 172-184. doi:10.1016/j.mce.2015.10.014

Compound heterozygous DUOX2 gene mutations (c. 2335-1G> C/c. 3264_3267delCAGC) associated with congenital hypothyroidism. Characterization of complex cryptic splice sites by minigene analysis

Belforte, F. S. et al.,
a Laboratorio de Genetica Molecular Tiroidea, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina b Laboratorio de Genetica y Biologia Molecular, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina

... Searching for potential 5? ss and 3? ss sequences in the DUOX2 gene spanning from intron 17 to intron 18 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice. html), Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group ...


Journal of Cell & Tissue Research
Dec2015, Vol. 15 Issue 3, p5181-5186. 6p.

CLONING AND EXPRESSION OF PLANT CODON OPTIMIZED CRY1AC GENE IN SACCHAROMYCES CEREVISIAE

MOHAN, T. C.; KUMARA SWAMY, G. K.; KRISHNARAJ, P. U.; MISRA, H. S.; KURUVINASHETTI, M. S.

... Splice sites were predicted by using softberry FSPLICE (Find Splice Site in Genomic DNA) option accessible through http://www.softberry.com. The sequence was analyzed for undesirable 5' mRNA secondary structure by using tools available at http//www. genebee.com. ...


Molecular and cellular endocrinology
2015, 404, 102-112. doi:10.1016/j.mce.2015.01.032

Novel compound heterozygous Thyroglobulin mutations c. 745+ 1G> A/c. 7036+ 2T> A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5? splice site in the exon 6

Citterio et al.,
a Laboratorio de Genetica y Biologia Molecular, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina b Catedra de Genetica y Biologia Molecular (FFyB-UBA), C1113AAD Buenos Aires, Argentina c Unite Endocrinologie Diabetologie Pediatrique and Centre des Maladies Rares de la Receptivite Hormonale, CHU-Angers, 49933 Angers CEDEX 9, France

... Searching for potential 5? ss sequences in the TG gene spanning from exon 6 to intron 6 and exon 40 to intron 40 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html), Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group ...


ISRN Computational Biology
Volume 2013 (2013), Article ID 790240, 6 pages http://dx.doi.org/10.1155/2013/790240

Zebra Finch Glucokinase Containing Two Homologous Halves Is an In Silico Chimera

Khrustalev Vladislav Victorovich, 1 Lelevich Sergey Vladimirovich, 2 and Barkovsky Eugene Victorovich 1
1Department of General Chemistry, Belarusian State Medical University, Dzerzinskogo 83, 220116 Minsk, Belarus 2Department of Clinical Laboratory Diagnostics, Allergology and Immunology, Grodno State Medical University, Gorkogo 80, 230009 Grodno, Belarus

... Levels of 1GC; 2GC and 3GC have been calculated by “VVK Protective Buffer” [5] in those newly described exons too. Splicing sites for “new” exons have been predicted by "FSPLICE" algorithm from SoftBerry server (http://linux1.softberry.com/). ...


BMC Genomics
2013, 14:34 doi:10.1186/1471-2164-14-34

Developmentally regulated expression and complex processing of barley pri-microRNAs

Kruszka et al.,
1 Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University in Poznan, Umultowska 89, 61-614, Poznan, Poland 2 Computational Genomics Laboratory - Bioinformatics Laboratory, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University in Poznan, Umultowska 89, 61-614, Poznan, Poland

...Intron positions were predicted by comparisons of genomic and cDNA sequences using FSPLICE software, http://linux1.softberry.com webcite[53]. ...


Hum. Mol. Genet.
(2012) 21 (16): 3647-3654. doi: 10.1093/hmg/dds194

Deep intronic mutation in OFD1, identified by targeted genomic next-generation sequencing, causes a severe form of X-linked retinitis pigmentosa (RP23)

Webb et al.,
1UCL Institute of Ophthalmology, 11-43 Bath Street, London EC1V 9EL, UK, 2Jules Stein Eye Institute, University of California, 200 Stein Plaza, CA 90095-7000, USA

... SplicePredictor, http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi. FSplice, http://linux1.softberry. com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind. SPLM, http://linux1.softberry. com/berry.phtml?topic=splm&group=programs&subgroup=gfind. ...


Journal of the Peripheral Nervous System
Volume 17, Issue 2, pages 141–146, June 2012 DOI: 10.1111/j.1529-8027.2012.00405.x

Two novel missense mutations in FGD4/FRABIN cause Charcot-Marie-Tooth type 4H (CMT4H)

Baudot et al.,
1Inserm, UMR 910, “Genetique Medicale et Genomique Fonctionnelle”, Faculte de Medecine de la Timone 2Aix-Marseille Univ, UMR 910, “Genetique Medicale et Genomique Fonctionnelle”, Faculte de Medecine de la Timone, Marseille, France

... variations on splicing was assessed using the following programs: ESE finder (http://rulai.cshl. edu/cgi-bin/tools/ESE3/esefinder.cgi?process=home), NNSplice (http://biologyhelp.awardspace. com/desc.php?id=147&type=biotech), and FSPLICE (http://linux1.softberry.com/berry ...


Breast Cancer Research and Treatment
April 2012, Volume 132, Issue 3, pp 979-992 DOI 10.1007/s10549-011-1661-5

Assessing the RNA effect of 26 DNA variants in the BRCA1 and BRCA2 genes

Mireia Menendez et al.,
1. Hereditary Cancer Program, Genetic Diagnosis Unit, Laboratori de Recerca Translacional, Institut Catala d’Oncologia, Hospital Duran i Reynals—Bellvitge Biomedical Research Institute (ICO-IDIBELL), L’Hospitalet de Llobregat, Barcelona and Hospital Josep Trueta, IDIBGI, Gran Via 199-203, Girona, 08908, Spain 2. Human Cancer Genetics, Spanish National Cancer Centre (CNIO), Madrid, Spain

... www.fruitfly.org/seq_tools/splice. html), NetGene2 Server (http://www.cbs.dtu.dk/ services/ NetGene2/) and SoftBerry (http://linux1.softberry.com/berry. phtml?topic= fsplice&group=programs&subgroup=gfind). In the case of intronic ...


Molecular and Cellular Endocrinology
Volume 348, Issue 1, 2 January 2012, Pages 313–321

Two novel mutations in the thyroglobulin gene as cause of congenital hypothyroidism: Identification a cryptic donor splice site in the exon 19

Hector M. Targovnik et al.,
a Laboratorio de Biologia Molecular, Catedra de Genetica y Biologia Molecular, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires, 1113 Buenos Aires, Argentina b Unidad de Medicina Molecular, Departamento de Medicina, Facultad de Medicina, Universidad de Salamanca, 37007 Salamanca, Spain c Service d’Endocrinologie Pediatrique, Hopital des Enfants, Centre Hospitalier Universitaire de Toulouse, 31059 Toulouse Cedex 9, France

... Searching for potential 5?ss sequences in the TG gene spanning exon 19 and intron 19 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html), Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind), SPL ...


Aging Cell
(2011), 10: 896–907. doi: 10.1111/j.1474-9726.2011.00727.x

Alternative splicing factor or splicing factor-2 plays a key role in intron retention of the endoglin gene during endothelial senescence.

Blanco, F. J. and Bernabeu, C.
Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), and Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), c/Ramiro de Maeztu 9, 28040 Madrid, Spain

... Genome Bioinformatics (http://genome.ucsc.edu/). Then, the FSPLICE and FGENESH tools were used to predict exons and introns in the DNA sequences (http://linux1. softberry.com/berry.phtml). The Transeq tool at the European ...


Clinical Gastroenterology and Hepatology
Volume 9, Issue 9 , Page 806, September 2011 DOI: 10.1016/j.cgh.2011.03.034

Lynch Syndrome in Young-Onset Colorectal Cancer: Reassessing the Role of the MSH6 Gene

Maria Dolores Giraldez, Antoni Castells, Sergi Castellvi-Bel
Department of Gastroenterology, Hospital Clinic, CIBERehd, IDIBAPS, University of Barcelona, Barcelona, Spain

... By applying our strategy to the Limburg study (PolyPhen [http://genetics.bwh.harvard.edu/pph/], NNSPLICE [http://www.fruitfly.org/seq_tools/splice.html], and FSPLICE [http://linux1.softberry. com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind]), 8 of their patients ...

Phytopathologia Mediterranea
49, jan. 2011.

Amplification of Polyketide Synthase gene fragments in ochratoxigenic and nonochratoxigenic black aspergilli in grapevine.

STORARI, M., PERTOT, I., GESSLER, C., BROGGINI, G.

... Arbor, MI, USA). Putative introns were deter- mined using FSplice (www.softberry. com) and by homology with similar PKSs found in the NCBI database using BLASTX (http://blast.ncbi.nlm. nih.gov/Blast.cgi). Deduced amino ...



Chem. Senses
(2011) 36 (2): 149-160. doi: 10.1093/chemse/bjq105

Conservation of Indole Responsive Odorant Receptors in Mosquitoes Reveals an Ancient Olfactory Trait

Bohbot et al.,
1Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37235, USA 2Henry A. Wallace Beltsville Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Agricultural Research Service, USDA, Beltsville, MD 20705, USA

... Home.html). Matches were manually annotated using ClustalW and refined using the Softberry Splice Site Prediction program (http://linux1.softberry.com/berry.phtml? topic=fsplice&group=programs&subgroup=gfind). ClustalW ...


Microbiology
156 (2010), 2549-2557; DOI 10.1099/mic.0.039735-0

Molecular characterization and expression analysis of a suite of cytochrome P450 enzymes implicated in insect hydrocarbon degradation in the entomopathogenic fungus Beauveria bassiana

Nicolas Pedrini 1,2, Shizhu Zhang 1, M. Patricia Juarez 2 and Nemat O. Keyhani 1
1 Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611, USA 2 Instituto de Investigaciones Bioquimicas de La Plata, CONICET, Facultad de Ciencias Medicas, UNLP, Calles 60 y 120 (1900), La Plata, Argentina

... Sequence analyses. The sequences were analysed using programs implemented at the Biology WorkBench website (http://workbench.sdsc.edu/); splice site analysis was performed using the FSPLICE program at the SoftBerry server (http://www.softberry.com/berry.phtml). ... 


Neurology
2010 Feb 2;74(5):366-71

Genetic contribution of FUS to frontotemporal lobar degeneration

Van Langenhove et al.,
Neurodegenerative Brain Diseases Group, Department of Molecular Genetics, VIB, University of Antwerp-CDE, Universiteitsplein 1, B-2610 Antwerpen, Belgium.

.. the protein. The effect of sequence variants on splice site function and the prediction of alternative splice sites were assessed by the programs FSPLICE (http://www. softberry.com), NetGene2, 27 and NNSplice. 28. RESULTS. ... 


Chem. Senses
2010, doi: 10.1093/chemse/bjq105

Conservation of Indole Responsive Odorant Receptors in Mosquitoes Reveals an Ancient Olfactory Trait

Bohbot et al.,
1 Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37235, USA 2 Henry A. Wallace Beltsville Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Agricultural Research Service, USDA, Beltsville, MD 20705, USA

... Home.html). Matches were manually annotated using ClustalW and refined using the Softberry Splice Site Prediction program (http://linux1.softberry.com/berry.phtml? topic=fsplice&group=programs&subgroup=gfind). ClustalW ...


Neurology.
2010 Mar 9;74(10):846-50.

THAP1 mutations (DYT6) are an additional cause of early-onset dystonia

Houlden et al.,
From the Department of Molecular Neuroscience (H.H., R.P., A.M., J.H.), Sobell Department of Motor Neuroscience and Movement Disorders (S.A.S., P.S., M.E., K.P.B.), University College London Institute of Neurology, England;

... This intronic change is unlikely to be pathogenic because it did not affect splicing using the SpliceView program (http://bioinfo.itb.cnr.it/oriel/splice-view.html), NNSPLICE 0.9 (http://www.fruitfly.org/seq_tools/splice.html), and FSPLICE 1.0 (http://linux1.softberry.com/berry. ... 


Eur J Hum Genet.
2011 Jan;19(1):56-63. Epub 2010 Aug 18

Characterization of novel SLC6A8 variants with the use of splice-site analysis tools and implementation of a newly developed LOVD database

Betsalel et al.,
Metabolic Unit, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, The Netherlands.

... Project 6 (http://www.fruitfly.org/seq_tools/splice.html), Netgene2 7 (http://www.cbs.dtu.dk/services/ NetGene2/), Splice Predictor 8 (http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi), GenscanW 9 (http://genes.mit.edu/GENSCAN.html) and FSplice (http://linux1.softberry.com/berry.phtml ... 


Hum. Mol. Genet.
2010 19 (21): 4201-4206. doi: 10.1093/hmg/ddq338

A novel SOD1 splice site mutation associated with familial ALS revealed by SOD activity analysis

Birve et al.,
1Department of Pharmacology and Clinical Neuroscience and 2Department of Medical Biosciences, Clinical Chemistry, Umea University, Umea, Sweden

... The analyses of mRNA (Fig. 1B), fibroblast extracts (Fig. 2A) and erythrocytes (Fig. 2B) combine to show that the usage of the alternative splice site must be close to complete for the mutant allele, which was only predicted by the program FSPLICE at www.softberry.com. ... 


BMC Evolutionary Biology
2009, 9:97 doi:10.1186/1471-2148-9-97

Identification, distribution and molecular evolution of the pacifastin gene family in Metazoa

Bert Breugelmans, Gert Simonet, Vincent van Hoef, Sofie Van Soest, Jozef, Vanden Broeck
Department of Animal Physiology and Neurobiology, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000 Leuven, Belgium

... presence of a signal peptide were predicted using BESTORF (http://www.softberry.com) and SignalP (http://www.cbs.dtu.dk/services/SignalP/), respectively. ... If no complete ORF was found, the Softberry splice finder tool (FSPLICE) was used to search the missing ...


PLoS ONE.
2009; 4(2): e4372.

Identification of Lympho-Epithelial Kazal-Type Inhibitor 2 in Human Skin as a Kallikrein-Related Peptidase 5-Specific Protease Inhibitor

Ulf Meyer-Hoffert, Zhihong Wu, and Jens-Michael Schroder
Department of Dermatology, University Hospital Schleswig-Holstein, Campus Kiel, Kiel, Germany

... Subsequent sequence manipulations utilized the online BLAST 2 Sequences [37] (http://www.ncbi.nlm.nih.gov/ blast/bl2seq/bl2.html). Splice site analysis was performed using the FSPLICE program implemented at the SoftBerry server (http://www.softberry.com/berry.phtml). ...


Fungal Genetics and Biology
Volume 46, Issue 1, Supplement 1, March 2009, Pages S14-S18

Analysis and prediction of gene splice sites in four Aspergillus genomes

Kai Wang, David Wayne Ussery and Soren Brunak
aCenter for Biological Sequence Analysis, Department of Systems Biology, Building 208, Technical University of Denmark, DK-2800 Lyngby, Denmark

... 1407 donor sites), and most of them are likely to be false positives (Table 3). On the other hand, FSPLICE predicts splice sites based on weight matrices model on many organisms including Aspergillus (www.softberry.com). ...


PLoS ONE.
2009; 4(4): e5227.

Molecular Identification and Expression Analysis of Filaggrin-2, a Member of the S100 Fused-Type Protein Family

Zhihong Wu, Britta Hansmann, Ulf Meyer-Hoffert, Regine Glaser, and Jens-Michael Schroder
Department of Dermatology, University Hospital of Schleswig-Holstein, Kiel, Germany

... Subsequent sequence manipulations utilized the online BLAST 2 Sequences [62] (http://www.ncbi.nlm.nih.gov/ blast/bl2seq/bl2.html). Splice site analysis was performed using the FSPLICE program implemented at the SoftBerry server (http://www.softberry.com/berry.phtml). ...


European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21

Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda

Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China 2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China

...to search for cDNA and genomic DNA of SEDL-related splice variants.7 The FSPLICE 1.0 and SPL platforms (http://www.softberry.com/) were used to predict potential splice sites in genomic DNA. SPLM was implemented to substitute for SPL..


Genetics
Vol. 176, 749-761, June 2007

The Centromeric Retrotransposons of Rice Are Transcribed and Differentially Processed by RNA Interference

Pavel Neumann, Huihuang Yan and Jiming Jiang
Department of Horticulture, University of Wisconsin, Madison, Wisconsin 53706

... Splice site analysis was performed using the FSPLICE program implemented at the SoftBerry server (http://www.softberry.com/berry.phtml). ...


Journal of Biochemistry and Molecular Biology
Vol. 40, No. 2, March 2007, pp. 172-179

PCR-mediated Recombination of the Amplification Products of the Hibiscus tiliaceus Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase Gene

Linghui Wu, Tian Tang, Renchao Zhou and Suhua Shi*
State Key Laboratory of Biocontrol and Key Laboratory of Gene Engineering of the Ministry of Education, School of Life Sciences, Sun Yat-Sen University, 510275 Guangzhou, China

...The boundaries of exons/introns in the obtained sequences were determined using FSPLICE (Softberry Inc.) combined with BLAST (blastn, tblastx and bl2seq) (Altschul et al., 1997; Tatusova and Madden, 1999). ...


The American Journal of Human Genetics
2005, Volume 76, Issue 5, Pages 729-749

Diversity and Function of Mutations in P450 Oxidoreductase in Patients with Antley-Bixler Syndrome and Disordered Steroidogenesis

Huang et al.,

... and "Frame 7" (table 4), disrupted the canonical splice-acceptor or -donor sites; the splice-site recognition programs FSPLICE (see the Softberry Web site ...


Genome Explorer

Nature
425, 209-215 (11 September 2003) | doi:10.1038/425209a

Bioinformatics: Programmed for success

Steve Buckingham

... Three-way synteny from Softberry. Fast searching is also a feature of Genome Explorer from Softberry in Mount Kisco, New York, which uses the FMAP algorithm. ... ...... Softberry, for example, offers a number of gene-prediction programs that can be accessed over the web, including FGENESH, which ... The fully automated FGENESH++C will automatically annotate any genome (other than human) to a standard claimed to be indistinguishable ...


SPLICEDB

International Journal of Evolutionary Biology
Volume 2013 (2013), Article ID 818954, 10 pages http://dx.doi.org/10.1155/2013/818954

Conservation/Mutation in the Splice Sites of Cytokine Receptor Genes of Mouse and Human

Rosa Calvello, Antonia Cianciulli, and Maria Antonietta Panaro
Department of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari, Via Orabona 4, 70126 Bari, Italy

... invertebrates, fungi, protozoa, and plants [25–30]. Comprehensive databases have also been generated, for example, http://www.softberry.com/spldb/SpliceDB.html [29–31], and [26]. Cumulatively, the above-quoted papers report ...


European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21

Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda

Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China 2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China

... 9 Exons 3, 4, 5 and 6 (containing the ... canonical and noncanonical mammalian splice sites (SpliceDB) was used ... and SPL platforms (http://www.softberry.com/) were ...


JOURNAL OF COMPUTATIONAL BIOLOGY
Volume 12, Number 6, 2005 Pp. 894-906

Finding short DNA motifs using permuted markov models

X Zhao, H Huang, TP Speed

... The data are human donor sequences from SpliceDB[9], a recently developed database of known mammalian splice site sequences (http://www.softberry.com/spldb ...


Current Opinion in Structural Biology
2004, 14:273-282

The evolving roles of alternative splicing

Liana F Lareau1, Richard E Green1, Rajiv S Bhatnagar2,3 and Steven E Brenner1,2_
Departments of 1Molecular and Cell Biology, and 2Plant and Microbial Biology, University of California, Berkeley, California 94720, USA 3Department of Dermatology, University of California, San Francisco, California 94143, USA

... [79] SpliceDBhttp://www.softberry.com/berry.phtml?topic?SpliceDBDatabase and composition statistics for mammalian splice sites inferred from ESTs [80] ...


Yearbook of Medical Informatics.
Review Paper. 2004 121-136

Curated databases and their role in clinical bioinformatics

CC Englbrecht, M Han, MT Mader, A Osanger KFX Mayer
MIPS, Institute for Bioinformatics

...SpliceDB http://www.softberry.com/spldb/SpliceDB.html Canonical and non-canonical mammalian splice sites [122]
122.Burset M, Seledtsov IA, Solovyev VV. SpliceDB: database of canonical and non-canonical mammalian splice sites. Nucleic Acids Res 2001;29:255-9


Nucleic Acids Research,
2001, Vol. 29, No. 1 255-259

SpliceDB: database of canonical and non-canonical mammalian splice sites

M. Burset, I. A. Seledtsov1 and V. V. Solovyev*
The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK and 1Softberry Inc., 108 Corporate Park Drive, Suite 120, White Plains, NY 10604, USA


FGENESH+

Theoretical and Applied Genetics
2016 DOI 10.1007/s00122-016-2708-0

Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes

Y.-M. Jeong et al.,
1 Department of Life Science, The Catholic University of Korea, Bucheon 420?743, Korea 2 Epigenomics Research Center of Genome Institute, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Korea

... For gene prediction, the genome assembly was premasked for class I and class II transposons using RepeatMasker (http://www.repeatmasker.org) and protein- coding genes were predicted ab initio using Fgenesh+ (http://www.softberry.com), AUGUSTUS (Stanke and ...


Theoretical and Applied Genetics
2016 129: 1357. DOI: 10.1007/s00122-016-2708-0

Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes

Jeong, Y. M. et al.,
Department of Life ScienceThe Catholic University of Korea; Epigenomics Research Center of Genome InstituteKorea Research Institute of Bioscience and Biotechnology

... II transposons using RepeatMasker (http://www.repeatmasker.org) and protein- coding genes were predicted ab initio using Fgenesh+ (http://www.softberry.com), AUGUSTUS ...


BMC Genomics
2016,17:657 DOI: 10.1186/s12864-016-3017-3

Transcriptome analysis of smooth cordgrass (Spartina alterniflora Loisel), a monocot halophyte, reveals candidate genes involved in its adaptation to salinity

Bedre, R., Mangu, V. R., Srivastava, S., Sanchez, L. E., & Baisakh, N.
School of Plant, Environmental and Soil Sciences, Louisiana State University Agricultural Center; Department of Genetics and Biochemistry, Clemson University

... The positions of the SSRs on open reading frames of the genes were determined by using gene finding software MolQuest (FGENESH+; http://linux1.softberry.com/berry.phtml). ...


Molecular plant pathology
2016 DOI: 10.1111/mpp.12444

Fungal phytopathogens encode functional homologues of plant rapid alkalinisation factor (RALF) peptides

Thynne, E. et al.,
Plant Sciences Division, The Australian National University, Canberra, Australia Evolution, Ecology and Genetics Division, Research School of Biology, The Australian National University, Canberra, Australia Computational Evolution Group, The University of Auckland, Auckland, New Zealand

... 2013; Nemri et al. 2014). Where annotations were not present or were different, the online Softberry server (http://linux1.softberry.com/berry.phtml) was used to predict mRNA and protein sequences using the FGNESH+ prediction algorithm (Solovyev et al., 2006). ...


New Phytologist
2016 DOI: 10.1111/nph.14089

The Argonaute-binding platform of NRPE1 evolves through modulation of intrinsically disordered repeats

Trujillo, J. T., Beilstein, M. A., Mosher, R. A.
The School of Plant Sciences, The University of Arizona, Tucson, AZ, USA

... NRPE1 coding sequence was predicted using Fgenesh+ with A. thaliana or O. sativa protein sequences at http://www.softberry.com (Softberry ...


Biologia Plantarum
2016, 60(2), 279-284. DOI: 10.1007/s10535-016-0595-5

The B-, G-and S-genomic Chi genes in family Triticeae

Shoeva, O. Y., Dobrovolskaya, O. B., Leonova, I. N., Salina, E. A., Khlestkina, E. K.
1. Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia 2. Food Security Research Center, Novosibirsk State University, Novosibirsk, 630090, Russia

... The gene structure was determined with the FGENESH + program (http://linux1.softberry.com/ berry.phtml, Solovyev 2007). Sequence clustering was performed using the MEGA Page 3. B-, G- AND S-GENOMIC CHI GENES IN TRITICEAE 281 v. 5.1 software (Tamura et al. ...


Theoretical and Applied Genetics
2016, 1-16. DOI 10.1007/s00122-016-2723-1

Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense)

Liu, L. et al.,
1. Department of Plant Science and Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea 2. Department of Agronomy and Horticultural Science, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan

... Gene coding regions of the tomato scaffold were predicted by FGENESH+ (http://linux1.softberry. com). ... repeatmasker.org) and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were predicted with FGENESH (http://linux1.softberry.com) and BLASTX (https://blast. ...


Insect science
2016, 23(3), 366-376. DOI: 10.1111/1744-7917.12333

Genome?wide identification and characterization of odorant?binding protein (OBP) genes in the malaria vector Anopheles sinensis (Diptera: Culicidae)

He, X. et al.,
Institute of Entomology and Molecular Biology, College of Life Sciences, Chongqing Normal University, Chongqing, China

... sinensis genome by TBLASTN with an E-value cut-off at 1E-5. Thereafter, putative OBP sequences were predicted by Fgenesh+ (http://www.softberry.com/). ... sinensis OBP genes were predicted by Fgenesh+ (http://linux1.softberry.com/). ...


BMC plant biology
2015, 15(1), 198. DOI: 10.1186/s12870-015-0550-1

Transcriptionally active LTR retrotransposons in Eucalyptus genus are differentially expressed and insertionally polymorphic

Marcon, H. S et al.,
Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista – UNESP Programa de Pos-graduacao em Ciencias Biologicas (Genetica), Universidade Estadual Paulista – UNESP

... website. Putative ORFs were retrieved using FGENESH + tool [23] on Softberry platform (http://linux1.softberry.com/berry.phtml) and manually inspected. Conserved domains were annotated using Pfam (http://pfam.xfam.org/). ...


Journal of Molecular Catalysis B: Enzymatic.
Volume 118, August 2015, Pages 79–88. doi:10.1016/j.molcatb.2015.04.010

An unusual feruloyl esterase belonging to family VIII esterases and displaying a broad substrate range

Ohlhoff et al.,
a Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Bellville, Cape Town, South Africa b Centre for Microbial Ecology and Genomics, University of Pretoria, Pretoria, South Africa

... BLASTx and BLASTn. The assembled sequences were submitted to FGENESH+ in Softberry (Softberry, Inc., Mount Kisco, NY) for gene prediction and to determine the location of the coding/noncoding regions. The nucleotide ...


Plant Science
2015, Volume 234, May 2015, Pages 50–59, doi:10.1016/j.plantsci.2015.02.005

Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress

Jakubowska, D., Janicka-Russak, M., Kabala, K., Migocka, M., Reda, M.
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Kanonia Street 6/8, 50-328 Wroclaw, Poland

... homologs of genes encoding NADPH oxidase. Identified sequences were then analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www.softberry.com). ClustalW was used to perform the ...


Eukaryotic cell
2015, 14(2), 158-169 doi: 10.1128/EC.00153-14

Asexual propagation of a virulent clone complex in a human and feline outbreak of sporotrichosis

de Melo Teixeira, M. et al.,
aInstituto de Ciencias Biologicas, Universidade de Brasilia, Brasilia, DF, Brazil bDepartamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo, Sao Paulo, SP, Brazil

... BLASTx and BLASTn. The assembled sequences were submitted to FGENESH+ in Softberry (Softberry, Inc., Mount Kisco, NY) for gene prediction and to determine the location of the coding/noncoding regions. The nucleotide ...


Fungal Genetics and Biology
2014, 62, 55-61. DOI:10.1016/j.fgb.2013.10.013

MAT gene idiomorphs suggest a heterothallic sexual cycle in a predominantly asexual and important pine pathogen

Bihon, W., Wingfield, M. J., Slippers, B., Duong, T. A., Wingfield, B. D.
a Department of Genetics, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Private Bag X20, Hatfield, Pretoria 0028, South Africa b Crop Protection Division, Vegetable and Ornamental Plant Institute, Agricultural Research Council, Private Bag X293, Pretoria 0001, South Africa

... Workbench. Contigs with sequences having high similarity to the M. graminicola MAT1-2-1 sequence were analysed using FGENESH+(http://linux1.softberry.com) and AUGUSTUS (http://augustus.gobics.de) gene prediction programs. ...


Apidologie
2014, 1-15 DOI:10.1007/s13592-014-0292-3

Putative orthologues of genetically identified Drosophila melanogaster chitin producing and organising genes in Apis mellifera

Wang, Y., Odemer, R., Rosenkranz, P., Moussian, B.
1. Animal Genetics, Interfaculty Institute for Cell Biology, Eberhard-Karls University of Tubingen, Auf der Morgenstelle 8, 72076, Tubingen, Germany 2. Apicultural State Institute, University of Hohenheim, August-von-Hartmannstr. 13, 70599, Stuttgart, Germany

... To search for possible exons in the 5? region of GB46725 (coding for the putative grainyhead orthologue), the respective region was scanned manually and by using the software Fgenesh+ (www.?softberry.?com) and Genscan (genes.mit.edu/GENSCAN.html). ...


Plant Pathology
2014 Volume DOI: 10.1111/ppa.12184

Sequence variation in the putative effector gene SIX8 facilitates molecular differentiation of Fusarium oxysporum f. sp. cubense.

Fraser-Smith S. et al.,
1 The University of Queensland, St. Lucia, Qld, Australia 2 Plant Biosecurity Cooperative Research Centre, LPO Box 5012, Bruce, ACT 2617, Australia

... Gene structure was predicted using homology to the Fol-Six8 protein with the program fgenesh+ (Softberry.). ... The amino acid sequence of the Foc-Six8 homologues was predicted using the program fgenesh+ (Softberry) using homology to the Fol-Six8 protein (Fig. ...


Journal of virology
2014, JVI-00209 DOI:

Functional annotation of Cotesia congregata bracovirus: identification of the viral genes expressed in parasitized host immune tissues

Chevignon G. et al.,
1 Institut de Recherche sur la Biologie de l'Insecte, UMR CNRS 7261, UFR Sciences et Techniques, universite Francois-Rabelais, Tours, France. 2 Commissariat a l'Energie Atomique et aux energies alternatives, Genoscope (Centre National de Sequencage) Evry, France.

... Whenever overlapping 242 consensus sequences encompassed an entire CDS predicted by FGENESH+ 243 software detection (SoftBerry platform, http://linux1.softberry.com/all.html) on the 244 CcBV integrated genome (14), the corresponding gene was considered to 245 ...


Physiologia plantarum
, 150(1), 32-45. DOI: 10.1111/ppl.12064

Transcriptional regulation of the V?ATPase subunit c and V?PPase isoforms in Cucumis sativus under heavy metal stress

Kabala K. et al.,
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland

... cucumber sequences were then analyzed using gene finding programs identifying full-length cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/ eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...


Physiologia Plantarum
Volume 150, Issue 1, pages 32–45, January 2014 DOI:10.1111/ppl.12064

Transcriptional regulation of the V-ATPase subunit c and V-PPase isoforms in Cucumis sativus under heavy metal stress

Katarzyna Kabala*, Malgorzata Janicka-Russak, Malgorzata Reda, Magdalena Migocka
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland

.. cucumber sequences were then analyzed using gene finding programs identifying full-length cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/ eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...


Molecular Biology Reports
Volume 40, Issue 4 , pp 2809-2820 DOI:10.1007/s11033-012-2296-2

Isolation and characterization of a Laccase gene potentially involved in proanthocyanidin polymerization in oriental persimmon (Diospyros kaki Thunb.) fruit

Qianni Hu, Chun Luo, Qinglin Zhang, Zhengrong Luo
1. Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Shizishan, Wuhan, 430070, China

... Co., Ltd. Bioinformatics analyses. The similar protein-based gene prediction was performed on the DkLAC1 by the SoftBerry tool (http://linux1.softberry.com/berry.phtml? topic=fgenes_plus&group=programs&subgroup=gfs). The ...


Phil. Trans. R. Soc. B
19 September 2013 vol. 368 no. 1626 20130047 DOI:10.1098/rstb.2013.0047

Functional endogenous viral elements in the genome of the parasitoid wasp Cotesia congregata: insights into the evolutionary dynamics of bracoviruses

Bezier et al.,
1Institut de Recherche sur la Biologie de l'Insecte, CNRS UMR 7261, Universite Francois Rabelais, Parc de Grandmont, 37200 Tours, France 2Commissariat a l'Energie Atomique, Genoscope (Centre National de Sequencage), 2 rue Gaston Cremieux, CP 5706, 91057 Evry Cedex, France

... For both Cotesia spp., gene predictions were performed using a combination of FGENESH and FGENESH+ software from the SoftBerry platform with the Apis mellifera training set (http://linux1.softberry.com/all.htm) and from the EMBL-EBI platform using Wise2 algorithms (http ...


G3
March 1, 2013 vol. 3 no. 3 465-480 DOI:10.1534/g3.112.004986

Unequal Recombination and Evolution of the Mating-Type (MAT) Loci in the Pathogenic Fungus Grosmannia clavigera and Relatives

Tsui et al.,
*Department of Forest and Conservation Sciences, The University of British Columbia, Vancouver, BC, Canada V6T 1Z4 †Department of Wood Science, The University of British Columbia, Vancouver, BC, Canada V6T 1Z4

... The assembled sequences were submitted to FGENESH+ within Softberry (http://www.softberry. ru/berry.phtml?topic=fgenes_plus&group=programs&subgroup=gfs) for gene prediction and to determine the location of the coding/non coding regions, and manually annotated with ...


Plant and Soil
Volume 364, Issue 1-2 , pp 245-260 DOI:10.1007/s11104-012-1345-x

The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber

M. Migocka, A. Warzybok, G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland

... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was determined using FGENESH or FGENESH+ programs available on softberry.com ...


Plant Pathology
DOI:10.1111/ppa.12184

Sequence variation in the putative effector gene SIX8 facilitates molecular differentiation of Fusarium oxysporum f. sp. cubense

Fraser-Smith et al.,
1The University of Queensland, St. Lucia, Queensland, Australia 2Cooperative Research Centre for National Plant Biosecurity, Australia

... Gene structure was predicted using homology to the Fol-Six8 protein with the software program FGENESH+ (Softberry, Mount Kisco, NY, USA). Nucleotide and amino acid ... program FGENESH+ (Softberry, Mount Kisco, NY, USA) using homology to the Fol-Six8 protein. ...


The FASEB Journal
January 2013 vol. 27 no. 1 86-97 DOI:10.1096/fj.12-219444

Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female

Dottorini et al.,
*Department of Experimental Medicine and †Department of Industrial Engineering, University of Perugia, Perugia, Italy; ‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK; and §Department of Genetics, University of Cambridge, Cambridge, UK

... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted using FGENESH-C, FGENESH+ (http://linux1.softberry.com/), Wise2 (http://www.ebi.ac.uk/), and Genescan (http://genes.mit.edu/GENSCAN.html). Mosquito rearing and mating analysis. ...


Science China Life Sciences
Volume 56, Issue 7 , pp 628-637 DOI:10.1007/s11427-013-4505-1

Cloning and characterization of the gene cluster required for beauvericin biosynthesis in Fusarium proliferatum

Zhang et al.,
14505. CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China 24505. University of Chinese Academy of Sciences, Beijing, 100049, China

... analysis. Gene products of the individual ORFs were deduced and analyzed using the programs AUGUSTUS [18,19] and FGENESH (http://linux1.softberry.com/berry. phtml?topic =fgenes_plus&group=programs&subgroup=gfs). ...


J Phylogen Evolution Biol
Volume 1 • Issue 1 • 1000107 DOI:10.4172/jpgeb.1000107

Ancient Origin of Chaperonin Gene Paralogs Involved in Ciliopathies

Krishanu Mukherjee 1 and Luciano Brocchieri 2*
1Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32610-3610, USA 2Department of Molecular Genetics and Microbiology and Genetics Institute, University of Florida, Gainesville, FL 32610-3610, USA

from the genome and the corresponding query protein was used to guide the prediction of the complete structure of the newly-identified gene, based on homology and on intron-exon junction signals, using the gene-prediction software FGENESH+ [39] at the Softberry web-site (linux1.softberry. com). Reverse


G3
January 1, 2013 vol. 3 no. 1 41-63 doi: 10.1534/g3.112.004044

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

Manning et al.,
*Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331 †Department of Forest Sciences, University of British Columbia, Vancouver, British Columbia, Canada, V6T 1Z4 ‡Carbone/Ferguson Laboratories, Division of Neuroscience, Oregon National Primate Research Center (ONPRC), Beaverton, Oregon 97006

...Protein-encoding genes were annotated using a combination of manual curation, EST alignments, and ab initio gene predictions made by FGENESH, FGENESH+ (http://linux1.softberry.com) and GENEID (http://genome.crg.es/software/geneid). ...


Fungal Biology
Volume 117, Issue 6, June 2013, Pages 411–421 DOI:10.1016/j.funbio.2013.04.005

Characterization of the mating-type genes in Leptographium procerum and Leptographium profanum

Tuan A. Duong a, Z. Wilhelm de Beer b, Brenda D. Wingfield a, Michael J. Wingfield a
a Department of Genetics, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa b Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa

... Plasmids from the positive clones were extracted and inserts were sequenced by primer walking (sequencing primers are available on request). Genes present in the inserts were predicted using FGENESH+ (Salamov and Solovyev 2000) (http://linux1.softberry.com). ...


Gene
Volume 519, Issue 1, 25 April 2013, Pages 18–25 DOI:10.1016/j.gene.2013.01.058

Genome-wide identification and divergent transcriptional expression of StAR-related lipid transfer (START) genes in teleosts

Teng et al.,
a Beijing Institutes of Life Science, Chinese Academy of Sciences, Beijing 100101, China b Graduate University of the Chinese Academy of Sciences, Beijing 100049, China c Institute of Genomic Medicine, Wenzhou Medical College, Wenzhou 325035, China

... Gene predicted using FGENESH+ software (http://linux1.softberry.com/berry.phtml). ... a–?Distinct expression pattern of STARTs suggests divergent functions in development. FGENESH+ software (http://linux1.softberry.com/berry.phtml). ...


PloS one
February 01, 2013DOI: 10.1371/journal.pone.0055185

Genomic and Secretomic Analyses Reveal Unique Features of the Lignocellulolytic Enzyme System of Penicillium decumbens

Liu et al.,
State Key Laboratory of Microbial Technology, Shandong University, Jinan, Shandong, China Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China

... Gene Finding and Annotation. Gene models were predicted independently with a set of gene finders including Augustus [58], GeneMark-ES [59], GeneId [60] and SoftBerry eukaryotic gene finding suite (Fgenesh and Fgenesh+) [61]. ...


PLoS biology
(2013). 11(6), e1001585. DOI:10.1371/journal.pbio.1001585

Co-Expression of VAL-and TMT-Opsins Uncovers Ancient Photosensory Interneurons and Motorneurons in the Vertebrate Brain

Fischer et al.,
Max F. Perutz Laboratories, University of Vienna, Vienna, Austria, Research Platform “Marine Rhythms of Life,” University of Vienna, Vienna, Austria

...Full-length coding sequences were predicted with FGENESH+ (softberry.com) using Takifugu rubripes TMT-Opsin as input protein sequence. ...


PLoS genetics
(2013). 9(1), e1003233. DOI:10.1371/journal.pgen.1003233

Comparative Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens

Condon et al.,
Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, New York, United States of America Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon, United States of America

... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions with Fgenesh+ [103] and Genewise ....


PLoS Pathog
8(12): e1003037. doi:10.1371/journal.ppat.1003037

Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi

Ohm et al.,
United States Department of Energy (DOE) Joint Genome Institute (JGI), Walnut Creek, California, United States of America

... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions with Fgenesh+ [87] and Genewise...


BMC Plant Biology
2012, 12:235 http://www.biomedcentral.com/1471-2229/12/235

Endo-(1,4)-b?-Glucanase gene families in the grasses: temporal and spatial Co-transcription of orthologous genes

Buchanan et al.,
1 Australian Research Council Centre of Excellence in Plant Cell Walls, and the Australian Centre for Plant Functional Genomics, School of Agriculture, Food and Wine, University of Adelaide, South Australia 5064, Australia. 2 Genetic Discovery Group, Crop Genetics Research and Development, Pioneer Hi-Bred International Inc, 7300 NW 62nd Avenue, Johnston, IA 50131-1004, USA

...and were extracted using the FGENESH + program (Softberry, Inc. 116 Radio Circle, Suite 400Mount Kisco, NY 10549, USA)....


Molecular Reproduction and Development
Volume 79, Issue 6, pages 380–391, June 2012 DOI: 10.1002/mrd.22040

An oocyte-preferential histone mRNA stem-loop-binding protein like is expressed in several mammalian species

Aurore Thelie et al.,
1INRA, UMR85 Physiologie de la Reproduction et des Comportements, Nouzilly, France 2CNRS, UMR7247, Nouzilly, France

... We extracted the syntenic regions in mammals, and then applied several prediction gene methods, including FGENESH+ (http://linux1.softberry.com/berry.phtml), Genscan (Burge and Karlin, 1997), and Genewise (Birney et al., 2004). ...


MPMI
DOI: Vol. 25, No. 2, 2012, pp. 180–190. DOI: 10.1094/ MPMI -08-11-0212

A Highly Conserved Effector in Fusarium oxysporum Is Required for Full Virulence on Arabidopsis

Louise F. Thatcher, Donald M. Gardiner, Kemal Kazan, and John M. Manners
CSIRO Plant Industry, Queensland Bioscience Precinct, St. Lucia, Queensland, 4067, Australia

... gene structure was predicted using homology to F. oxysporum f. sp. lycopersici SIX proteins with FGENESH+ (Softberry, Mount Kisco, NY, U.S.A.), ...


Chemistry & Biology
Volume 19, Issue 12, 21 December 2012, Pages 1611–1619 DOI: 10.1016/j.chembiol.2012.10.010

Terpendole E, a Kinesin Eg5 Inhibitor, Is a Key Biosynthetic Intermediate of Indole-Diterpenes in the Producing Fungus Chaunopycnis alba

Takayuki Motoyama1, Toshiaki Hayashi1, Hiroshi Hirota1, Masashi Ueki1, Hiroyuki Osada1
1 Chemical Biology Core Facility, Chemical Biology Department, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198, Japan

... Nucleotide and amino acid sequence data were analyzed by DNASIS-Mac software (Hitachi Software Engineering, Tokyo, Japan). Open reading frames were predicted by FGENESH and FGENESH + software (Softberry, Mount Kiscko, NY). Construction of Recombinant Strains. ...


Fungal Genetics and Biology
Volume 49, Issue 9, September 2012, Pages 708–716 DOI: 10.1016/j.fgb.2012.06.010,

Protein phosphatase Z modulates oxidative stress response in fungi

Leiter et al.,
a Department of Microbial Biotechnology and Cell Biology, Faculty of Science and Technology, University of Debrecen, Egyetem ter 1, H-4032 Debrecen, Hungary b Departament de Bioquimica i Biologia Molecular, Institut de Biotecnologia i Biomedicina, Universitat Autonoma de Barcelona, Cerdanyola del Valles 08193, Barcelona, Spain

.. 5 2.2. Sequence analysis of fungal PPZ phosphatases DNA sequences were analyzed with FGENESH and FGENESH+ (http://www.softberry.com/berry.phtml; exon-intron analysis), WEBGENE (http://www.itb.cnr.it/sun/webgene; gene structure analysis), pDRAW32 (http://www ...


New Phytologist
Volume 194, Issue 4, pages 1001–1013, June 2012 DOI: 10.1111/j.1469-8137.2012.04128.x

Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen

Olson et al.,
1 Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, Box 7026, Ullsvag 26, 750 05 Uppsala, Sweden 2 US DOE Joint Genome Institute, Walnut Creek, CA 94598, USA

... based – FGENESH+, Genewise (Birney & Durbin, 2000) seeded by BLASTx (Altschul et al., 1990) alignments against GenBank's database of nonredundant proteins (NR: http://www.ncbi.nlm.nih. gov/BLAST/); and EST-based – EST_map (http://www.softberry.com/) seeded by ...


International Journal of Food Microbiology
Volume 157, Issue 2, 2 July 2012, Pages 202–209 DOI: 10.1016/j.ijfoodmicro.2012.05.008,

The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties

Jure Piskur et al.,
a Wine Research Centre, University of Nova Gorica, Slovenia b Department of Biology, Lund University, Sweden

... 2) homology-based — FGENESH+; Genewise (Birney and Durbin, 2000) seeded by BLASTx alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm. nih.gov/BLAST/), and 3) EST-based — EST_map (http://www.softberry.com/) seeded by ...


Fungal Genetics and Biology
Volume 49, Issue 3, March 2012, Pages 217–226 DOI: 10.1016/j.fgb.2012.01.007

The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction

Mahajabeen Padamsee et al.,
a Department of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, United States b Department of Plant Biology, University of Minnesota, Saint Paul, MN 55108, United States

... 2) homology-based – FGENESH +; Genewise (Birney and Durbin, 2000) seeded by BLASTx alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm. nih.gov/BLAST/), and (3) EST-based – EST_map (http://www.softberry.com/) seeded by ...


African Journal of Biotechnology
Vol. 11 (1), pp. 88-98, 3 January, 2012, DOI: 10.5897/AJB11.3474

Identification and characterization of the Bcl-2-associated athanogene (BAG) protein family in rice

Rashid Mehmood Rana 1, 2, Shinan Dong 1, Zulfiqar Ali 3, Azeem Iqbal Khan 4 and Hong Sheng Zhang 1
1 State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China. 2 Department of Plant Breeding and Genetics, PMAS-Arid Agriculture University Rawalpindi, Pakistan.

... The resultant six members of BAG family in rice were processed for further study. Genomic and cDNA sequences of these proteins were retrieved from NCBI and gene structure was predicted by FGENESH+ (http://linux1.softberry.com/berry.phtml). ...


J. Exp. Bot.
(2012) doi: 10.1093/jxb/ers245 First published online: September 20, 2012

Functional analysis of OsHSBP1 and OsHSBP2 revealed their involvement in the heat shock response in rice (Oryza sativa L.)

Rashid Mehmood Rana 1,2, Shinan Dong 1, Haijuan Tang 1, Fiaz Ahmad 1 and Hongsheng Zhang 1
1 State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China 2 Department of Plant Breeding and Genetics, PMAS-Arid Agriculture University Rawalpindi, Pakistan

... by one. The HSBP domain was identified by Pfam (PF06825) to confirm the presence of these proteins in rice. Gene structure was predicted by FGENESH+ (http://linux1.softberry.com/berry.phtml). The chromosomal location ...


Immunogenetics
September 2012 DOI 10.1007/s00251-012-0643-z

Identification of natural killer cell receptor genes in the genome of the marsupial Tasmanian devil (Sarcophilus harrisii)

Lauren E. van der Kraan (1) Emily S. W. Wong (1) Nathan Lo (2) Beata Ujvari (1) Katherine Belov (1)
1. Faculty of Veterinary Science, University of Sydney, B19 RMC Gunn, Sydney, NSW, 2006, Australia 2. School of Biological Sciences, University of Sydney, Sydney, NSW, 2006, Australia

... incomplete, a different gene prediction software, Softberry FGENESH+ (http://linux1.softberry.com/all.htm), was used to re-predict the sequences, incorporating protein homology informa- tion (the BLAST best hit). Functional ...


Gene.
2012 Apr 15;497(2):249-55. Epub 2012 Jan 31.

A novel Acetyl-CoA synthetase short-chain subfamily member 1 (Acss1) gene indicates a dynamic history of paralogue retention and loss in vertebrates.

Castro LF et al.,
University of Porto, Portugal.

... Intron/exon predictions were made with FGENESH+ (http://linux1.softberry.com/berry.138 phtml). 2.2. Phylogenetic analysis. The ACSS1 amino acid sequences retrieved from the genome search were aligned using MAFFT with the L-INS-i method (Katoh and Toh, 2008). ...


Genet. Mol. Res.
11 (4): 3676-3687 (2012) DOI http://dx.doi.org/10.4238/2012.August.17.3

Regulation of ATG6/Beclin-1 homologs by abiotic stresses and hormones in rice (Oryza sativa L.)

R.M. Rana1,2, S. Dong1, Z. Ali3,4, J. Huang1 and H.S. Zhang1
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, China 2Department of Plant Breeding and Genetics, Pir Mehr Ali Shah Arid Agriculture University Rawalpindi, Rawalpindi, Pakistan

... Genomic and cDNA sequences of these proteins were retrieved from NCBI, and gene structure was predicted by FGENESH+ (http://linux1.softberry.com/ berry.phtml). The chromosomal location of each ATG6 gene in rice was determined from the rice physical map constructed by the International Rice Genome Sequencing Project (IRGSP) (http://rgp.dna.affrc.go.jp). Subcellular localization of the OsATG6 family was predicted by WoLF PSORT (Horton et al., 2006) and ProtComp (http://linux1.softberry.com/berry.phtml). ...


Plant Physiology October
2011 vol. 157 no. 2 757-769 DOI: 10.1104/pp.111.181990

Genome-Wide Comparison of Nucleotide-Binding Site-Leucine-Rich Repeat-Encoding Genes in Arabidopsis

Guo et al.,
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany

... Gordon et al., 1998). Primer walking and PCR were used to fill or polish gaps and ambiguous regions. Annotation was performed using FGENESH and FGENESH+ (http://linux1.softberry.com/berry.phtml). Spidey (http://www.ncbi ...


Parasitology Research
Volume 108, Issue 3 , pp 611-620 DOI: 10.1007/s00436-010-2104-7

Eimeria maxima phosphatidylinositol 4-phosphate 5-kinase: locus sequencing, characterization, and cross-phylum comparison

Mei-Yen Goh, Mei-Zhen Pan, Damer P. Blake, Kiew-Lian Wan, Beng-Kah Song
1. School of Science, Monash University Sunway Campus, Jalan Lagoon Selatan, 46150 Bandar Sunway, Selangor DE, Malaysia 2. Parasitology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK

... Structural annotation of the putative EmPIP5K gene Open reading frame identification was performed by submitting consensus contig sequence to the ab initio gene-prediction programs AUGUSTUS version 2.0.3 (Stanke et al. 2008), FGENESH+ (http://www.softberry. ...


The Journal of Biological Chemistry
March 25, 2011 286, 10419-10428. doi: 10.1074/jbc.M110.179853

Two Novel Classes of Enzymes Are Required for the Biosynthesis of Aurofusarin in Fusarium graminearum

Frandsen et al.,
From the ‡Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, DK-1870 Frederiksberg, the §Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark, DK-2800 Kongens Lyngby

... default settings (12). Ad hoc ab initio gene modeling was performed using FGENESH and FGENESH+ (SoftBerry). Motifs in unaligned sequences were identified using Meta-MEME version 4.1.1 and MAST (13, 14). Primer design ...


Peptides
Volume 34, Issue 1, March 2012, Pages 193–200

An evolutionary comparison of leucine-rich repeat containing G protein-coupled receptors reveals a novel LGR subtype

Matthias B. Van Hiel a, b, 1, , Hans Peter Vandersmissen a, 1, , Tom Van Loy a, , Jozef Vanden Broeck a
a Animal Physiology and Neurobiology, Zoological Institute of the Katholieke Universiteit Leuven, Naamsestraat 59, P.O. Box 02465, B-3000 Leuven, Belgium b Department of Genetics, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, 30 Flemington Road, Parkville, Melbourne, Victoria 3010, Australia

... 39, 60]. Possible incorrectly in silico predicted sequences were manually checked at the genomic DNA level and, where possible, repredicted using softberry (http://linux1.softberry.com/berry.phtml) FGENESH+. Sequences were ...


PLoS ONE
6(8): e24111. doi:10.1371/journal.pone.0024111

Topological and Functional Characterization of an Insect Gustatory Receptor

Zhang et al.,
The Key Sericultural Laboratory of Agricultural Ministry, Southwest University, Chongqing, China CSIRO Food Futures Flagship, Canberra, Australian Capital Territory, Australia

...The genomic scaffold sequences containing candidate genes were predicted using FGENESH+ (http://www.softberry.com/berry.phtml), BGF...


Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184–194 DOI: 10.1016/j.exppara.2010.07.012

Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases

Tiago M. Martins a, b, , , Virgilio E. do Rosario b, Ana Domingos a, b
a Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal

... A threshold of E ? 1e-04 was adopted for the tblastn search (Wu et al., 2003). The gene structure of the identified CP genes with multiple exons was predicted using the FGENESH and FGENESH+ software (http://www.softberry.com). ...


J. Exp. Bot.
(2011) 62 (15): 5641-5658. doi: 10.1093/jxb/err249

Flowering time variation in oilseed rape (Brassica napus L.) is associated with allelic variation in the FRIGIDA homologue BnaA.FRI.a

Wang et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China

... online). The genes were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) with FRI and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml). ...


J. Exp. Bot.
(2011) 62 (10): 3359-3374. doi: 10.1093/jxb/erq321

Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

Abou-Elwafa et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK

... Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...


Plant Physiology
February 2011 vol. 155 no. 2 1013-1022 DOI: 10.1104/pp.110.169870

Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene Is Associated with Changes in Flowering Time across a Range of Populations

Skot et al.,
Institute of Biological, Environmental, and Rural Sciences, Aberystwyth University, Aberystwyth, Ceredigion SY23 3EB, United Kingdom (L.S., R.S., A.T., K.S., D.T., G.L., I.A.); Department of Genetics and Biotechnology, Faculty of Agricultural Sciences, Research Centre Flakkebjerg, Aarhus University, 4200 Slagelse, Denmark (T.A.)

... The identity of LpFT3 was confirmed by direct sequencing of the Hd3a.1f/3r-positive BACs with coding sequence and protein prediction generated using FGENESH+ (http://www.softberry.com/ berry.phtml) and by direct comparison with other monocot FT sequences obtained ...


PLoS Pathog
(2011), 7(7): e1002137. doi:10.1371/journal.ppat.1002137

Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens.

Klosterman et al.,
USDA-ARS, Salinas, California, United States of America University of California, Davis, California, United States of America

...Protein-encoding genes were annotated using a combination of manually curated genes, in addition to EST BLAST alignments, and ab initio gene predictions made by FGENESH, FGENESH+ (http://linux1.softberry.com), and ...


PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.

Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany

...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99] and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...

Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976

Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.

Berka et al.,
Novozymes, Inc., Davis, California, USA. US Department of Energy Joint Genome Institute, Walnut Creek, California, USA. Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.

... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly; cDNA-based EST_map (http://www.softberry.com/) seeded ...


Insect Molecular Biology
Special Issue: The Aphid Genome
Volume 19, Issue Supplement s2, pages 141–153, March 2010 DOI: 10.1111/j.1365-2583.2009.00975.x

Identification of ion channel genes in the Acyrthosiphon pisum genome

Dale et al.,
1 Syngenta, Jealotts Hill Research Centre, Bracknell, Berkshire, UK; 2 MRC Functional Genomics Unit, Department of Physiology Anatomy and Genetics, University of Oxford, South Parks Road, Oxford, UK;

... eugenes.org/aphid/), was also queried. Softberry protein-based gene predictions software FGENESH+ (http://linux1.softberry.com/berry.phtml) was used to refine gene sequence data. Previously identified members of the Glutamate ... 


Plant Physiology Preview
Published on November 29, 2010; 10.1104/pp.110.169870

Allelic variation in the Lolium perenne L. (perennial ryegrass ) FLOWERING LOCUS T (LpFT3) gene is associated with changes in flowering time across a range of populations

Skot et al.,
1 Aberystwyth University; 2 Aarhus University

... was confirmed by direct sequencing of the Hd3a.1f/3r positive BACs with coding sequence and protein prediction generated using FGENESH+ (http://www.softberry.com/berry.phtml) ... (http://linux1.softberry.com/berry.phtml). Predicted secondary structures for the proteins ...


J. Exp. Bot.
2010 doi: 10.1093/jxb/erq321

Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

Abou-Elwafa et al.,
1 Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2 Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK

.. Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...


Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184-194 doi:10.1016/j.exppara.2010.07.012

Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases

ATiago M. Martins a, b, Virgilio E. do Rosario b and Ana Domingos a, b
Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal

... A threshold of E 1e-04 was adopted for 93 the tblastn search (Wu et al., 2003). The gene structure of the identified CP genes with 94 multiple exons was predicted using the FGENESH and FGENESH+ software 95 (http://www.softberry.com). ... 


Developmental & Comparative Immunology
Volume 34, Issue 1, January 2010, Pages 1-13 doi:10.1016/j.dci.2009.08.002

Structure and expression pattern of teleost caspase recruitment domain (CARD) containing proteins that are potentially involved in NF-?B signalling

M.X. Chang a, W.Q. Chen a, b and P. Nie a
aState Key Laboratory of Freshwater Ecology and Biotechnology, and Laboratory of Fish Diseases, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, PR China bCollege of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei Province 430070, China

... Manual annotation of the orthologous genes was also performed using FGENESH+ to predict structures based on homology with human genes: “fish” specific parameters were applied in this program (http://linux1.softberry.com/berry.phtml). 2.2. Fish and cell line. ... 


Cytokine & Growth Factor Reviews
Volume 20, Issue 2, Pages 115-124

Structural conservation of interferon gamma among vertebrates

R. Savan, S. Ravichandran, J. Collins, M. Sakai, H. Young

... Initially, DYRK2, MDM, RAP1B, NUP107, SLC35E3, CNTN1B, OPN1SW1, CALU harboring scaffolds or contigs were identified. These contigs were then searched for IFN-? gene using FGENESH+ software and curated manually (http://www.softberry.com/berry.phtml). ...


Mol Biol Evol.
2009 May;26(5):1143-53. Epub 2009 Feb 19.

Evolution of mutation rates: phylogenomic analysis of the photolyase/cryptochrome family

Lucas-Lledo JI, Lynch M.
Department of Biology, Indiana University, Bloomington, Indiana, USA.

... The FGENESH+ gene predictor (http://linux1.softberry.com/berry.phtml) was occasionally used to improve the translation of some unannotated eukaryotic genes. Results from different searches were merged and aligned using ClustalX 1.83 (Thompson et al. ...


Mol Biol Evol.
2009 Jul;26(7):1557-69. Epub 2009 Apr 6.

The Fruitless gene in Nasonia displays complex sex-specific splicing and contains new zinc finger domains

Bertossa RC, van de Zande L, Beukeboom LW.
Evolutionary Genetics, Centre for Ecological and Evolutionary Studies, The Netherlands.

... 1990 Go ). In cases in which no or partial sequences were annotated, missing domains were predicted using FGENESH+ at http://linux1.softberry.com/berry.phtml (Solovyev et al. 2006 Go ) using already known protein sequences as template. ...


Genetics.
2009 May;182(1):145-59. Epub 2009 Mar 16.

The multi-AT-hook chromosomal protein of Drosophila melanogaster, D1, is dispensable for viability

Weiler KS.
Department of Biology, West Virginia University, Morgantown, West Virginia 26506, USA

... was identified by tBLASTn of D. simulans genomic sequence using the D. melanogaster protein as a query (http://insects.eugenes.org/species/blast/). FGENESH+ (http://www.softberry.com) was used to predict the partial protein sequence. ...


Science.
2009 May 1;324(5927):626-31.

Biomolecular characterization and protein sequences of the Campanian hadrosaur B. canadensis

Schweitzer et al.,
1 North Carolina State University, Raleigh, NC 27695, USA. 2 North Carolina Museum of Natural Sciences, Raleigh, NC 27601, USA.

... two extinct organisms: Mammut americanum (MOR 605) and T. rex (MOR 1125) (see table S1 and SOM appendix) (6). The Anolis carolinensis amino acid sequence was inferred with the use of FGENESH+ (gene prediction on the basis of protein homology; www.softberry.com). ...


BMC Genomics
2009, 10:553 doi:10.1186/1471-2164-10-553

Annotation and expression of carboxylesterases in the silkworm, Bombyx mori

Quan-You Yu 1,2, Cheng Lu *2, Wen-Le Li 2, Zhong-Huai Xiang 2 and Ze Zhang *1,2
1The Institute of Agricultural and Life Sciences, Chongqing University, Chongqing 400044, China and 2The Key Sericultural Laboratory of the Agricultural Ministry of China, Southwest University, Chongqing, 400716, China

... weak sequence similarity to any query sequence and its flanking regions (1 kb or more long) were extracted. Putative COE genes within the extracted sequences were predicted using BGF software [55] and Fgenesh+ (http://www.softberry.com/). Phylogenetic analysis ...


Nature Biotechnology
26, 553 - 560 (2008)

Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)

Diego Martinez et al.,
Los Alamos National Laboratory/Joint Genome Institute, PO Box 1663, Los Alamos, New Mexico 87545, USA. Novozymes, Inc., 1445 Drew Ave., Davis, California 95618, USA.

... an ab initio gene predictor, Fgenesh 37 , specifically trained for this genome, and two homology-based gene predictors, Fgenesh+ (http://www.softberry.com) and ...


Genes & Dev.
2008. 22: 2869-2885 10.1101/gad.1691208

LAB-1 antagonizes the Aurora B kinase in C. elegans

De Carvalho, C. E. et al.,
1Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA; 2 Department of Molecular Genetics, University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030, USA

... Prediction of the coding sequence in the respective region in 1003.1 and conceptual translation were performed using FGENESH+ (http://www.softberry.com/berry ...


Nature
Volume 453 Number 7198 pp1064 - 1071 (19 Jun 2008), doi: 10.1038/nature06967

The amphioxus genome and the evolution of the chordate karyotype.

Bowler et al.
# Department of Energy Joint Genome Institute, Walnut Creek California 94598, USA
# Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720, USA

... A\Supplementary Note 3. Annotation of protein coding genes 3.1 Expressed sequence tag sequencing. cDNA libraries for amphioxus were prepared from gastrula and neurula stage embryos, and from larvae as described by 6, and a single library was created for Petromyzon marinus (sea lamprey). Approximately 32,000 expressed sequence tags (ESTs) were attempted from each library. (Supplementary Table S6). 3.2 Gene prediction, functional annotation and quality control. The JGI Annotation Pipeline was used for annotation of the amphioxus v1.0 assembly described here. The pipeline includes the following steps: (1) repeat masking, (2) mapping ESTs, full length cDNAs, and putative full length known genes, (3) gene structure prediction using several methods, (4) protein functional annotation using several methods, and (5) combining gene predictions into a non redundant representative set of gene models, which are subject to genome-scale analysis. The genomic sequence, predicted genes and annotations of amphioxus, together with available evidence, are available at the JGI Genome Portal (www.jgi.doe.gov/Amphioxus) and from GenBank under accession number ABEP01000000. Transposons were masked using RepeatMasker 7 tools and a custom library of manually curated repeats (see above Supplementary Note 2.4). 480,070 ESTs were clustered into 77,402 consensus sequences and both individual ESTs and consensus sequences were mapped onto genome assembly using BLAT4. Gene predictors used for annotation of amphioxus v1.0 included ab initio FGENESH 8, homology- based FGENESH+ 8, homology-based GENEWISE 9, and EST-based ESTEXT (Grigoriev, unpublished, available upon request). ...


PLoS ONE.
2008; 3(3): e1889.

Genome-Wide Detection of Serpentine Receptor-Like Proteins in Malaria Parasites

Luciana Madeira et al.,
1Departamento de Parasitologia, Instituto de Ciencias Biome'dicas, Universidade de Sa~o Paulo, Sa~o Paulo, Brasil 2Departamento de Bioqui'mica, Instituto de Qui'mica, Universidade de Sa~o Paulo, Sa~o Paulo, Brasil

... These sequences were submitted to a HMM plus similar protein-based gene prediction using the FGENESH+ program [22] (http://www.softberry.com), setting the ...


Nature
2008, 4doi:10.1038/nature07410

The Phaeodactylum genome reveals the evolutionary history of diatom genomes.

Bowler et al.
1. CNRS UMR8186, Department of Biology, Ecole Normale Supe'rieure, 46 rue d'Ulm, 75005 Paris, France
2. Stazione Zoologica 'Anton Dohrn', Villa Comunale, I-80121 Naples, Italy

... Gene predictors used for these annotations included ab initio Fgenesh 12 trained on sets of known genes and reliable homology-based gene models from P. tricornutum and T.pseudonana, and homology-based Fgenesh+ 12 and Genewise 13 seeded by BLASTX alignments against sequences in the NCBI non-redundant protein set. ...


Nucleic Acids Research
(2007), doi:10.1093/nar/gkm768

ChromDB: The Chromatin Database

Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA

... In many cases, we have derived our own transcript models from genomic sequences using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...


BMC Genetics
2008, 9:78 doi:10.1186/1471-2156-9-78

Genomic Complexity of the Variable Region-Containing Chitin-Binding Proteins in Amphioxus

Dishaw et al.,
All Children’s Hospital,Department of Molecular Genetics,801SixthStreet South,St. Petersburg,FL 33701,USA

... html),FGENESH and FGENESH+ (http://linux1.softberry.com/all.htm) or genomescan[63,66] (http://genes.mit.edu/genomescan. html).Details ...


Fish & Shellfish Immunology
Volume 22, Issue 4, April 2007, Pages 351-362

Characterization of an interleukin-15 like (IL-15L) gene from zebrafish (Danio rerio)

I. Gunimaladevi, Ram Savan, Kenji Sato, Ryoji Yamaguchi and Masahiro Sakai
he United Graduate School of Agricultural Sciences, Kagoshima University, Korimoto 1-21-24, Kagoshima, Japan

... 15 gene sequences. The intron-exon structure was determined by FGENESH+ (http://www.softberry.com/berry.phtml). Gene-specific ...


Fungal Genetics and Biology
Volume 44, Issue 2, February 2007, Pages 77-87

Extracellular oxidative systems of the lignin-degrading Basidiomycete Phanerochaete chrysosporium

Phil Kersten and Dan Cullen
Forest Products Laboratory, USDA, One Gifford Pinchot Drive, Madison, WI 53705, USA

... Predictions were based on ab initio methods Fgenesh (Salamov and Solovyev, 2000), homology-based methods, Fgenesh+ (www.softberry.com) and Genewise (Birney and ...


J. Biol. Chem.
Vol. 282, Issue 19, 13984-13993, May 11, 2007

Molecular and Functional Characterization of Inositol Trisphosphate Receptors during Early Zebrafish Development

Rachel Ashworth et al.,
School of Biological and Chemical Sciences, Queen Mary University of London, London E1 4NS, United Kingdom

... sequences using the FGENESH+ program, a hidden-Markov model-based algorithm for finding genes with protein similarity, accessible at the Softberry web site. ...


PLoS Biol
(2007) 5(10): e275 doi:10.1371/journal.pbio.0050275

A Novel Snf2 Protein Maintains trans-Generational Regulatory States Established by Paramutation in Maize

Hale CJ, Stonaker JL, Gross SM, Hollick JB
Department of Plant and Microbial Biology, University of California Berkeley, Berkeley, California, United States of America

... for CHR156 was identified from BAC CH201-3L17 (GenBank accession AC194602), and gene model prediction was performed using FGENESH+ (Softberry, http: / /www ...


Journal of Molecular Evolution
2007 Volume 65, Number 2 pp. 137-153

Comprehensive Analysis of Animal TALE Homeobox Genes: New Conserved Motifs and Cases of Accelerated Evolution

Krishanu Mukherjee and Thomas R. Burglin
Department of Biosciences and Nutrition, Karolinska Institutet, and School of Life Sciences, Sodertorns Hogskola, Huddinge, Sweden

... carried out with the genomic sequence using the MIT GENSCAN server (http://genes.mit.edu/GENSCAN.html), as well as the FGENESH+ server at Softberry (http://www ...


Genetics
Vol. 176, 599-609, May 2007

The FLOWERING LOCUS T-Like Gene Family in Barley (Hordeum vulgare)

Sebastien Faure, Janet Higgins, Adrian Turner and David A. Laurie
John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom

... New gene predictions were made using FGENESH+ and PROT_MAP (http://sun1.softberry. com) for FT-like genes showing incorrect alignment within the PEBP domain and ...


PNAS
| May 1, 2007 | vol. 104 | no. 18 | 7705-7710

The tiny eukaryote Ostreococcus provides genomic insights into the paradox of plankton speciation

Brian Palenik et al.,
aScripps Institution of Oceanography, University of California at San Diego, La Jolla, CA 92093-0202; cJoint Genome Institute and Stanford Human Genome Center, Stanford University School of Medicine, 975 California Avenue, Palo Alto, CA 94304;

... Gene prediction methods used for annotation of two Ostreococcus genomes included ab initio Fgenesh (40), homology-based Fgenesh+ (SoftBerry), Genewise (41 ...


Nature Biotechnology
25, 319 - 326 (2007) Published online: 4 March 2007 | doi:10.1038/nbt1290

Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis

Thomas W Jeffries et al.,
US Department of Agriculture, Forest Service, Forest Products Laboratory, One Gifford Pinchot Drive, Madison, Wisconsin 53705, USA.
Department of Bacteriology, University of Wisconsin-Madison, 420 Henry Mall, Madison, Wisconsin 53706, USA.

... Gene prediction methods used for analysis of the P. stipitis genome include ab initio Fgenesh 44 , homology-based Fgenesh+ (http://www.softberry.com/) and ...


Molecular Plant Pathology
Volume 8 Issue 1 Page 111-120, January 2007

Isolation and characterization of the mating type locus of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana

LAURA CONDE-FERRAEZ et al.,
Centro de Investigacion Cientifica de Yucatan (CICY), Calle 43 no. 130, Chuburna de Hidalgo, C.P. 97200, Merida, Yucatan, Mexico

... Identification of open reading frames (ORFs) and gene predictions were performed using FGENESH and FGENESH+ software (Softberry™, http:/ / www.softberry.com ...


Insect Molecular Biology
15 (5), 541 - 549. doi:10.1111/j.1365-2583.2006.00674.x

Proteomic analyses of male contributions to honey bee sperm storage and mating

A. M. Collins, T. J. Caperna, V. Williams, W. M. Garrett, J. D. Evans
Bee Research Laboratory, ARS, USDA, Beltsville, MD, USA; *Growth Biology Laboratory, ARS, USDA, Beltsville, MD, USA; and Biotechnology and Germplasm Laboratory, ARS, USDA, Beltsville, MD, USA

... 2006) combined with a partially redundant database of ab initio proteins predicted by Genscan (Burge & Karlin, 1997) and FGENESH+ ( http:/ / www.softberry.com ...


J. Biol. Chem.,
Vol. 281, Issue 51, 39388-39395, December 22, 2006

A Toll Receptor and a Cytokine, Toll5A and Spz1C, Are Involved in Toll Antifungal Immune Signaling in the Mosquito Aedes aegypti*

Sang Woon Shin1, Guowu Bian1, and Alexander S. Raikhel2
From the Department of Entomology and the Institute for Integrative Genome Biology, University of California, Riverside, California 92521

... possible orthologues of Drosophila Toll and Toll-5. The open reading frames from these two loci were predicted using FGENESH+ (27) (sun1.softberry.com) by ...


Nature
434, 980-986 (21 April 2005)

The genome sequence of the rice blast fungus Magnaporthe grisea

Dean et al.,
Center for Integrated Fungal Research, North Carolina State University, Raleigh, North Carolina 27695, USA School of Biological and Chemical Sciences, University of Exeter, Washington Singer Laboratories, Exeter EX4 4QG, UK

...Gene predictions were performed using FGENESH/FGENESH1 + trained on M. grisea sequences (SoftBerry) and GENEWISE (Sanger Center) and validated against 65 characterized M. grisea genes. Additional information and gene identification...


Genome Research
14:685-692, 2004

Automated Whole-Genome Multiple Alignment of Rat, Mouse, and Human

Michael Brudno1 et al
1 Department of Computer Science, Stanford University, Stanford, California 94305, USA

... Fgenesh+ gene prediction is conducted on sequences with protein homology ...


Genome Research 13:313-322 2003
Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.313703.

A Complexity Reduction Algorithm for Analysis and Annotation of Large Genomic Sequences

Trees-Juen Chuang,1 et al
1Bioinformatics Research Center, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan;

...Numerous ab initio prediction programs have been used extensively in genome annotation, including FGENESH (Solovyev et al. 1995; Salamov and Solovyev 2000),
...Successful implementation of this method includes AAT (Huang et al. 1997), FGENESH+ and FGENESH++ (Salamov and Solovyev 2000),...
. Among these programs FGENESH+ (and FGENESH++), GenomeScan, GeneWise, and Procrustes are combined tools of sequence homology and ab initio annotation.


Annual Review of Genomics and Human Genetics Vol. 3: 293-310 (Volume publication date September 2002)

DATABASES AND TOOLS FOR BROWSING GENOMES

Ewan Birney,1 Michele Clamp,2 and Tim Hubbard2

1European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, United Kingdom; e-mail: birney@ebi.ac.uk
2Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, United Kingdom; michele@sanger.ac.uk th@sanger.ac.uk

... Another predicted gene track on the UCSC browser comes from Softberry ( http:/ / www.softberry.com ) and uses a program Fgenesh+, which is based on HMMs and ...


FGENESH++

BMC Genomics
2016 17:540 DOI: 10.1186/s12864-016-2843-7

Evolutionary and functional analysis of mulberry type III polyketide synthases

Li, H. et al.,
State Key Laboratory of Silkworm Genome Biology, Southwest University

... All hits were analyzed using the Fgenesh++ program (http://www.softberry.com) [21, 48]. ...


Biotechnology and Bioengineering
2015 DOI 10.1002/bit.25864

Engineering Rhodosporidium toruloides for increased lipid production

Zhang et al.,
1: Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America. 2: Department of Bioengineering, University of California, Berkeley, California, United States of America.

... Genome annotation was performed using an automated software pipeline FGENESH++ (http://www.softberry.com) version 3.1.1. Genes were first predicted ab initio using FGENESH... Gene prediction parameters were obtained from Softberry and were based on Puccinia spp. ...


Nature Genetics
45, 456–461 (2013) doi:10.1038/ng.2569

The draft genome of the fast-growing non-timber forest species moso bamboo (Phyllostachys heterocycla)

Peng et al.,
Research Institute of Forestry, Chinese Academy of Forestry, Key Laboratory of Tree Breeding and Cultivation, State Forestry Administration, Beijing, China. National Center for Gene Research, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China.

... as used in genomic sequencing. Annotation of protein-coding genes. Protein-coding gene models were derived from evidence-based FgeneSH++(Softberry) pseudomolecules (Supplementary Fig. 7). To facilitate gene models ...


Nature Genetics
43, 913–918 (2011) doi:10.1038/ng.889

The genome of the extremophile crucifer Thellungiella parvula

Dassanayake et al.,
Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois, USA. Office of Networked Information Technology, School of Integrative Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois, USA.

...Random shotgun genomic libraries were constructed according to the manufacturer's recommendations for each of the two pyrosequencing platforms, GS FLX Titanium (454 Life Sciences) and Illumina GA2 (Illumina). Newbler (454-Roche), ABySS29 and minimus2 (ref. 30) were used as the main assembly programs to generate the draft genome, and FGENESH++ (SoftBerry), GENSCAN, BLAST (see URLs) and Blast2GO12 were used to predict and annotate gene models. ... ...FGENESH++ (SoftBerry) was used to predict protein coding ORFs in the T. parvula draft genome masked for repetitive sequences, with parameters optimized for dicot plants and protein sequences from the NCBI non-redundant (NR) database as reference....


Insect Molecular Biology
Volume 19, Issue Supplement s2, pages 5–12, March 2010

AphidBase: a centralized bioinformatic resource for annotation of the pea aphid genome

Legeai et al.,
1 INRA UMR, Le Rheu cedex, France; 2 INRIA Centre Rennes – Bretagne Atlantique, GenOuest, Campus de Beaulieu, Rennes, France;

... Evidence-based prediction programs such as Augustus (Stanke et al., 2006), Fgenesh++ (unpubl., http://www.softberry.com) or the NCBI RefSeq pipeline are generally considered most reliable because they are better able to characterize untranslated regions (UTRs) and ... 


J. Proteome Res.
2010, 9 (2), pp 990–996 DOI: 10.1021/pr900885k

A Hybrid, de Novo Based, Genome-Wide Database Search Approach Applied to the Sea Urchin Neuropeptidome

Menschaert et al.,
Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Laboratory for Bioinformatics and Computational Genomics, Ghent University, B-9000 Ghent, Belgium

... The gene prediction program, Fgenesh++ (www.softberry.com), was applied to the genomic sequences corresponding to the newly identified peptides. The softberry gene finding software has a model trained for the sea urchin. ... 


Nature
2008, 452, 949 - 955.

The genome of the model beetle and pest Tribolium castaneum.

Richards et al.
1. Human Genome Sequencing Cente
2. Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA.

... Work at the BCM-HGSC was funded by grants from the NHGRI and USDA. FgenesH and FgenesH++ analysis was donated by Softberry Inc. This research was additionally supported in part by the Intramural...


Genome Biology
2006, 7(Suppl 1):S10 doi:10.1186/gb-2006-7-s1-s10

Automatic annotation of eukaryotic genes, pseudogenes and promoters

Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA

... The Fgenesh++ gene prediction pipeline can identify 91% of coding nucleotides with a specificity of 90%. ...


Am. J. Hum. Genet.,
76:652-662, 2005

Position Effects Due to Chromosome Breakpoints that Map 900 Kb Upstream and 1.3 Mb Downstream of SOX9 in Two Patients with Campomelic Dysplasia

Gopalrao V. N. Velagaleti,1,2,* et al,.
Departments of 1Pathology and 2Pediatrics, University of Texas Medical Branch, Galveston; Departments of 3Molecular and Human Genetics and 4Pediatrics, Baylor College of Medicine, and 5Texas Children's Hospital, Houston; and 6Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN

...In an effort to identify possible transcripts that may be responsible for the CD phenotype, we used several gene-prediction programs and identified seven hypothetical transcripts in the region that spans 100 kb in either direction from the breakpoint on chromosome 17 Ecgenes H17C12306.1 and H17C12308.1, SGP genes Chr17_1538.1 and Ch17_1539.1, Fgenesh++ gene C17001650, and Genscan genes NT_010641.44 and NT_010641.45....


Genome Research
15:566-576, 2005

ECgene: Genome-based EST clustering and gene modeling for alternative splicing

Namshin Kim1,2, Seokmin Shin2 and Sanghyuk Lee1,3
1 Division of Molecular Life Sciences, Ewha Womans University, Seoul 120-750, Korea; 2 School of Chemistry, Seoul National University, Seoul 151-747, Korea

...the structure of full-length mRNA can be inferred by examining the flanking genomic region, especially with the aid of ab initio gene predicting programs such as Genscan (Burge and Karlin 1997 ) and Fgenesh++ (Salamov and Solovyev 2000 )...


Plant Physiology
139:1612-1624 (2005)

Structure and Architecture of the Maize Genome

Haberer et al.,
Munich Information Center for Protein Sequences, Institute for Bioinformatics, Gesellschaft fur Strahlenforschung Research Center for Environment and Health, D–85764 Neuherberg, Germany (G.H., H.G., K.F.X.M.); Broad Institute of the Massachusetts Institute of Technology and Harvard, Cambridge, Massachusetts 02141 (S.Y., C.R., S.R., B.B., C.N.);

... Genes were detected by applying FGeneSH++ (Salamov and Solovyev, 2000 Go ;


Genome Research
14:685-692, 2004

Automated Whole-Genome Multiple Alignment of Rat, Mouse, and Human

Michael Brudno1 et al.
1 Department of Computer Science, Stanford University, Stanford, California 94305, USA;

... we built a three-way synteny map based on chains of Fgenesh++-predicted (Solovyev 2002 ) exons, rather than whole genes. ...


Genome Research
14:539-548, 2004

Characterization of Evolutionary Rates and Constraints in Three Mammalian Genomes

Gregory M. Cooper1 et al
1 Department of Genetics, Stanford University, Stanford, California 94305, USA;

....The gene annotations used to classify the constrained elements contain nearly 40,000 genes, including RefSeq genes and gene predictions; they are based on annotations for the human, mouse, and rat genomes made by Fgenesh++ software developed by Softberry Inc. (Solovyev 2002; http://www.softberry.com )....


Nucleic Acids Research,
2003, Vol. 31, No. 1 207-211

The PEDANT genome database

Dmitrij Frishman*,1 et al
1 Institute for Bioinformatics, GSF - National Research Center for Environment and Health, Ingolstadter Landstra?e 1, 85764 Neueherberg, Germany

... The mouse database contains 20 chromosome contigs with 37 793 genes predicted using the Fgenesh++ software (www.softberry.com). ...


Genome Research
13:1765-1774, 2003

Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay

Shirin Khambata-Ford1,5 et al
1 Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA;

...Of 858 sequences, 9% of GFP+ low clones and 8% of GFP+ high clones aligned to the 2-kb segment upstream of the transcription start site of a predicted gene in at least two of four data sets of predicted genes from Genscan, Ensembl, Softberry (Fgenesh++), and Acembly (category B in Table 1).


Genome Research
13:313-322 ©2003
Received March 27, 2002; accepted in revised form December 3, 2002.
Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.313703.

A Complexity Reduction Algorithm for Analysis and Annotation of Large Genomic Sequences

Trees-Juen Chuang,1 et al
1Bioinformatics Research Center, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan;

...Numerous ab initio prediction programs have been used extensively in genome annotation, including FGENESH (Solovyev et al. 1995; Salamov and Solovyev 2000),
...Successful implementation of this method includes AAT (Huang et al. 1997), FGENESH+and FGENESH++ (Salamov and Solovyev 2000),...
. Among these programs FGENESH+ (and FGENESH++), GenomeScan, GeneWise, and Procrustes are combined tools of sequence homology and ab initio annotation.


Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297

Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene

Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA

... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms (http://www.softberry.com/berry.phtml) were initially employed. ...


Cell,
Vol. 110, 521-529, August 23, 2002, Copyright .2002 by Cell Press

HIV-1 Integration in the Human Genome Favors Active Genes and Local Hotspots

Astrid R.W. Schroder,1 et al
1Infectious Disease Laboratory

...An integration target sequence was scored as a part of a transcrip-tion unit if it was (1) a member of the Refseq set of well-studied genes (http://www.ncbi.nlm.nih.gov/LocusLink/refseq.html) or (2) if , it was predicted to be a transcription unit by the ENSEMBLE (http://www.ensembl.org) or Fgenesh++ (http://www.softberry.com/Help/fgeneshplus2.htm) programs and if that assignment was supported by mRNA or spliced EST sequence evidence.


Genome Res.
2002. 12: 1549-1555

Mosaic Organization of Orthologous Sequences in Grass Genomes

Rentao Song, Victor Llaca 1, and Joachim Messing 2
Waksman Institute, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854-8020, USA

... Gene prediction was based on both GeneScan (http://genes.mit.edu/Genscan.html) and FGENESH++ (http://www.softberry.com./berry.phtml?topic=gfind). ...


Reprint from
Daily Biotech Updates . . . www .genengnews.com

Vol. 22, No. 17 , October 1, 2002

DrugDiscovery
Tech Note:An Enhanced Human-Genome Database Transforming Raw Human Sequence Data Into Useful Information

Christine Schuller, Ph.D., and Andreas Fritz, Ph.D

The Softberry analysis results, for which Biomax has the exclusive world-wide commercial license, contain approximately 40,000 genes, which agrees well with predictions of the total number of human genes (according to the International Human Genome Sequencing Consortium, or IHGSC).
... For example, 50% of the genes in the Biomax Human Genome Database are not found in the Ensembl database. ..
These genes (identified by FGENESH++ and Biomax, and not found in Ensembl database) comprise the following: 6% of genes classified as known genes, 50% classified as having some similarity to known genes, and 90% of the genes not having similarity to known genes
For human genome applications, the FGENESH++ software was first used to map known human genes using sequences available from the Reference Sequence (RefSeq) Project at the Nation al Center for Biotechnology Information (NCBI; Bethesda, MD; www.ncbi.nlm. nih.gov/LocusLink/refseq.html).
REFERENCES
1. Salamov AA and Solovyev VV,Ab initio gene finding in Drosophila genomic DNA. Genome Res 10: 391-7 (2000).


FGENESH-C

The FASEB Journal
January 2013 vol. 27 no. 1 86-97 DOI:10.1096/fj.12-219444

Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female

Dottorini et al.,
*Department of Experimental Medicine and †Department of Industrial Engineering, University of Perugia, Perugia, Italy; ‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK; and §Department of Genetics, University of Cambridge, Cambridge, UK

... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted using FGENESH-C, FGENESH+ (http://linux1.softberry.com/), Wise2 (http://www.ebi.ac.uk/), and Genescan (http://genes.mit.edu/GENSCAN.html). Mosquito rearing and mating analysis. ...


Gene
Volume 528, Issue 2, 10 October 2013, Pages 267–276 DOI:10.1016/j.gene.2013.06.062

The metacaspase gene family of Vitis vinifera L.: Characterization and differential expression during ovule abortion in stenospermocarpic seedless grapes

Zhang et al.,
a College of Horticulture, Northwest A&F University, Yangling, Shaanxi 712100, China b Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Northwest Region), Ministry of Agriculture, Yangling, Shaanxi 712100, China

... Intron and exon organizations of metacaspases were analyzed by using FGENESH-C (http://linux1.softberry.com/berryphtml?topic=fgenes_c&group=programs&subgroup=gfs); to determine the locations of metacaspases on chromosomes, the metacaspases were further used ...


The FASEB Journal
Published online before print September 20, 2012 DOI: 10.1096/fj.12-219444

Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female

Dottorini et al.,
*Department of Experimental Medicine and †Department of Industrial Engineering, University of Perugia, Perugia, Italy; ‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK;

... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted using FGENESH-C, FGENESH (http://linux1.softberry.com/), Wise2 (http:// www.ebi.ac.uk/), and Genescan (http://genes.mit.edu/ GENSCAN.html). Mosquito rearing and mating analysis ...


J. Exp. Bot.
(2011) 62 (15): 5641-5658. doi: 10.1093/jxb/err249

Flowering time variation in oilseed rape (Brassica napus L.) is associated with allelic variation in the FRIGIDA homologue BnaA.FRI.a

Wang et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China

... online). The genes were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) with FRI and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml). ...


J. Exp. Bot.
(2011) 62 (10): 3359-3374. doi: 10.1093/jxb/erq321

Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

Abou-Elwafa et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK

... Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...


J. Exp. Bot.
2010 doi: 10.1093/jxb/erq321

Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

Abou-Elwafa et al.,
1 Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany 2 Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK

.. Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2; http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...


FGENESH-2

PLoS ONE
(2013), 8(1): e53525. doi:10.1371/journal.pone.0053525

A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s.

Dalman et al.,
Uppsala BioCenter, Department of Forest Mycology and Plant Pathology, Swedish University of Agricultural Sciences, Uppsala, Sweden

...he gene annotations found in TC32-1 were transferred to the reference sequence using PROT_MAP, FGENESH-2 (SoftBerry, Mount Kisco, NY) and Artemis ...


Eukaryotic Cell
August 2010, p. 1225-1235, Vol. 9, No. 8 doi:10.1128/EC.00031-10

Methylenetetrahydrofolate Reductase Activity Is Involved in the Plasma Membrane Redox System Required for Pigment Biosynthesis in Filamentous Fungi

Frandsen et al.,
Division

... MTHFR homologs in complete Ascomycota genomes were identified in the listed databases using the blastp and tblastn algorithms with default settings (1). All Pezizomycotina tblastn hits were annotated using FGENEH-2 from Softberry (Mount Kisco, NJ) with FgMET13p as a ... 


J Immunol.
2010 Feb 1;184(3):1379-91. Epub 2009 Dec 21

A small, variable, and irregular killer cell Ig-like receptor locus accompanies the absence of MHC-C and MHC-G in gibbons

Abi-Rached et al.,
Department of Structural Biology, Stanford University, Stanford, CA 94305, USA.

... Foster City, CA). Exons and introns of genes were either identified manually or by using the BLAST (www.ncbi.nlm.nih.gov/BLAST) and FGENESH-2 (www.softberry. com/all.htm) algorithms. Phylogenetic analysis of KIR. KIR gene ... 


The Journal of Immunology
2009, doi:10.4049/jimmunol.0903016

A Small, Variable, and Irregular Killer Cell Ig-Like Receptor Locus Accompanies the Absence of MHC-C and MHC-G in Gibbons

Abi-Rached et al.,
Department of Structural Biology, Stanford University, Stanford, CA 94305; Max Planck Institute for Molecular Genetics, Berlin-Dahlem

... Biosystems, Foster City, CA). Exons and introns of genes were either identified manually or by using the BLAST (www.ncbi.nlm.nih.gov/ BLAST) and FGENESH-2 (www.softberry.com/all.htm) algorithms. Phylogenetic analysis of KIR ...


PLoS Genet.
2009 Oct;5(10):e1000688. Epub 2009 Oct 16.

A novel system of polymorphic and diverse NK cell receptors in primates

Averdam et al.,
Department of Primate Genetics, German Primate Centre, Gottingen, Germany.

... Both programs are available from Phil Green, University of Washington. Exons and introns of genes were identified in finished BAC clone sequences manually or by BLAST and FGENESH-2 algorithms (http://www.ncbi.nlm.nih.gov/BLAST/; http://www.softberry.com/all.htm). ...


The Journal of Immunology
2007, 178: 7151-7161.

Genomics and Diversity of the Common Marmoset Monkey NK Complex

Anne Averdam et al.,
Department of Primate Genetics and Primate Husbandry, German Primate Center, Gottingen, Germany; Max Planck Institute for Molecular Genetics, Berlin, Germany; and Department of Biological Sciences, University of South Carolina, Columbia, SC 29208

... BLAST and FGENESH-2 algorithms (http://www.ncbi.nlm.nih.gov/BLAST/; http://www.softberry.com/all.htm) identified exons and introns of genes in finished BAC ...


FGENESH++C

Nucleic Acids Research,
2006, Vol. 34, Database issue D568-D571

The Mouse Functional Genome Database (MfunGD): functional annotation of proteins in the light of their cellular context

Andreas Ruepp1,* et al.,
1Institute for Bioinformatics (MIPS), GSF National Research Center for Environment and Health Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany

... The basis of the MfunGD dataset is a complement of gene products that was obtained by Softberry Inc., which used the FGENESH++C software as gene predictor. ...


Nature
425, 209-215 (11 September 2003) | doi:10.1038/425209a

Bioinformatics: Programmed for success

Steve Buckingham

... Three-way synteny from Softberry. Fast searching is also a feature of Genome Explorer from Softberry in Mount Kisco, New York, which uses the FMAP algorithm. ... ...... Softberry, for example, offers a number of gene-prediction programs that can be accessed over the web, including FGENESH, which ... The fully automated FGENESH++C will automatically annotate any genome (other than human) to a standard claimed to be indistinguishable ...


FGENESB

BMC Genomics
2016, 17:326 DOI: 10.1186/s12864-016-2680-8

Xylan degradation by the human gut Bacteroides xylanisolvens XB1A T involves two distinct gene clusters that are linked at the transcriptional level

Despres, J. et al.,
Institut National de la recherche Agronomique (INRA), UR454 Microbiologie; INRA, Plate-forme d’Exploration du Metabolisme

... Putative promoters and terminators were searched within intergenic sequences (>100 bp) using different tools (BPROM, PPP, Arnold) available at http://molbiol-tools.ca/Promoters.htm. Operon prediction was carried out using FGENESB, which is based on distances between ORFs and frequencies of different genes neighboring each other in known bacterial genomes, as well as on promoter and terminator predictions (http://www.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...


PloS one
2016, 11(1), e0146832.

Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum"

Ullrich, S. R. et al.,
Institute of Biological Sciences, TU Bergakademie Freiberg, Leipziger Stra?e 29, Freiberg, Germany; Georg-August-University Gottingen, Genomic and Applied Microbiology & Gottingen Genomics Laboratory, Grisebachstra?e 8, Gottingen, Germany

... Regulatory sequences within the urease gene cluster were predicted using the software FGENESB with default settings (Softberry Inc., Mount Kisco, NY, USA). ...


Gene
Volume 593, Issue 1, 15 November 2016, Pages 154–161 http://dx.doi.org/10.1016/j.gene.2016.08.009

Identification and in silico characterization of two novel genes encoding peptidases S8 found by functional screening in a metagenomic library of Yucatan underground water

Apolinar–Hernandez, M. M. et al.,
a Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan A.C., Calle 43 No. 130, Chuburna de Hidalgo, Merida, Yucatan CP 97200, Mexico b El Colegio de la Frontera Sur (ECOSUR) Unidad Campeche, Avenida Rancho Poligono 2A, Ciudad Industrial Lerma, Campeche, Campeche CP 24500, Mexico

... ORFs in the contigs were predicted by using the Glimmer3 system (with default parameters) (Salzberg et al., 1998), and results were verified with fgenesB (Solovyev and Salamov, 2011) (http://www.softberry.com/berry.phtml?topic=fgenesb). ...


Curr Genet
2016 DOI 10.1007/s00294-016-0568-4

Genome-wide bioinformatics analysis of steroid metabolism-associated genes in Nocardioides simplex VKM Ac-2033D

Donova, V. et al.,
1 Department of Bioengineering and Bioinformatics, M.V. Lomonosov Moscow State University, Leninskie Gory, h. 1, b. 73, Moscow 119991, Russian Federation 2 Institute for Information Transmission Problems, Russian Academy of Sciences, Bolshoy Karetny per. 19, b. 1, Moscow 127051, Russian Federation

... The complete genome sequence in GenBank: CP009896. Operons with found genes were calculated with internet-service FgenesB (http://linux1.softberry.com/ berry.phtml?topic=fgenesb&group=programs&subgroup =gfindb). ...


Applied and environmental microbiology
2016, 82(1), 192-201. doi: 10.1128/AEM.01827-15

A novel bacteriophage targeting Cronobacter sakazakii is a potential biocontrol agent in foods

Lee, J. H. et al.,
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, South Korea bDepartment of Food Science and Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin, South Korea

... All of the open reading frames (ORFs) were predicted with the bacterial genetic code parameter using the Glimmer version 3.02 (29), GeneMarkS (30), and FgenesB software programs (Softberry, Inc., Mount Kisco, NY, USA), and their ribosomal binding sites were confirmed by ...


PloS one
2016, 11(5), e0155537. http://dx.doi.org/10.1371/journal.pone.0155537

Falsirhodobacter sp. alg1 Harbors Single Homologs of Endo and Exo-Type Alginate Lyases Efficient for Alginate Depolymerization

Mori, T. et al.,
Faculty of Science and Engineering, Waseda University, Tokyo, Japan Department of Life Sciences, Graduate School of Bioresources, Mie University, Mie, Japan

...Operon and standalone genes were predicted using the FGENESB online prediction tool (Softberry) [25]. ...


Frontiers in microbiology
2016, 7: 687. doi: 10.3389/fmicb.2016.00687

The rnc Gene Promotes Exopolysaccharide Synthesis and Represses the vicRKX Gene Expressions via MicroRNA-Size Small RNAs in Streptococcus mutans

Mao, M. Y. et al.,
1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China 2Department of Dentistry, Yan'an Hospital Affiliated to Kunming Medical University, Kunming, China

... We first analyzed these intergenic noncoding sequences by FGENESB and BPROM programs for operon and promoter prediction, respectively (http://linux1.softberry.com/berry.phtml) (Solovyev and ...


Plasmid
2016, Volumes 84–85, March–May 2016, Pages 36–43. doi:10.1016/j.plasmid.2016.02.005

The ancient small mobilizable plasmid pALWED1. 8 harboring a new variant of the non-cassette streptomycin/spectinomycin resistance gene aadA27

Kurakov, A. et al.,
a Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov sq. 2, 123182 Moscow, Russia b Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, 119071 Moscow, Russia

.. Putative ORFs and promoters were detected using BPROM, FGENESB (http://www.softberry.com/berry.html), and GeneMark.hmm for ...


Current genetics
2016, Volume 62, Issue 3, pp 643-656 DOI: 10.1007/s00294-016-0568-4

Genome-wide bioinformatics analysis of steroid metabolism-associated genes in Nocardioides simplex VKM Ac-2033D

Shtratnikova, V. Y., et al.,
Department of Bioengineering and Bioinformatics, M.V. Lomonosov Moscow State University Institute for Information Transmission Problems, Russian Academy of Sciences

.. Operons with found genes were calculated with internet-service FgenesB (http://linux1.softberry.com/ berry.phtml?topic=fgenesb&group ...


Standards in Genomic Sciences
2016, 11:36 DOI: 10.1186/s40793-016-0161-y

Draft genome sequence of Fusicladium effusum, cause of pecan scab

Bock, C. H., Chen, C., Yu, F., Stevenson, K. L., Wood, B. W.
Southeastern Fruit and Tree Nut Research Lab, USDA, Agricultural Research Service

... Ab initio gene prediction with the FGENESB package (Softberry Inc.) predicted...


Virus research
2016, 155(2), 433-439. doi:10.1016/j.virusres.2010.11.012

The genome sequence and proteome of bacteriophage ?CPV1 virulent for Clostridium perfringens

Volozhantsev, N. V. et al.,
a State Research Center for Applied Microbiology & Biotechnology, Obolensk, Moscow Region, Russian Federation b Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA 30605, USA

... genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology. gatech.edu/GeneMark; Lukashin and Borodovsky, 1998) and SoftBerry FGENESB (http ...


The ISME Journal
2016 doi:10.1038/ismej.2016.59

A mobile genetic element profoundly increases heat resistance of bacterial spores

Berendsen, E. M., Boekhorst, J., Kuipers, O. P., Wells-Bennik, M. H.

... et al., 2005). For B. subtilis strains, detailed gene and operon predictions within the Tn1546 transposon were made using FGENESB (www.softberry.com) and predictions were manually inspected. Specific insertion locations ...


FEMS microbiology letters
2016, 363(12), fnw092. DOI: http://dx.doi.org/10.1093/femsle/fnw092

Characterization of LysPBC4, a novel Bacillus cereus-specific endolysin of bacteriophage PBC4

Na, H., Kong, M., Ryu, S.
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921, South Korea

... 2007), GeneMark (Besemer, Lomsadze and Borodovsky 2001), FGENESB (Softberry, Inc., Mount Kisco, NY) and ARAGORN (Laslett and Canback 2004) software. The function of each ORF was predicted using NCBI BLASTP and InterProScan (Altschul et al. 1990) databases. ...


Frontiers in microbiology
2014, 5: 189. DOI: 10.3389/fmicb.2014.00189

Combined metagenomic and phenomic approaches identify a novel salt tolerance gene from the human gut microbiome.

Culligan, E. P., Marchesi, J. R., Hill, C., & Sleator, R. D.
1Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Cork, Ireland 2School of Microbiology, University College Cork, Cork, Ireland 3Cardiff School of Biosciences, Cardiff University, Cardiff, UK

... The retrieved sequence was analyzed using the FGENESB software program (Softberry) to identify putative open reading frames and translated nucleotide sequences were subjected to BLASTP analysis to assign putative functions to the encoded proteins and identify ...


Genome announcements
2014, 2(2), e00194-14. DOI: 10.1128/genomeA.00194-14

Draft genome sequence of Trueperella pyogenes, isolated from the infected uterus of a postpartum cow with metritis

Goldstone R. J. et al.,
aInstitute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, United Kingdom bInstitute of Life Science, School of Medicine, Swansea University, Singleton Park, Swansea, United Kingdom

... The prediction of open reading frames (ORFs) was achieved using FgenesB (8) via the SoftBerry web interface (http://linux1.softberry.com/berry.phtml), rRNA prediction was carried out via the HMMER Web server (9), and tRNA prediction was done using tRNAscan-SE via the ...


BioMed Research International
2014, Article ID 489782, 7 pages DOI: 10.1155/2014/489782

Characterization of the Opp Peptide Transporter of Corynebacterium pseudotuberculosis and Its Role in Virulence and Pathogenicity

Moraes P. M. R. O. et al.,
1Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG, Brazil 2Instituto de Ciencias da Saude, Universidade Federal da Bahia, 40210-340 Salvador, BA, Brazil

... bacteria was performed using the Artemis software. The operon analyses were performed using SoftBerry (http://linux1.softberry.com/berry.phtml?topic= fgenesb&group=help&subgroup=gfindb). A similarity analysis of the genes ...


PloS one
2014, 9(2), e90087. DOI: 10.1371/journal.pone.0090087

New Hydrocarbon Degradation Pathways in the Microbial Metagenome from Brazilian Petroleum Reservoirs

Sierra-Garcia I. N. et al.,
Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas - UNICAMP, Campinas, Brazil Laboratory of Genomics and Expression, University of Campinas - UNICAMP, Campinas, Brazil

... several tools available for gene prediction in prokaryotes through heuristic approaches: Metagene [14] http://metagene.cb.ku-tokyo.ac.jp/) and MetaGeneMark [15] designed for metagenomic sequences, GLIMMER 3.02 [16], [17] and FGENESB (http://linux1.softberry.com/berry ... ...Putative ribosomal binding sites were identified using RBSFINDER [22], and the presence of bacterial promoters and transfer RNA genes was predicted using the programs BPROM (http://linux1.softberry.com/berry.phtml) and tRNAscan-SE [23], respectively. ...


Plasmid
2014, 71, 23-31. DOI: 10.1016/j.plasmid.2013.10.002

Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains

Kananaviciute, R., Butaite, E., Citavicius, D.
Department of Microbiology and Biotechnology, Faculty of Natural Sciences, Vilnius University, M. K. Ciurlionio 21/27, Vilnius LT-03101, Lithuania

... sequencing of remaining fragments. Open reading frames (ORFs) were predicted using ORF Finder Program at NCBI website and FGENESB program at Softberry site (http://linux1.softberry.com/berry.phtml). Potential protein-coding ...


Applied microbiology and biotechnology
2014, 98(5), 2145-2154. DOI: 10.1007/s00253-013-5126-0

Molecular cloning and characterization of a novel acetylalginate esterase gene in alg operon from Sphingomonas sp. MJ-3

Park Y. J. et al.,
1. Department of Food Science and Biotechnology, Kyungsung University, Busan, 608-736, Korea 2. College of Pharmacy, Kyungsung University, Busan, 608-736, Korea

... The PCR primers used for screening and sequencing are listed in Table 1. The positive fosmid DNAs were sequenced, and then genes or operon were ana- lyzed by using fgenesb program (http://linux1.softberry.com/ berry.phtml) and ORF finder (http://www.ncbi.nlm.nih.gov ...


Genome announcements
2014, 2(2), e00243-14. DOI: 10.1128/genomeA.00243-14

Genome sequence of a hyperthermophilic archaeon, Thermococcus nautili 30-1, that produces viral vesicles

Oberto J. et al.,
aUniversite Paris-Sud, CNRS, UMR8621, Institut de Genetique et Microbiologie, Orsay, France bFidelity Systems, Inc., Gaithersburg, Maryland, USA cInstitut Pasteur, Paris, France

... 16 ? 10 6 reads assembled with Velvet (3). Genome assembly was performed with Consed (4). The remaining gaps were filled using bacterial artificial chromosome (BAC) sequencing with Thermofidelase and Fimers (5). Genes were annotated using FGENESB (Softberry). ...


Journal of biotechnology
2014, 174, 14-15. DOI: 10.1016/j.jbiotec.2014.01.022

Complete genome sequence of hyperthermophilic archaeon Thermococcus sp. ES1

Jung J. H. et al.,
a Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea b Department of Biotechnology, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute (KAERI), Jeongeup 580-185, Republic of Korea

... polymerase chain reactions. GeneMarkS ( Besemer et al., 2001), Glimmer 3.02 ( Delcher et al., 2007), and FgenesB (Softberry, Inc., Mount Kisco, NY) were used to predict open reading frames (ORFs). Their functions were verified ...


Journal of biotechnology
2014, 179, 15-16. DOI: 10.1016/j.jbiotec.2014.03.009

Draft genome sequence of Xanthomonas axonopodis pv. glycines 8ra possessing transcription activator-like effectors used for genetic engineering

Lee J. H. et al.,
a Department of Food Science and Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea b Department of Food and Animal Biotechnology, and Department of Agricultural Biotechnology, Center for Food and Bioconvergence, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Republic of Korea

... in Macrogen (Korea). ORF prediction was conducted using applications such as Glimmer3 (Delcher et al., 2007), GeneMarkS (Besemer et al., 2001), and FgenesB (Softberry, Inc., Mount Kisco, NY). Functional analysis of all ...


Archives of Virology
January 2014, Volume 159, Issue 1, pp 159-162 DOI: 10.1007/s00705-013-1776-6

Complete genome sequence of marine bacterium Pseudoalteromonas phenolica bacteriophage TW1

Hakdong Shin, Ju-Hoon Lee, Chi Sang Ahn, Sangryeol Ryu, Byung Cheol Cho
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, 151-921, Korea 3. Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Korea

... using a GS-FLX pyrosequencer at Macrogen, Seoul, South Korea, and the qualified sequence reads were assembled using Newbler v2.3. The open reading frames (ORFs) in the genome were predicted using GeneMarkS [ 2 ], Glimmer3 [ 5 ], and FgenesB (Softberry, Inc., Mount ...


Archives of virology
2014, 1-4. DOI: 10.1007/s00705-014-2140-1

Complete genome sequence of enterobacteria phage 4MG, a new member of the subgroup "PVP-SE1-like phage" of the "rV5-like viruses"

Kim M., Heu S., Ryu S.
1. Department of Agricultural Biotechnology, Seoul National University, Seoul, 151-921, South Korea 3. Microbial Safety Division, National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, South Korea

... A single contig assembled with quality-filtered reads was analyzed using the tools GeneMarkS [ 10 ], Glimmer 3.02 [ 11 ], and FgenesB (Softberry, Inc., NY, USA) for prediction of open reading frames (ORFs), BlastP [ 12 ], InterProScan [ 13 ], and NCBI Conserved Domain ...


AMB Express
2014, 4(1), 23. http://www.amb-express.com/content/4/1/23

Cloning, expression and characterization of a versatile Baeyer-Villiger monooxygenase from Dietzia sp. D5.

Bisagni, S., Hatti-Kaul, R., Mamo, G.
Department of Biotechnology, Center for Chemistry and Chemical Engineering, Lund University, P.O. Box 124, SE-22100 Lund, Sweden

... D5 (unpublished data). Identification of ORFs and ana- lysis of the BVMO4 gene and its deduced protein se- quence was performed with CLCBio Main Workbench (Aarhus, Denmark) FGENESB (Soft Berry Mount Nysco, USA) and BLASTp at NCBI. ...


Environmental microbiology
2014, 16(5), 1334-1345. DOI:10.1111/1462-2920.12440

Biosynthetic genes and activity spectrum of antifungal polyynes from Collimonas fungivorans Ter331

Fritsche K. et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Wageningen, The Netherlands 2 BioDetection Systems b.v., Amsterdam, The Netherlands

... al., 2011). Gene colours indicate predicted function (see Supporting Information Table S1). Arrowed lines above the genes indicate operonic organization, as predicted by FgenesB (http://www.softberry.com). Black arrow heads ...


Functional & integrative genomics
2014, 1-10. DOI:10.1007/s10142-014-0375-2

Arsenic and cadmium are inhibitors of cyanobacterial dinitrogenase reductase (nifH1) gene

Singh, S., Shrivastava, A. K., Singh, V. K.
1. Molecular Biology Section, Laboratory of Algal Biology, Center of Advanced Study in Botany and Department of Bioinformatics, Banaras Hindu University and Shobhit University, Varanasi and Meerut, 221005, India 2. Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India

... This was followed by FGeneSH B (Salamov and Solovyev 2000) (http://linux1.softberry.com/) to find out the bacterial operon and to predict transcription regulation within nifH1. Promoter analysis Virtual footprint 3.0 (Munch et al. 2005) (http://prodoric.tu-bs. ...


Microbial ecology
March 2014. DOI:10.1007/s00248-014-0388-3

Phylogenetic and Functional Analysis of Gut Microbiota of a Fungus-Growing Higher Termite: Bacteroidetes from Higher Termites Are a Rich Source of b-Glucosidase Genes

Zhang, M. et al.,
1. School of Life Sciences, East China Normal University, Shanghai, China 3. Key Laboratory of Insect Development and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China

... 27, 28]. If 50 % ORFs of a contig were all binned to the same phylum, this contigs could be assigned to this phylum [21]. The ORFs of contigs were predicted by FgenesB (Softberry, Goteborg, Sweden). ?-Glucosidases were ...


PLOS ONE
December 12, 2013 DOI: 10.1371/journal.pone.0082985

Functional Environmental Screening of a Metagenomic Library Identifies stlA; A Unique Salt Tolerance Locus from the Human Gut Microbiome

Eamonn P. Culligan, Roy D. Sleator, Julian R. Marchesi, Colin Hill
Alimentary Pharmabiotic Centre, University College Cork, Cork, Ireland, School of Microbiology, University College Cork, Cork, Ireland Cardiff School of Biosciences, Cardiff University, Cardiff, United Kingdom, Department of Hepatology and Gastroenterology, Imperial College London, London, United Kingdom

... platform on a titanium mini-run. Putative open reading frames were predicted using Softberry FGENESB bacterial operon and gene prediction software (available at www.softberry.com). Retrieved nucleotide and translated amino ...


J. Virol. November
2013 vol. 87 no. 21 11775-11786 DOI:10.1128/JVI.02173-13

Antirepression System Associated with the Life Cycle Switch in the Temperate Podoviridae Phage SPC32H

Minsik Kim and Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, South Korea

... were assembled using the GS de novo assembler (v. 2.60), and the open reading frames (ORFs) that encode proteins of more than 35 amino acids in size were predicted using the software programs GeneMarkS (17), Glimmer 3.02 (18), and FgenesB (Softberry, Inc., Mount ...


MicrobiologyOpen
Volume 2, Issue 5, pages 717–724, October 2013 DOI:10.1002/mbo3.110

Characterization of mineral phosphate solubilization traits from a barley rhizosphere soil functional metagenome

Chhabra et al.,
1 Department of Science and Health, Institute of Technology Carlow, Carlow, Ireland 2 Department of Microbiology, University College Cork, Cork, Ireland

... The gene calling of sequenced data was carried out using the Fgenesb annotator pipeline (Softberry Inc., Mount Kisco, NY) (http://linux1.softberry.com), GeneMark.hmm prediction tool (http://exon.gatech.edu/genemark/) (Besemer and Borodovsky 1999) and ORF Finder (open ...


MicrobiologyOpen
Volume 2, Issue 4, pages 674–683, August 2013 DOI:10.1002/mbo3.104

Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems

Vercammen et al.,
1Department of Bioengineering Sciences, Research group Microbiology and VIB Department of Structural Biology, Vrije Universiteit Brussel, Brussels, Belgium 2Ecologie des Systemes Aquatiques, Universite Libre de Bruxelles, Campus de la Plaine, Brussels, Belgium 3Genetique et Physiologie Bacterienne, Universite Libre de Bruxelles, IBMM-DBM, Gosselies, Belgium

... The sequences were assembled using CAP3 version 3 (available at Mobyle Pasteur: http://mobyle.pasteur.fr/cgi-bin/portal.py#forms::cap3) and annotated by the free online program Softberry (http://linux1.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup ...


Applied Microbiology and Biotechnology
July 2013 DOI:10.1007/s00253-013-5126-0

Molecular cloning and characterization of a novel acetylalginate esterase gene in alg operon from Sphingomonas sp. MJ-3

Yoo Jung Park, Yu Jeong Chu, Young Hee Shin, Eun Yeol Lee, Hee Sook Kim
1. Department of Food Science and Biotechnology, Kyungsung University, Busan, 608-736, Korea 2. College of Pharmacy, Kyungsung University, Busan, 608-736, Korea 3. Department of Chemical Engineering, Kyung Hee University, Gyeonggi-do, 446-701, Korea

... The PCR primers used for screening and sequencing are listed in Table 1. The positive fosmid DNAs were sequenced, and then genes or operon were ana- lyzed by using fgenesb program (http://linux1.softberry.com/ berry.phtml) and ORF finder (http://www.ncbi.nlm.nih.gov ...


Genome Announc.
May/June 2013 vol. 1 no. 3 e00235-13 doi: 10.1128/genomeA.00235-13

Complete Genome Sequence of Xanthomonas citri subsp. citri Strain Aw12879, a Restricted-Host-Range Citrus Canker-Causing Bacterium

Jalan et al.,
Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, Florida, USAa; Waksman Genomics Core Facility, Rutgers University, Busch Campus, Piscataway, New Jersey, USAb;

... between the 454 scaffolds. PCR amplification and Sanger sequencing were used to close the remaining gaps, and Softberry's FgenesB pipeline was used for finding protein coding sequences (CDS). The predicted CDS were ...


Genome Announc.
May/June 2013 vol. 1 no. 3 e00356-13 DOI:10.1128/genomeA.00356-13

Draft Genome Sequence of Methylobacterium mesophilicum Strain SR1.6/6, Isolated from Citrus sinensis

Almeida et al.,
Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Para, Brazila Departamento de Microbiologia, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Biomedicas II, Cidade Universitaria, Sao Paulo, Sao Paulo, Brazilb

... The functional annotation was performed using FgenesB (SoftBerry), RNAmmer (10), tRNAscan-SE (11), Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html), and InterProScan (12). In addition, manual annotation was also performed using Artemis software (13). ...


Genome Announc.
March/April 2013 vol. 1 no. 2 e00141-13 DOI:10.1128/genomeA.00141-13

Genome Sequence of Thalassolituus oleivorans MIL-1 (DSM 14913T)

Golyshin et al.,
School of Biological Sciences, Bangor University, Bangor, Gwynedd, United Kingdoma; Max Planck Institute for Marine Microbiology, Bremen, Germanyb;

... The final assembly contains 12,110,290 short-insert library reads and provides 294? coverage of the genome. The automated genome annotation was performed at Fidelity Systems Ltd., using FgenesB 2.0 (SoftBerry, Inc., NY). ...


Archives of Virology
Volume 159, Issue 1 , pp 159-162 DOI:10.1007/s00705-013-1776-6

Complete genome sequence of marine bacterium Pseudoalteromonas phenolica bacteriophage TW1

Hakdong Shin, Ju-Hoon Lee, Chi Sang Ahn, Sangryeol Ryu, Byung Cheol Cho
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, 151-921, Korea 3. Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Korea

... using a GS-FLX pyrosequencer at Macrogen, Seoul, South Korea, and the qualified sequence reads were assembled using Newbler v2.3. The open reading frames (ORFs) in the genome were predicted using GeneMarkS [ 2 ], Glimmer3 [ 5 ], and FgenesB (Softberry, Inc., Mount ...


Archives of Virology
Volume 158, Issue 10 , pp 2179-2183 DOI:10.1007/s00705-013-1700-0

Complete genome sequence analysis of bacterial-flagellum-targeting bacteriophage chi

Ju-Hoon Lee, Hakdong Shin, Younho Choi, Sangryeol Ryu
2. Department of Food Science and Biotechnology, Kyung Hee University, Yongin, 446-701, Korea 1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea

... Roche) at Macrogen, Inc. (Seoul, South Korea). Open reading frames (ORFs) were predicted using gene prediction programs such as Glimmer3 [ 13 ], GeneMarkS [ 3 ], and FgenesB (Softberry, Inc. Mount Kisco, NY, USA) and ...


Plant Science
Volume 211, October 2013, Pages 8–16 DOI:10.1016/j.plantsci.2013.06.008

Alterations in lignin content and phenylpropanoids pathway in date palm (Phoenix dactylifera L.) tissues affected by brittle leaf disease

Saidi et al.,
a Laboratoire des Biotechnologies Vegetales Appliquees a l’Amelioration des Cultures, Ecole Nationale d’Ingenieurs de Sfax, Route Soukra Km 4, B.P 1173, 3038 Sfax, Tunisia b Centre de Recherches Phoenicicoles, 2260 Degache, Tunisia

.. and motif searches were performed on the protein sequences using Pfam (http://www.sanger. ac.uk/software/pfam), protein which did not exhibit the appropriate protein motif were re-predicted and manually corrected by using Fgenesh software (http://linux1.softberry.com/berry ...


Plasmid
Volume 70, Issue 2, September 2013, Pages 284–287 DOI:10.1016/j.plasmid.2013.06.001

pDB2011, a 7.6 kb multidrug resistance plasmid from Listeria innocua replicating in Gram-positive and Gram-negative hosts

David Bertsch, Janine Anderegg, Christophe Lacroix, Leo Meile, Marc J.A. Stevens
Laboratory of Food Biotechnology, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich, Switzerland

... Microsynth AG). Open reading frames (ORFs) were identified using the bacterial operon and gene prediction tool FGENESB (www.softberry.com). Annotation was done using BLAST (http://ncbi.nlm.nih.gov/blast/Blast.cgi). The ...


Appl. Environ. Microbiol.
March 2013 vol. 79 no. 5 1428-1435 DOI:10.1128/AEM.03291-12

Use of a Novel Escherichia coli-Leuconostoc Shuttle Vector for Metabolic Engineering of Leuconostoc citreum To Overproduce D-Lactate

Han Seung Chae a, Seung Hwan Lee b, Ju-Hoon Lee c, Si Jae Park d and Pyung Cheon Lee a
aDepartment of Molecular Science and Technology, Ajou University, Woncheon-dong, Yeongtong-gu, Suwon, South Korea bChemical Biotechnology Research Center, Korea Research Institute of Chemical Technology (KRICT), Yuseong-gu, Daejeon, South Korea

... DNA and amino acid sequences were analyzed using the DNASTAR and Artemis12 software (20) programs. Prediction of open reading frames (ORFs) was conducted using the GeneMark (21) and FgenesB (Softberry, Mount Kisco, NY) programs. ...


J Gen Virol
November 2013 vol. 94 no. Pt 11 2569-2576 DOI:10.1099/vir.0.053991-0

Characterization and genomic analysis of two Staphylococcus aureus bacteriophages isolated from poultry/livestock farms

Hyunjin Yoon et al.,
1Department of Food Technology and Services, College of Health Industry, Eulji university, Seongnam 461-713, Korea 2Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, Seoul National University, Seoul 151-921, Korea

... ORFs were predicted with Glimmer 3 (Delcher et al., 2007), GeneMarkS (Besemer et al., 2001) and FgenesB (http://linux1.softberry.com/berry.phtml). RBS finder (Suzek et al., 2001), which facilitates determination of the start codon of each ORF, ...


Appl. Environ. Microbiol.
June 2013 vol. 79 no. 12 3829-3838 DOI:10.1128/AEM.00581-13

Functional Screening of a Metagenomic Library Reveals Operons Responsible for Enhanced Intestinal Colonization by Gut Commensal Microbes

Yoon et al.,
Department of Microbiology,a Brain Korea 21 Project for Medical Sciences,b Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine,c Seoul, Republic of Korea

... Clustering of genes into an operon was performed using FGENESB, a program for the prediction of bacterial operons (SoftBerry, Mount Kisco, NY). The ORF map shown in Fig. 3A and B was constructed using CloneMap (ver. 2.11) software (CGC Scientific, Inc., Ballwin, MO). ...


Extremophiles
Volume 17, Issue 5 , pp 809-819 DOI:10.1007/s00792-013-0562-4

Characterization of a cold-adapted and salt-tolerant esterase from a psychrotrophic bacterium Psychrobacter pacificensis

Guojie Wu, Gaobing Wu, Tao Zhan, Zongze Shao, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China 2. College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml), amino acid alignments by BLASTP (http://www.ncbi.nlm.nih.gov/), and Signal peptide by the SignaIP 4.0 ...


Journal of Molecular Catalysis B: Enzymatic
Volume 98, 30 December 2013, Pages 119–126 DOI:10.1016/j.molcatb.2013.10.012

A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance

Guojie Wu a, Shuo Zhang a, Houjin Zhang b, Shanshan Zhang a, Ziduo Liu a,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China b School of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430070, PR China

... of the esterase-encoding gene, est12, was carried out by Basic Local Alignment Search Tool (BLAST) program on the NCBI online database (http://www.ncbi.nlm.nih.gov), and the promoter region was analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml ...


PloS one
March 01, 2013DOI: 10.1371/journal.pone.0057634

A Serratia marcescens PigP Homolog Controls Prodigiosin Biosynthesis, Swarming Motility and Hemolysis and Is Regulated by cAMP-CRP and HexS

Shanks et al.,
Charles T. Campbell Laboratory of Ophthalmic Microbiology, Department of Ophthalmology, University of Pittsburgh Eye Center, Pittsburgh, Pennsylvania, United States of America Department of Chemistry, University of Pittsburgh, Pittsburgh, Pennsylvania, United States of America

.. As noted above, the pigP gene is in a predicted operon with SMA3565-SMA3566 based on the alignment and proximity of open reading frames and Softberry FGENESB operon prediction software (http://linux1.softberry.com) (Figure 1B), however, this has not been previously ...


Archives of Virology
Volume 158, Issue 10 , pp 2101-2108 DOI:10.1007/s00705-013-1719-2

Characterization and complete genome sequence of a virulent bacteriophage B4 infecting food-borne pathogenic Bacillus cereus

Ju-Hoon Lee, Hakdong Shin, Bokyung Son, Sunggi Heu, Sangryeol Ryu
2. Department of Food Science and Biotechnology, Kyung Hee University, Yongin, 446-701, Korea 1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea

... Prediction of open reading frames (ORFs) was carried out using GeneMarkS [ 4 ], Glimmer v3.02 [ 11 ] and FgenesB software (Softberry, Inc. Mount Kisco, NY) and confirmed using RBSfinder (J. Craig Venter Institue, Rockville, MD). ...


Physiological and Molecular Plant Pathology
Volume 84, October 2013, Pages 61–69 DOI:10.1016/j.pmpp.2013.07.003

Modulated expression of ion transporters may be responsible for manganese deficiency in brittle leaf disease affected date palm (Phoenix dactylifera L.) trees

Saidi et al.,
a Laboratoire des Biotechnologies Vegetales Appliquees a l'Amelioration des Cultures, Ecole Nationale d'Ingenieurs de Sfax, Route Soukra Km 4, B.P 1173, 3038 Sfax, Tunisia b Centre de Recherches Phoenicoles, 2260 Degache, Tunisia c Faculte des Sciences de Sfax, Route de Soukra Km 4, BP 1171, 3018 Sfax, Tunisia

... and motif searches were performed on the protein sequences using Pfam (http://www.sanger. ac.uk/software/pfam), protein which did not present the appropriate protein motif was re-predicted and manually corrected by using Fgenesh software (http://linux1.softberry.com/berry ...


American Journal of Molecular Biology
2013, 3, 115-130 DOI:10.4236/ajmb.2013.32016

Genome sequencing and next-generation sequence data analysis: A comprehensive compilation of bioinformatics tools and databases

Jose C. Jimenez-Lopez 1, Emma W. Gachomo 2,3, Sweta Sharma 2,3, Simeon O. Kotchoni 2,3
1Department of Biochemistry, Cell and Molecular Biology of Plants, Estacion Experimental del Zaidin, High Council for Scientific Research (CSIC), Granada, Spain 2Department of Biology, Rutgers University, Camden, USA 3Center for Computational and Integrative Biology (CCIB), Rutgers University, Camden, USA

Example of tools used for gene prediction are: 1) Glimmer, a system for finding genes in microbial DNA, especially the genomes of bacteria, archaea, and viruses (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi), 2) FgenesB, a package developed by Soft- berry Inc. for automatic annotation of bacterial genomes (http://www.molquest.com/help/2.3/programs/FgenesB/about.html),


IJSEM
February 2013 vol. 63 no. Pt 2 526-532 DOI:10.1099/ijs.0.036947-0

Listeria fleischmannii sp. nov., isolated from cheese

Bertsch et al.,
1Laboratory of Food Biotechnology, Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland 2Chemisches und Veterinaruntersuchungsamt Stuttgart (CVUAS), 70736 Fellbach, Germany

... The prediction tool FGENESB (Softberry) indicated the presence of eight open reading frames between prs and ldh, all showing the highest similarity (>50 %) with protein sequences from members of the genus Listeria (Fig. ...


Molecular & amp;Cellular Proteomics (mcp)
November 1, 2013 , 12, 3388-3397. DOI:10.1074/mcp.M112.027169

Proteogenomic Analysis of Bradyrhizobium japonicum USDA110 Using Genosuite, an Automated Multi-algorithmic Pipeline

Kumar et al.,
From the ‡G.N. Ramachandran Knowledge Center for Genome Informatics, CSIR-Institute of Genomics and Integrative Biology, South Campus, Sukhdev Vihar, Mathura Road, Delhi 110025, India; §Queensland Centre for Medical Genomics, Institute for Molecular Bioscience, The University of Queensland, St Lucia, QLD, 4072, Australia

... FGENESB gene predictions were downloaded from (http://linux1.softberry.com/data/ annotation/bact/NC_004463.fna.ann.gz). ORF comparison across algorithms was performed using in-house scripts. Protein Functional Annotation. ...


Appl. Environ. Microbiol.
July 2013 vol. 79 no. 13 3967-3973 DOI:10.1128/AEM.00867-13

Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces

Shannon M. Hinsa-Leasur a, Cassandra Koid a, James M. Tiedj b and Janna N. Schultzhaus a
Biology Department, Grinnell College, Grinnell, Iowa, USAa Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USAb

... with 64 bp separating the two genes. Based on results of the sequence analysis programs FGENESB and BPROM (SoftBerry), the Psyc_1602-encoding gene and cat1 reside in an operon. Located 379 bp downstream of cat1 ...


mcp
doi: 10.1074/mcp.M113.027318 mcp.M113.027318.

Analysis of the secretome and identification of novel constituents from culture filtrate of bacillus Calmette-Guerin using high-resolution mass spectrometry

Zheng et al.,
1 Chinese Academy of Medical Sciences & Peking Union Medical College; 2 Chinese Academy of Medical Sc, China

... Gene prediction programs for prokaryotes were FgeneSB (http://linux1.softberry.com/berry. phtml?topic=fgenesb&group=programs&subgroup=gfindb) and GeneMark (http://exon.biology.gatech.edu/~genmark/gmhmm2_prok.cgi). Functional ...


J. Am. Chem. Soc.,
2013, 135 (47), pp 17906–17912 DOI: 10.1021/ja408683p

Discovery and Synthetic Refactoring of Tryptophan Dimer Gene Clusters from the Environment

Chang et al.,
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New York, New York 10065, United States

... using 454 pyrosequencing technology (Roche). Clone assemblies were annotated using FGENESB (Softberry) or CloVR(15) for gene prediction and BLASTP (NCBI) for protein homology relationsips. The gene clusters reported ...


The Journal of Steroid Biochemistry and Molecular Biology
Volume 138, November 2013, Pages 41–53 DOI:10.1016/j.jsbmb.2013.02.016

Comparative analysis of genes encoding key steroid core oxidation enzymes in fast-growing Mycobacterium spp. strains

Bragin et al.,
a Center of Innovations and Technologies “Biological Active Compounds and Their Applications”, Russian Academy of Sciences, Moscow 119991, Russian Federation b G.K.Skryabin Institute of Biochemistry & Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, Moscow Region, Russian Federation

... weight matrices (PWM) were calculated from the known binding sites of transcription factors KstR [21] and KstR2 [39] and used for a search of similar sites in sequence 500 bp length upstream of operons found with the program FgenesB (http://linux1.softberry.com/berry.phtml ...


PNAS
February 12, 2013 vol. 110 no. 7 2478–2483, doi: 10.1073/pnas.1218073110

Discovery of indolotryptoline antiproliferative agents by homology-guided metagenomic screening

Fang-Yuan Chang and Sean F. Brady
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, New York, NY 10065

... AB1091 was then annotated using FGENESB (Softberry) for gene prediction and BLASTP (National Center for Biotechnology Information) for protein homology searches (Fig. S9). Retrofitting and Conjugation of bor Gene Cluster-Containing Clone into S. albus. ...


BMC genomics
(2013). 14(1), 917. DOI:doi:10.1186/1471-2164-14-917

Comparative analysis of genome sequences from four strains of the Buchnera aphidicola Mp endosymbiont of the green peach aphid, Myzus persicae

Jiang et al.,
1 Center for Computational Science, Miller School of Medicine, University of Miami, Coral Gables 33146, FL, USA 2 Department of Biology, University of Miami, Coral Gables 33146, FL, USA

... Genome annotation Gene models in the assembled genomes and plasmid scaffolds were predicted with FgenesB (www.softberry.com, utilizing the annotated genome of Buchnera aphidicola Bp (NC_004545) as a training set), GeneMark [62], and GLIMMER [63]. ...


Journal of Biomolecular Structure and Dynamics
(2013). 31(3), 342-350. DOI:

Improved annotation of a plant pathogen genome Xanthomonas oryzae pv. oryzae PXO99A

Lei, Y., Kang, S. K., Gao, J., Jia, X. S., & Chen, L. L.
a National Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Center for Bioinformatics, Huazhong Agricultural University , No. 1 Shizishan Street, Hongshan District, Wuhan , 430070 , P.R. China b College of Science, Huazhong Agricultural University , No. 1 Shizishan Street, Hongshan District, Wuhan , 430070 , P.R. China

... BMC Bioinformatics, 11: 119 [PubMed] View all references) and FgenesB, (http://linux1.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup= gfindb), respectively. Method for recognizing noncoding 'hypothetical ORFs'. ...


Frontiers in microbiology
(2013).4. DOI:10.3389/fmicb.2013.00340

Metatranscriptomic and functional metagenomic analysis of methylphosphonate utilization by marine bacteria

Martinez, A., Ventouras, L. A., Wilson, S. T., Karl, D. M., & DeLong, E. F.
1Division of Biological Engineering, Department of Civil and Environmental Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA 2Center for Microbial Oceanography: Research and Education (C-MORE), University of Hawaii, Honolulu, HI, USA

...The complete DNA sequence was assembled using Sequencher v. 4.10 (Gene Codes Corporation, Ann Arbor, MI) and annotated with FGENESB (Softberry) and BlastP (NCBI)....


Applied Microbiology and Biotechnology
Volume 97, Issue 18 , pp 8173-8182 DOI:10.1007/s00253-013-4927-5

Discovery of (hemi-) cellulase genes in a metagenomic library from a biogas digester using 454 pyrosequencing

Yan et al.,
1. Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Fenglin Rd 300, Shanghai, 200032, China 2. Biofuels institute, School of the Environment, Jiangsu University, Zhenjiang, 212013, Jiangsu, China

... whose GH activity was lost. ORFs were predicted by FgenesB (Softberry, Goteborg, Sweden), and a BLASTX search was performed against the NR database to access annotation information. Translated pro- tein sequences ...


AEM
Published ahead of print 14 December 2012, doi: 10.1128/AEM.03291-12

Metabolic Engineering to Overproduce D-Lactate by Leuconostoc citreum using a Novel E. coli-Leuconostoc Shuttle Vector

Han Seung Chae 1, Seung Hwan Lee 2, Ju-Hoon Lee 3, Si Jae Park 2 and Pyung Cheon Lee 1
1 Department of Molecular Science and Technology, Ajou University, Woncheon-dong, Yeongtong-gu, Suwon 443-749, South Korea 2 Chemical Biotechnology Research Center, Korea Research Institute of Chemical Technology (KRICT), Yuseong-gu, Daejeon 305-600, South Korea

... 99 Prediction of open reading frames (ORFs) was conducted using GeneMark (5) and FgenesB 100 (Softberry, Mount Kisco, NY) programs. Gene annotation and similarity analysis were 101 performed using BLAST programs (2) from the National Center for Biotechnology 102 ...


FEMS Microbiology Letters
Volume 337, Issue 1, pages 1?9, December 2012 DOI: 10.1111/j.1574-6968.2012.02665.x

Novel traits of Trichoderma predicted through the analysis of its secretome

Irina S. Druzhinina 1,2, Ekaterina Shelest 3, Christian P. Kubicek 1,2,*
1 Research Division Biotechnology and Microbiology, Institute of Chemical Engineering, Vienna University of Technology, Vienna, Austria 2 Austrian Center of Industrial Biotechnology (ACIB), GmBH c/o Institute of Chemical Engineering, Vienna University of Technology, Vienna, Austria

... Therefore, we applied the TMHMM Server v2.0 (http://www.cbs.dtu.dk/services/TMHMM/) to predict transmembrane helices in proteins, ProtComp, v8.0 (http://linux1.softberry.com/) and WolfPsort (http://wolfpsort.org/) both designed to predict the subcellular localization for animal ...


Journal of Biotechnology
Available online 28 November 2012

Genome sequence of Corynebacterium pseudotuberculosis biovar equi strain 258 and prediction of antigenic targets to improve biotechnological vaccine production

Soares et al.,
a CLIB Graduate Cluster Industrial Biotechnology, Centrum f?r Biotechnologie, Universit?t Bielefeld, 33615 Bielefeld, Germany b Institut f?r Genomforschung und Systembiologie, Centrum f?r Biotechnologie, Universit?t Bielefeld, 33615 Bielefeld, Germany

.. The complete genome sequence of C. pseudotuberculosis 258 was functionally annotated using the following softwares: FgenesB (http://linux1.softberry.com/); RNAmmer (Lagesen et al., 2007); tRNAscan-SE (Lowe and Eddy, 1997); InterproScan (Zdobnov and Apweiler, 2001 ...


Front Microbiol.
2012; 3: 185. DOI: 10.3389/fmicb.2012.00185

Complete Genome of Ignavibacterium album, a Metabolically Versatile, Flagellated, Facultative Anaerobe from the Phylum Chlorobi

Liu et al.,
1Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA, USA 2Section for Marine Biology, Department of Biology, University of Copenhagen, Helsingor, Denmark

... assembly. The genome was annotated using a pipeline based on FGENESB software (Softberry, Inc., USA), Artemis (Sanger Institution, UK), and custom-made Perl scripts (ActivePerl; ActiveState Inc., Vancouver, BC, USA). ...


PLoS ONE
7(9): e43176. doi:10.1371/journal.pone.0043176

Theoretical Prediction and Experimental Verification of Protein-Coding Genes in Plant Pathogen Genome Agrobacterium tumefaciens Strain C58

Qian Wang, Yang Lei, Xiwen Xu, Gejiao Wang, Ling-Ling Chen
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, People's Republic of China, Center for Bioinformatics, Huazhong Agricultural University, Wuhan, People's Republic of China

... Furthermore, potential new protein-coding genes that were not found in the RefSeq annotation were predicted by two ab initio gene finding programs, ie, Prokaryotic dynamic programming gene-finding algorithm (Prodigal) [21] and FgenesB (http://linux1.softberry.com/berry ...


Journal of Biomolecular Structure and Dynamics
2012 Aug 1. [Epub ahead of print] DOI: 10.1080/07391102.2012.698218

Improved annotation of a plant pathogen genome Xanthomonas oryzae pv. oryzae PXO99A.

Yang Lei a, Shou-Kai Kanga , Junxiang Gao b, Xi-Shuai Jia a & Ling-Ling Chen a
a National Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Center for Bioinformatics, Huazhong Agricultural University, No. 1 Shizishan Street, Hongshan District, Wuhan, 430070, P.R. China b College of Science, Huazhong Agricultural University, No. 1 Shizishan Street, Hongshan District, Wuhan, 430070, P.R. China

... BMC Bioinformatics , 11: 119 View all references) and FgenesB, (http://linux1.softberry. com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb), respectively. Method for recognizing noncoding 'hypothetical ORFs'. ...


PLoS Negl Trop Dis.
2012 January; 6(1): e1471. doi: 10.1371/journal.pntd.0001471

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

Cejkova et al.,
1Department of Biology, Faculty of Medicine, Masaryk University, Brno, Czech Republic 2Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, United States of America

... bp. Gene identification and annotation. FgenesB (Softberry Inc., New York, USA), GeneMark [34] and Glimmer [35] were used independently for prediction of open reading frames (ORFs) in the Samoa D genome sequence. Visualization ...


PLoS One;
2011 May Journal Volume: 5; Journal Issue: 1;

Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community

Reddy et al.,

... the BLAST scores. After manual frameshift correction, genes were called using fgenesb (http:// www.softberry.com). For phylogenetic ... to Iodobacteriophage. Genes were predicted using fgenesV (www. softberry.com). Found at: doi ...


Food Microbiology
Volume 33, Issue 1, February 2013, Pages 124–130 DOI: 10.1016/j.fm.2012.09.008

Macedovicin, the second food-grade lantibiotic produced by Streptococcus macedonicus ACA-DC 198

Georgalaki et al.,
a Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece b Institut Pasteur de Lille, Center for Infection and Immunity of Lille (CIIL), F-59019 Lille, France

... CAP3 (Huang and Madan, 1999). The region was annotated using heuristic GeneMark TM (Besemer and Borodovsky, 1999), FgenesB (http://www.softberry.com) and MetaGene annotator (Noguchi et al., 2006). At the same time ...


IJSEM
April 2012 DOI: 10.1099/ijs.0.036947-0

Listeria fleischmannii sp. nov., isolated from cheese

Bertsch et al.,
1 ETH Zurich; 2 CVUAS;

... JN118555). The 157 prediction tool FGENESB (Softberry, Inc.) indicated the presence of eight ORFs between prs and ldh, all 158 showing the highest homology (>50%) to protein sequences from Listeria species (Fig. 2). ORFB 159 ...


Journal of Molecular Evolution
Volume 74, Issue 3-4 , pp 187-205 DOI:10.1007/s00239-012-9498-z

Phylogenetic Classification of Diverse LysR-Type Transcriptional Regulators of a Model Prokaryote Geobacter sulfurreducens

Julia Krushkal, Yanhua Qu, Derek R. Lovley, Ronald M. Adkins
1. Department of Preventive Medicine, The University of Tennessee Health Science Center, 66 N. Pauline Blvd. Ste. 633, Memphis, TN, 38163, USA 2. Department of Microbiology, The University of Massachusetts, Amherst, MA, 01003, USA

... J Mol Evol 123 Page 5. predicted earlier and described previously (Krushkal et al. 2007; Mahadevan et al. 2008; Tran et al. 2008) using the commercial version of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc.; 2003–2009). ...


BMC Genomics
2012, 13:625 doi:10.1186/1471-2164-13-625

The large universal Pantoea plasmid LPP-1 plays a major role in biological and ecological diversification

Maayer et al.,
1 Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria, South Africa 2 Center for Microbial Ecology and Genomics, Department of Genetics, University of Pretoria, Pretoria, South Africa

... The CDS for complete LPP-1 sequences were downloaded from the National Center for Biotechnology Information (NCBI) database [63] and those encoded on the draft plasmids were predicted using FgenesB [64]....


Journal of Proteomics
Volume 77, 21 December 2012, Pages 357–371 DOI: 10.1016/j.jprot.2012.09.010

A comprehensive proteomic analysis of Mycobacterium bovis bacillus Calmette–Guerin using high resolution Fourier transform mass spectrometry

Zheng et al.,
MOH Key Laboratory of Systems Biology of Pathogens, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, PR China

... Two different gene prediction programs for prokaryotes, FgeneSB (http://linux1.softberry.com/ berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb) and GeneMark (http://exon.biology.gatech.edu/~genmark/gmhmm2_prok.cgi), supported the presence of this ...


MPMI
July 2012, Volume 25, Number 7 Pages 954-963 DOI: 10.1094/MPMI-11-11-0304

Nonlegume Parasponia andersonii Deploys a Broad Rhizobium Host Range Strategy Resulting in Largely Variable Symbiotic Effectiveness

Rik H. M. Op den Camp et al.,
1Department of Plant Sciences, Laboratory of Molecular Biology, Wageningen University, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands; 2Department of Agricultural Biotechnologies, Universita di Padova, Viale dell'Universita 16, 35020 Legnaro (Padova), Italy;

... Genes were predicted using FGENESB (Softberry, Mount Kisco, NY, USA), BASys (Van Domselaar et al. 2005), and manual annotation. Estimated full-length 16S rDNA and genes encoding proteins involved in Nod-factor biosynthesis were identified by BLAST searches. ...


J. Bacteriol. April
2012 vol. 194 no. 8 2041-2049 DOI doi: 10.1128/?JB.06637-11

Novel, Highly Specific N-Demethylases Enable Bacteria To Live on Caffeine and Related Purine Alkaloids

Ryan M. Summers et al.,
aDepartment of Chemical and Biochemical Engineering, University of Iowa, Iowa City, Iowa, USA bThe Center for Biocatalysis and Bioprocessing, University of Iowa, Coralville, Iowa, USA

... the supplemental material. Analyses of open reading frames (ORFs) were performed manually with the help of GeneMark.hmm for prokaryotes (23), FGENESB (Softberry, Inc., Mount Kisco, NY), and GLIMMER (9). Cloning and ...


J. Virol.
doi: 10.1128/?JVI.01987-12 October 2012 vol. 86 no. 20 11410-11411

Complete Genome Sequence of Pectobacterium carotovorum subsp. carotovorum Bacteriophage My1

Dong Hwan Lee et al.,
aDivision of Microbial Safety, National Academy of Agricultural Science, Rural Development Administration, Suwon, Republic of Korea bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, Republic of Korea

... Quality filtered reads were assembled using a 454 Newbler 2.3 assembler. The open reading frames (ORFs) were predicted using the Glimmer v3.02 (3), GeneMarkS (2), and FgenesB (Softberry, Inc., Mount Kisco, NY) and then confirmed by the RBSfinder (17). ...


J. Bacteriol.
doi: 10.1128/?JB.01373-12 October 2012 vol. 194 no. 20 5718-5719

Whole-Genome Sequence of Corynebacterium pseudotuberculosis Strain Cp162, Isolated from Camel

Syed Shah Hassan et al.,
aInstituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil bInstituto de Ciencias Biologicas, Universidade Federal do Para, Belem, PA, Brazil

... short reads (3) and manual curation. The functional annotation of the genome for open reading frame (ORF) prediction was performed using the software program FgenesB (Softberry). The software program RNAmmer (6) was ...


Appl Environ Microbiol.
August 2012, doi: 10.1128/?AEM.02120-12

Genomic and transcriptomic studies of an RDX-degrading actinobacterium

Hao-Ping Chen et al.,
1Department of Microbiology & Immunology, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada 3U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi

... 46 Biolabs). 47 Page 3. 3 Open reading frames (ORFs) were identified using the FGENESB software (Softberry Inc., 48 Mount Kisco, NY) and the RAST server (http://rast.nmpdr.org) (3). The genes that were 49 identified were ...


J. Virol.
doi: 10.1128/?JVI.01042-12 July 2012 vol. 86 no. 14 7713-7714

Complete Genome Sequence of Cronobacter sakazakii Temperate Bacteriophage phiES15

Ju-Hoon Lee b, Younho Choi a, Hakdong Shin a, Junghyun Lee a and Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea

... The predictions of open reading frames (ORFs) were conducted using three major gene prediction programs, GeneMarkS (2), Glimmer3 (5), and FgenesB (Softberry, Inc., Mount Kisco, NY) and confirmed by ribosomal binding site analyses performed using RBS finder (J. Craig ...


J. Virol.
doi: 10.1128/?JVI.01283-12 August 2012 vol. 86 no. 16 8899-8900

Complete Genome Sequence of Phytopathogenic Pectobacterium carotovorum subsp. carotovorum Bacteriophage PP1

Ju-Hoon Lee et al.,
aDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea bDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea

... Korea). The open reading frames (ORFs) were bioinformatically predicted using Glimmer3 (4), GeneMarkS (2), and FgenesB (Softberry, Inc., Mount Kisco, NY) and confirmed by RBS finder (J. Craig Venter Institute, Rockville, MD). ...


J. Virol.
doi: 10.1128/?JVI.00706-12 June 2012 vol. 86 no. 11 6379-6380

Complete Genome Sequence of Bacillus cereus Bacteriophage PBC1

Minsuk Kong, Minsik Kim and Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea

... The assembly of quality filtered reads was performed using GS De Novo Assembler (v. 2.6), and the open reading frames (ORFs) were predicted using the Glimmer 3.02 (4), GeneMark.hmm (3), and FgenesB (Softberry, Inc., Mount Kisco, NY) software. ...


J. Bacteriol.
doi: 10.1128/?JB.00824-12 August 2012 vol. 194 no. 16 4434-4435

Complete Genome Sequence of the Hyperthermophilic Archaeon Pyrococcus sp. Strain ST04, Isolated from a Deep-Sea Hydrothermal Sulfide Chimney on the Juan de Fuca Ridge

Jong-Hyun Jung et al.,
aDepartment of Food Science and Biotechnology, Institute of Life Sciences and Resources, Kyung Hee University, Yongin, South Korea bDepartment of Microbiology, University of Massachusetts, Amherst, Massachusetts, USA

... The open reading frames (ORFs) were predicted using GeneMarkS (2), Glimmer 3.02 (3), and FgenesB (Softberry, Inc., Mount Kisco, NY), and functional analyses of the predicted ORFs were conducted using BLASTP (1) and InterProScan (12). ...


J. Bacteriol.
doi: 10.1128/?JB.00461-12 July 2012 vol. 194 no. 13 3567-3568

Complete Genome Sequence of Corynebacterium pseudotuberculosis Strain Cp267, Isolated from a Llama

Thiago Lopes et al.,
aInstituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Para, Brazil bInstituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil

... The following software programs were used in the automatic functional annotation of the genome: FgenesB (gene prediction; http://linux1.softberry.com/), RNAmmer (rRNA prediction) (3), tRNAscan-SE (tRNA prediction) (4), and Tandem Repeat Finder (repetitive DNA prediction ...


J. Bacteriol.
doi: 10.1128/?JB.01016-12 September 2012 vol. 194 no. 17 4769-4770

Complete Genome Sequence of the Hyperthermophilic Archaeon Thermococcus sp. Strain CL1, Isolated from a Paralvinella sp. Polychaete Worm Collected from a Hydrothermal Vent

Jong-Hyun Jung et al.,
aDepartment of Food Science and Biotechnology, Institute of Life Sciences and Resources, Kyung Hee University, Yongin, Republic of Korea bDepartment of Microbiology, University of Massachusetts, Amherst, Massachusetts, USA

... Korea). GeneMarkS (2), Glimmer 3.02 (3), and FgenesB (Softberry, Inc., Mount Kisco, NY) were used to predict the open reading frames (ORFs) present. Their functions were verified using BLASTP (1) and InterProScan (15). ...


J. Bacteriol.
doi: 10.1128/?JB.00572-12 July 2012 vol. 194 no. 13 3561-3562

Genome Sequence of Bacillus licheniformis WX-02

Wuming Yangtse et al.,
State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, People's Republic of China

... Open reading frames were identified using Fgenesb (http://linux1.softberry.com/berry.phtml?topic= fgenesb&group=programs&subgroup=gfindb), Prodigal (http://compbio.ornl.gov/prodigal/), and Glimmer (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi) and ...


The ISME Journal
6, 1916-1925 (October 2012) | doi:10.1038/ismej.2012.38

Functional metagenomics reveals novel salt tolerance loci from the human gut microbiome

Eamonn P Culligan, Roy D Sleator, Julian R Marchesi and Colin Hill

... FLX (Roche Applied Science) platform. Putative open reading frames were predicted using Softberry FGENESB bacterial operon and gene prediction software (Mavromatis et al., 2007). Retrieved nucleotide and translated amino ...


Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002

IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany 2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile

... to GenBank sequences. Additional searches for genes, operons, promoters, and terminators were done using FGENESB, BPROM, and FindTerm at www.softberry. com (Softberry, Mount Kisco, NY, USA). The sequence data ...


Extremophiles
September 2012, Volume 16, Issue 5, pp 715-726 DOI 10.1007/s00792-012-0467-7

Genome sequence of temperate bacteriophage Psymv2 from Antarctic Dry Valley soil isolate Psychrobacter sp. MV2

Tracy L. Meiring (1) I. Marla Tuffin (1) Craig Cary (2) Don A. Cowan (1)
1. Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Office 2117, Level 2 Life Sciences Building, Modderdam Rd, Bellville, 7535, South Africa 2. Department of Biological Sciences, University of Waikato, Hamilton, New Zealand

... Ab initio gene predictions were performed using GeneMark.hmm 2.0 (http://www.exon.biology. gatech.edu/heuristic_hmm2.cgi) (Besemer and Borodovsky 1999), fgenesv and fgenesb (http://www.linux1.softberry.com/berry.phtml) (Softberry, Mount Kisco, NY, USA) using the ...


AQUATIC MICROBIAL ECOLOGY
AQUATIC MICROBIAL ECOLOGY

Virus genes in Arctic marine bacteria identified by metagenomic analysis

Matthew T. Cottrell, David L. Kirchman
Matthew T. Cottrell, David L. Kirchman

... genomes EU795107, EU795222 to EU795255 and EU795278. Open reading frames were identified using the FGENESB (Softberry) web site (www.softberry.com) and then annotated using AutoFACT software (Koski et al. 2005 ...


Open Access Bioinformatics
2012:4 1–13 http://dx.doi.org/10.2147/OAB.S25500

reannotation of the Corynebacterium diphtheriae ncTc13129 genome as a new approach to studying gene targets connected to virulence and pathogenicity in diphtheria

Vivian D’Afonseca et al.,
1Federal University of Minas gerais, Belo horizonte, Minas gerais, Brazil; 2Federal University of Pelotas, Pelotas, rio grande do sul, Brazil;

... Methods genome reannotation The reannotation procedures involved the use of several algorithms, in a multi-step process. Structural annotation was performed using the following software: FGENESB: bacterial operon and gene predictor (http://www.softberry. ...


World Journal of Microbiology and Biotechnology
August 2012 DOI 10.1007/s11274-012-1145-8

Cloning and biochemical characterization of a glucosidase from a marine bacterium Aeromonas sp. HC11e-3

Xiaoluo Huang et al.,
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China 2. Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State of Oceanic Administration, Xiamen, 361005, People’s Republic of China

... 1964). Sequence analysis Nucleotide sequencing was accomplished by the Gene- script Company (Nanjing, China) and the open reading frame (ORF) in the obtained DNA fragments was predicted by FGENESB in softberry database (http://linux1.soft berry.com/berry.phtml). ...


Virus Research
Volume 155, Issue 2, February 2011, Pages 433–439 DOI: 10.1016/j.virusres.2010.11.012

The genome sequence and proteome of bacteriophage ?CPV1 virulent for Clostridium perfringens

Volozhantsev et al.,
a State Research Center for Applied Microbiology & Biotechnology, Obolensk, Moscow Region, Russian Federation b Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA DOI:605, USA

... Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.gatech.edu/GeneMark; Lukashin and Borodovsky, 1998) and SoftBerry FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs. ...


J. Bacteriol.
June 2011 vol. 193 no. 12 3158-3159 DOI: 10.1128/JB.00310-11

Genome Sequence of Rhizobium etli CNPAF512, a Nitrogen-Fixing Symbiont Isolated from Bean Root Nodules in Brazil

Maarten Fauvart †, Aminael Sanchez-Rodriguez †, Serge Beullens, Kathleen Marchal and Jan Michiels *
Centre of Microbial and Plant Genetics, Katholieke Universiteit Leuven, BE-3001 Heverlee, Belgium

... average length). Protein-coding genes were predicted using the Softberry FgenesB algorithm (http://linux1.softberry.com/all.htm). Functional annotation was performed by BLAST searches against the GenBank database. The ...


Appl. Environ. Microbiol
September 2011 vol. 77 no. 17 6189-6198 DOI: 10.1128/AEM.00377-11

Genetic and Biochemical Map for the Biosynthesis of Occidiofungin, an Antifungal Produced by Burkholderia contaminans Strain MS14

Ganyu Gu 1, Leif Smith 2,*, Aixin Liu 1,3 and Shi-En Lu 1,*
1Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, 32 Creelman St., Mississippi State, Mississippi 39762 2Department of Biological Sciences, Texas A&M University, College Station, Texas 77843

... Open reading frames (ORFs) and genes were subsequently predicted by the Softberry FGENESB program (Softberry, Inc., Mount Kisco, NY), and the identified ORFs and genes were analyzed using Blastx in the NCBI database. ...


FEMS Microbiology Letters
Volume 318, Issue 1, pages 18–26, May 2011 DOI: 10.1111/j.1574-6968.2011.02232.x

Comparative and evolutionary analysis of plasmid pREN isolated from Lactobacillus rennini, a novel member of the theta-replicating pUCL287 family

Asteri, I.-A., Papadimitriou, K., Boutou, E., Pot, B., Vorgias, C. E. and Tsakalidou, E.
1 Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Athens, Greece 2 Department of Biochemistry and Molecular Biology, Faculty of Biology, National and Kapodistrian University of Athens, Athens, Greece

... In order to identify potential protein encoding segments, three open reading frames (orfs) prediction programs were used: heuristic genemark™ (Besemer & Borodovsky, 1999), fgenesb (http:www.softberry.com) and metageneannotator (Noguchi et al., 2006). ...


J. Bacteriol.
October 2011 vol. 193 no. 20 5707-5715 DOI: 10.1128/JB.05426-11

Long-Chain N-Acyl Amino Acid Synthases Are Linked to the Putative PEP-CTERM/Exosortase Protein-Sorting System in Gram-Negative Bacteria

Jeffrey W. Craig, Marisa A. Cherry and Sean F. Brady
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New York, New York 10065

... GS FLX Titanium XLR70; Roche Diagnostics Corp.) and standard Sanger-type sequencing (Table 1). Sequences from each respective eDNA insert were analyzed for putative open reading frames (ORFs) using GLIMMER, version 3.02 (14), and SoftBerry FGENESB (bacterial ...


FEMS Microbiology Letters
317: 83–92. doi: 10.1111/j.1574-6968.2011.02218.x

Characterization of a functional toxin–antitoxin module in the genome of the fish pathogen Piscirickettsia salmonis.

Gomez, F. A., Cardenas, C., Henriquez, V. and Marshall, S. H.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile 2 Nucleo Biotecnologia Curauma (NBC), PUCV, Curauma, Valparaiso, Chile

... Sequence analysis. The DNA sequenced data were analysed with the softberry server software (http://linux1.softberry.com/berry.phtml) using the algorithms, FgenesB (to find possible ORFs in the sequences), and Bprom (to search for putative bacterial promoters). ...


Antonie van Leeuwenhoek
Volume 99, Issue 2 , pp 409-416 DOI: 10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz, Ireneusz Babiak, Waleria Hryniewicz
1. Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland 2. Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...


FEMS Microbiology Letters
314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x

ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis.

Marshall, S. H., Henriquez, V., Gomez, F. A. and Cardenas, C.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Facultad de Ciencias, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile 2 NBC, Nucleo de Biotecnologia Curauma, Curauma, Valparaiso, Chile

... sequencing by Macrogen Inc. (Korea). Sequence analysis. The DNA sequence data were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml) using the FgenesB and Bprom algorithms. FgenesB is a suite ...


J. Bacteriol.
January 2011 vol. 193 no. 1 323-324 DOI: 10.1128/JB.01211-10

Complete Genome Sequence of Corynebacterium pseudotuberculosis I19, a Strain Isolated from a Cow in Israel with Bovine Mastitis

Silva et al.,
1Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, PA, Brazil 2Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil

... For structural annotation, the following software programs were employed: FgenesB, a gene predictor (http://www.softberry.com); RNAmmer, an rRNA predictor (4); tRNAscan-SE, a tRNA predictor (5); and Tandem Repeats Finder, a repetitive-DNA predictor (http://tandem.bu.edu ...


Microbiology
March 2011 vol. 157 no. 3 636-647 DOI: 10.1099/mic.0.046045-0

cAMP receptor protein (CRP) positively regulates the yihU–yshA operon in Salmonella enterica serovar Typhi

Villarreal et al.,
1Laboratorio de Microbiologia Molecular, Departamento de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile 2Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Mexico

... In silico analyses to evaluate the transcriptional organization of the yihU–yshA cluster were performed using the fgenesb program (http://www.softberry.com), the ORF program (http://bioinformatics.biol.rug.nl/), and the EcoCyc (Keseler et al., 2009) and Prodoric databases ...


J. Bacteriol.
December 2011 vol. 193 no. 24 7025-7026 doi: 10.1128/JB.06293-11

Complete Genome Sequence of Corynebacterium pseudotuberculosis Strain CIP 52.97, Isolated from a Horse in Kenya

Cerdeira et al.,
1Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Brazil 2Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil

... The structural annotation was done automatically by a multipronged approach using the following programs: for gene prediction, FgenesB (http: //www.softberry.com); for rRNA prediction, RNAmmer (5); for tRNA prediction, tRNA-scan-SE (6); and for repetitive DNA prediction ...


J. Bacteriol.
doi: 10.1128/JB.05854-11 October 2011 vol. 193 no. 20 5871-5872

Complete Genome Sequence of Type Strain Campylobacter fetus subsp. venerealis NCTC 10354T

Stynen et al.,
1Laboratorio de Bacteriologia Aplicada, Departamento de Medicina Veterinaria Preventiva, Escola de Veterinaria, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil 2CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, VIC, Australia

... fetus 82-40 (NC_008599) as the scaffold. Structural annotation was performed by the following predictors: for genes, FgenesB (SoftBerry); for rRNA, RNAmmer (10); for tRNA, tRNAscan-SE (12); and for repetitive DNA, Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html). ...


International Journal of Food Microbiology
Volume 144, Issue 3, 5 January 2011, Pages 400–405 DOI: 10.1016/j.ijfoodmicro.2010.10.026

Genome analysis of Lactobacillus fermentum temperate bacteriophage ÔPYB5

Xiuhong Zhang a, b, Shaohua Wang a, Tingting Guo a, Jian Kong a
a State Key Laboratory of Microbial Technology, Shandong University, Jinan, China 250100 b College of Life Science, Shanxi Normal University, Linfen, China 041000

... Sequence analysis was performed using BlastX, BlastN, BlastP and FastA programs. Putative ORFs were also identified using GenMark (http://opal.biology.gatech.edu/GeneMark/ gmhmm2_prok.cgi) and fgenesb software (http://www.softberry.com/). ...


Journal of Genetics and Genomics
Volume 38, Issue 6, 20 June 2011, Pages 243–252 DOI: 10.1016/j.jgg.2011.04.006

Genome

Xiao-Yan You et al.,
a State Key Laboratory of Microbial Resource, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China b Shanghai MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center, Shanghai 201203, China

... http://www.phrap.org). 2.4. Sequence analysis. The Glimmer 3.02 (Delcher et al., 2007) and FgeneSB programs (http://www.softberry.com/) were used to predict the positions of open reading frames (ORFs). Protein function was ...


Environmental Microbiology Reports
3: 203–210. doi: 10.1111/j.1758-2229.2010.00209.x

Pseudomonas fluorescens BBc6R8 type III secretion mutants no longer promote ectomycorrhizal symbiosis.

Cusano et al.,
1 INRA, UMR1136 INRA-Nancy Universite, «Interactions Arbres/Micro-organismes», Centre de Nancy, IFR110, 54280 Champenoux, France. 2 Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, UK.

... partially conserved. Figure 2. Alignment by tblastx of the P. fluorescens BBc6R8 and SBW25 T3SSs, generated using WebACT (Carver et al., 2005). BBc6R8 genes were predicted using FgenesB (Softberry). Regions of high ...


Appl. Environ. Microbiol.
July 2011 vol. 77 no. 13 4293-4302 doi: 10.1128/AEM.00195-11

Regulation of the Edwardsiella ictaluri Type III Secretion System by pH and Phosphate Concentration through EsrA, EsrB, and EsrC

Matthew L. Rogge 1 and Ronald L. Thune 1,2
1Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana 70803 2Department of Veterinary Science, Louisiana State University Agricultural Center, Louisiana State University, Baton Rouge, Louisiana 70803

... Target amplicons, their operons, and their gene-specific primers are listed in Table 2. Putative operons were identified by using FGENESB (SoftBerry, Inc., Mount Kisco, NY), and transcriptional linkages were subsequently confirmed by reverse transcription-PCR (RT-PCR) using ...


The ISME Journal
(2012) 6, 146–157; doi:10.1038/ismej.2011.88; published online 21 July 2011

Genome-scale analysis of anaerobic benzoate and phenol metabolism in the hyperthermophilic archaeon Ferroglobus placidus

Dawn E Holmes 1,2,3, Carla Risso 1,3, Jessica A Smith 1 and Derek R Lovley 1
1Department of Microbiology, University of Massachusetts Amherst, Amherst, MA, USA 2Department of Physical and Biological Sciences, Western New England College, Springfield, MA, USA

... Operon organization of the F. placidus genome was predicted using the commercial version of the FGENESB software (V Solovyev and A Salamov, unpublished data; Softberry Inc., Mount Kisco, NY, USA; 2003–2009), as previously described for the genomes of various ...


J. Bacteriol.
November 2011 vol. 193 no. 22 6342-6357 doi: 10.1128/JB.05777-11

Comparative Genomic Analysis of Xanthomonas axonopodis pv. citrumelo F1, Which Causes Citrus Bacterial Spot Disease, and Related Strains Provides Insights into Virulence and Host Specificity

Jalan et al.,
1Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, 700 Experiment Station Road, Lake Alfred, Florida 33850 2Interdisciplinary Center for Biotechnology Research, 2033 Mowry Road, University of Florida, Gainesville, Florida 32611

... validation. Annotation and curation.Coding genes were identified using Softberry's FgenesB suite of bacterial operon- and gene-finding programs, based on the Markov chain model prediction algorithm at ICBR, UF (108). Predicted ...


Molecular Microbiology
(2011), 80: 951–965. doi: 10.1111/j.1365-2958.2011.07622.x

Anti-activator QslA defines the quorum sensing threshold and response in Pseudomonas aeruginosa.

Seet, Q. and Zhang, L.-H.
Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, Singapore 138673.

... aa in the Pseudomonas Genome Database (http://www.pseudomonas.com), but our in silico analysis predicted a translational start site at 27 bp downstream of the original annotated start site and the open reading frame would generate a 104 aa protein (FGENESB, Softberry). ...


PLoS ONE
(2011) 6(2): e16626. doi:10.1371/journal.pone.0016626

Genome of a Low-Salinity Ammonia-Oxidizing Archaeon Determined by Single-Cell and Metagenomic Analysis.

Blainey PC, Mosier AC, Potanina A, Francis CA, Quake SR
Howard Hughes Medical Institute, Department of Bioengineering, Stanford University, Stanford, California, United States of America Department of Environmental Earth System Science, Stanford University, Stanford, California, United States of America

... Gene prediction was carried out on the N. limnia assembly using the FgenesB platform (Softberry, Inc.), which called 2171 genes, including 2047 protein-coding ORFs, 74 pseudogenes, and 50 RNA genes [Table 2]. In total, 83.4% of the assembled bases were predicted to ...


Appl. Environ. Microbiol.
September 2011 vol. 77 no. 18 6663-6673 doi: 10.1128/AEM.05111-11

Diversity and Plasticity of the Intracellular Plant Pathogen and Insect Symbiont "Candidatus Liberibacter asiaticus" as Revealed by Hypervariable Prophage Genes with Intragenic Tandem Repeats

Zhou et al.,
1University of Florida, IFAS-IRREC, Ft. Pierce, Florida 34945 2USDA-ARS-USHRL, Ft. Pierce, Florida 34945

... Bioinformatics and phylogenetic analysis.Tandem repeats finder version 4.04 (4) was used to find repeats in hyv I and hyv II sequences. Bacterial gene predictions were carried out using FGENESB software (SoftBerry Inc., Mount Kisco, NY). ...


The ISME Journal
(2011) 5, 1253–1261; doi:10.1038/ismej.2011.15; published online 3 March 2011

Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment

Gaze et al.,
1School of Life Sciences, University of Warwick, Coventry, Warwickshire, UK 2University of Birmingham, School of Immunity and Infection, Edgebaston, Birmingham, UK

... first nucleotide BLAST (basic local alignment search tool; National Center for Biotechnology Information (NCBI)) was used to check for homology with previously reported attC regions, then the NCBI ORF finder (open reading frame finder) and FGENESB (Softberry, Mount Kisco ...


Microbiology
April 2011 vol. 157 no. 4 1229-1239 DOI: 10.1099/mic.0.044669-0

Sulfur globule oxidation in green sulfur bacteria is dependent on the dissimilatory sulfite reductase system

Carina Holkenbrink, Santiago Ocon Barbas, Anders Mellerup, Hiroyo Otaki† and Niels-Ulrik Frigaard
Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark

... Black arrows indicate binding of primers for PCR and sequencing. Prediction of promoters and terminators was done using fgenesb software (http://linux1.softberry. com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...


OMICS: A Journal of Integrative Biology.
July/August 2011, 15(7-8): 495-506. doi:10.1089/omi.2010.0117.

Genome Diversity of the TetR Family of Transcriptional Regulators in a Metal-Reducing Bacterial Family Geobacteraceae and Other Microbial Species

Krushkal et al.,
1Department of Preventive Medicine, the University of Tennessee Health Science Center, Memphis, Tennessee. 2Bioinformatics Program, the University of Memphis, Memphis, Tennessee.

... Operon organization of the Geobacteraceae genomes was predicted using the commercial version of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc., 2003–2009), as described earlier (Krushkal et al., 2007; Mahadevan et al., 2008; Tran et al ...


Front Microbiol.
2011; 2: 116. DOI: 10.3389/fmicb.2011.00116

Mechanisms and Evolution of Oxidative Sulfur Metabolism in Green Sulfur Bacteria

Lea H. Gregersen, 1,† Donald A. Bryant, 2 and Niels-Ulrik Frigaard 1,*
1Department of Biology, University of Copenhagen, Helsingor, Denmark 2Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA, USA

... the following software: MEGA 4 (sequence alignment and phylogenetics 6 ; Tamura et al., 2007), Artemis 12.0 (sequence viewing and manipulation; Wellcome Trust Sanger Institute, Hinxton, UK 7 ; Carver et al., 2008), FGENESB (sequence annotation; Softberry, Mount Kisco ...


PLoS ONE 6
2011, (5): e20095. doi:10.1371/journal.pone.0020095

Phage Encoded H-NS: A Potential Achilles Heel in the Bacterial Defence System.

Skennerton et al.,
Advanced Water Management Centre, The University of Queensland, St. Lucia, Queensland, Australia, Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences and Institute for Molecular Bioscience, The University of Queensland, St. Lucia, Queensland, Australia

... Annotation of phage contigs. Open Reading Frames (ORFs) were predicted using FGENESB (www.softberry.com) to call the position of the ORFs. Each ORF was extracted and compared against the NCBI non-redundant protein database (nr) using BLASTp. ...


BMC Genomics
2011, 12:576 doi:10.1186/1471-2164-12-576

Comparative genomics of the type VI secretion systems of Pantoea and Erwinia species reveals the presence of putative effector islands that may be translocated by the VgrG and Hcp proteins

Maayer et al.,
1 Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa 2 Agroscope Changins-Wadenswil ACW, Division of Plant Protection, Wadenswil, Switzerland

...Proteins encoded in the vgrG and hcp islands were identified using the FgenesB [56] and Orf finder...


International Journal of Food Microbiology
Volume 146, Issue 1, 15 March 2011, Pages 23–30 DOI: 10.1016/j.ijfoodmicro.2011.01.033,

cspB encodes a major cold shock protein in Clostridium botulinum ATCC 3502

Soderholm et al.,
a Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland b Centre for Biomolecular Sciences, School of Molecular Medical Sciences, University of Nottingham, Nottingham, UK

... 2007). Based on the prediction made with FGENESB bacterial operon and gene prediction tool (http://www.softberry.com), none of the genes is located in an operon. The genes next to the three csp genes are presented in Fig. 3. ...


BMC Microbiology
2011, 11:25 doi:10.1186/1471-2180-11-25

Complete genome sequence of a serotype 11A, ST62 Streptococcus pneumoniae invasive isolate

Camilli et al.,
1 Department of Infectious, Parasitic and Immune-mediated Diseases, Istituto Superiore di Sanita, Rome, Italy 2 Italian National Research Council, Institute for Biomedical Technologies, Milan, Italy

...The generated sequences were annotated identifying coding genes by cross prediction from the FGENESB package http://www.softberry.com/ webcite, th...


Molecular & Cellular Proteomics
December 1, 2011 , 10, M111.011627. doi: 10.1074/mcp.M111.011627

Proteogenomic Analysis of Mycobacterium tuberculosis By High Resolution Mass Spectrometry

Kelkar et al.,
From the ‡Institute of Bioinformatics, International Technology Park, Bangalore, 560 066, India, §Amrita School of Biotechnology, Amrita University, Kollam 690 525, India

...Two gene prediction programs, FgeneSB and GeneMark as well as the Orfind tool from NCBI were used to find ORFs in the region to which these GSSPs were mapped (18, 19)....


PLoS ONE
2011, 6(4): e18551. doi:10.1371/journal.pone.0018551

Evidence for Reductive Genome Evolution and Lateral Acquisition of Virulence Functions in Two Corynebacterium pseudotuberculosis Strains

Ruiz et al.,
1Research Center Rene? Rachou, Oswaldo Cruz Foundation, Belo Horizonte, Minas Gerais, Brazil, 2Department of General Biology, Federal University of Minas Gerais, Belo Horizonte, Minas Gerais, Brazil

...Structural annotation was performed using the following software: FgenesB: gene predictor (www.softberry.com); R...


PNAS
September 28, 2010 vol. 107 no. 39 16828-16833 doi: 10.1073/pnas.1011557107

Identification of the biosynthetic gene cluster for the pacidamycin group of peptidyl nucleoside antibiotics

Wenjun Zhang a,b, Bohdan Ostash c,d, and Christopher T. Walsh a,1
a Department of Biological Chemistry and Molecular Pharmacology and c Department of Microbiology and Moledular Genetics, Harvard Medical School, Boston, MA 02115; b Department of Chemical and Biomolecular Engineering, University of California, Berkeley, CA 94720

... 2.2.18) downloaded from the National Center for Biotechnology Information Web site. ORFs were detected and analyzed using online program FGENESB (Softberry), and the putative roles of the proteins were assigned using protein–protein BLAST and Pfam analysis. ...


The ISME Journal
8 July 2010, doi:10.1038/ismej.2010.94

Ecogenomics and genome landscapes of marine Pseudoalteromonas phage H105/1

Melissa Beth Duhaime, Antje Wichels, Jost Waldmann, Hanno Teeling and Frank Oliver Glockner

... hmm (prokaryotic version using bacterial or archaeal genetic code, precomputed Pseudoalteromonas haloplanktis chromosome 1 model and default settings) (Besemer et al., 2001) and (ii) FGENESB (generic bacterial model, default settings; Softberry, Mount Kisco, NY, ... 


Appl. Environ. Microbiol.
doi:10.1128/AEM.00928-10

Functionality of sortase A in Lactococcus lactis

Dieye et al.,
INRA, UMR1319 Micalis, Batiment 222, Domaine de Vilvert, F-78352 Jouy-en-Josas, France; Department of Molecular Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Kerklaan 30, 9751 NN Haren, The Netherlands

... SrtA is annotated 59 as a putative 287 amino acid protein. 60 In silico analysis of the srtA locus using the gene prediction server FGENESB (Softberry) 61 (http://linux1.softberry.com/berry.phtml? topic=fgenesb&group=programs&subgroup=gfindb) indicated a 62 ... 


Applied and Environmental Microbiology
March 2010, p. 1633-1641, Vol. 76, No. 5, doi:10.1128/AEM.02169-09

Expanding Small-Molecule Functional Metagenomics through Parallel Screening of Broad-Host-Range Cosmid Environmental DNA Libraries in Diverse Proteobacteria

Jeffrey W. Craig, Fang-Yuan Chang, Jeffrey H. Kim, Steven C. Obiajulu, and Sean F. Brady
Howard Hughes Medical Institute, Laboratory of Genetically Encoded Small Molecules, The Rockefeller University, 1230 York Avenue, New York, New York 10065

... Each cosmid was sequenced by 454 pyrosequencing, and the sequences were analyzed for putative open reading frames (ORFs) using GLIMMER3.02 (12) and SoftBerry FGENESB: Bacterial Operon and Gene Prediction Program (http://linux1.softberry.com/berry.phtml?topic ... 


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

... Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ... 


Journal of Microbiology
doi:10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)  Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland (2)  Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ... 


International Journal of Food Microbiology
Volume 141, Issue 3, 15 July 2010, Pages 222-228

Characterization of pLAC1, a cryptic plasmid isolated from Lactobacillus acidipiscis and comparative analysis with its related plasmids

Asteri et al.,
a Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece b Department of Biochemistry and Molecular Biology, Faculty of Biology, National and Kapodistrian University of Athens, Panepistimioupolis-Zographou, 157 84 Athens, Greece

... 1999). Ab initio orf finding was performed using several bioinformatics tools, including heuristic GeneMark (Besemer & Borodovsky, 1999), FGENESB (www.softberry.com) and MetaGeneAnnotator (Noguchi et al., 2006). Only ...


Journal of Bacteriology
July 2010, p. 3337-3344, Vol. 192, No. 13 doi:10.1128/JB.00274-10

Treponema denticola PrcB Is Required for Expression and Activity of the PrcA-PrtP (Dentilisin) Complex{triangledown}

Godovikova et al.,
Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, Michigan

... Annotation of the prcB open reading frame was done using the FGENESB algorithm trained to the T. denticola genome sequence (Softberry, Inc., Mt. Kisco, NY). A predicted 70 class promoter upstream of prcB was identified using BPROM software (Softberry, Inc., Mt. ... 


Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10

Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6

Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2

...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC islands were performed using CpGFinder (http://linux1.softberry.com). ... .


J Microbiol.
2010 Jun;48(3):318-24. Epub 2010 Jun 23.

Cel8H, a novel endoglucanase from the halophilic bacterium Halomonas sp. S66-4: molecular cloning, heterogonous expression, and biochemical characterization

Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, PR China.

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were predicted using FGENSB and BPROM (http://linux1.softberry.com/berry.phtml). ... Genes in the 3.3 kb DNA fragment were predicted using FGENSB in the softberry website. ... 


PLoS ONE
2010, 5(9): e13092. doi:10.1371/journal.pone.0013092

Functional Metagenomics: A High Throughput Screening Method to Decipher Microbiota-Driven NF-?B Modulation in the Human Gut

Lakhdari et al.,
INRA, UMR 1319 Micalis, Jouy-en-Josas, France, 2 LibraGen S.A., Toulouse, France

... Evry, France). The sequence is available on GenBank (accession number HQ231916). Potential transcription units were detected using SoftBerry's software FGENESB (http://linux1.softberry.com/berry.phtml). Potential ORFs ... 


Microbiology
2010, DOI 10.1099/mic.0.046045-0

The cAMP-Receptor Protein (CRP) positively regulates the yihU-yshA operon in Salmonella enterica serovar Typhi

Villarreal et al.,
1 Universidad Andres Bello; 2 Universidad Nacional Autonoma de Mexico

... In silico analyses, to evaluate the transcriptional organization of the yihU-yshA cluster, were performed using the FGENESB program (http://www.softberry.com), the ... (http://www.softberry. com), programs which recognize and identify DNA patterns to ...


Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10

Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9

Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2

... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc., 234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator 236 sequences using BPROM and FindTerm programs (Softberry Inc.). ... 


Microbiology
2010, DOI 10.1099/mic.0.041491-0

ccrABEnt serine recombinase genes are widely distributed in the Enterococcus faecium and Enterococcus casseliflavus species-groups and expressed in E. faecium

Bjorkeng et al.,
1 University of Tromso; 2 University Hospital of North-Norway; 3 CODA-CERVA-VAR; 4 UMCU

... 2010.02.08), Gene Mark (v2.4) (Besemer & Borodovsky, 1999), FGENESB 113 (www.softberry. com 2010.02.08), and ARTEMIS (Wellcome Trust Genome Campus, 114 Hinxton, Cambridge, UK). Pairwise comparison and multiple sequence alignments were 115 ... 


International Journal of Food Microbiology
Volume 144, Issue 3, 5 January 2011, Pages 400-405 doi:10.1016/j.ijfoodmicro.2010.10.026

Genome analysis of Lactobacillus fermentum temperate bacteriophage FPYB5

Xiuhong Zhang a, b, Shaohua Wang a, Tingting Guo a and Jian Kong a
a State Key Laboratory of Microbial Technology, Shandong University, Jinan, China 250100 b College of Life Science, Shanxi Normal University, Linfen, China 041000

... Sequence analysis was performed using BlastX, BlastN, BlastP and FastA programs. Putative ORFs were also identified using GenMark (http://opal.biology.gatech.edu/GeneMark/ gmhmm2_prok.cgi) and fgenesb software (http://www.softberry.com/). ...


PLoS ONE
5(1): e8812. doi:10.1371/journal.pone.0008812

Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community

Allgaier et al.,
1 Deconstruction Division, Joint BioEnergy Institute, Emeryville, California, United States of America, 2 Department of Biological and Agricultural Engineering, University of California Davis, Davis, California, United States of America

.. scores. After manual frameshift correction, genes were called using fgenesb (http://www.softberry.com). For ... Iodobacteriophage. Genes were predicted using fgenesV (www.softberry.com). (1.12 MB EPS). Figure S2. Correspondence ... 


Applied and Environmental Microbiology
June 2010, p. 3715-3722, Vol. 76, No. 11, doi:10.1128/AEM.02753-09

Characterization of Genes Responsible for the CO-Linked Hydrogen Production Pathway in Rubrivivax gelatinosus

Vanzin et al.,
National Renewable Energy Laboratory, 1617 Cole Blvd., Golden, Colorado 80401

... as noted above. Sequence analysis. Open reading frames (ORFs) were predicted with FGENESB (Softberry, Inc.) and SYCO (synonymous codon usage Gribskov statistic plot) trained on the Rx. gelatinosus codon usage table ... 


BMC Genomics
2010, 11:350doi:10.1186/1471-2164-11-350

Identification of novel non-coding small RNAs from Streptococcus pneumoniae TIGR4 using high-resolution genome tiling arrays

Kumar et al.,
1 Department of Basic sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS 39762, USA 2 Institute for Digital Biology, Mississippi State University, Mississippi State, MS 39762, USA

... potential to code smaller proteins. Further analysis of the DNA sequence in these regions using FGENESB gene prediction tool (www.softberry.com) identified the presence of smaller ORF (open reading frame). We did not find any predicted promoter sequences in the ... 


Journal of Proteomics
Volume 73, Issue 5, 10 March 2010, Pages 917-931 doi:10.1016/j.jprot.2009.12.005

Proteome of Gluconacetobacter diazotrophicus co-cultivated with sugarcane plantlets

dos Santos MF, Muniz de Padua VL, de Matos Nogueira E, Hemerly AS, Domont GB.
a Federal University of Parana, Campus Palotina, Brazil b Federal University of Rio de Janeiro, Laboratory of Protein Chemistry/Rio de Janeiro Proteomics Network, Department of Biochemistry, Institute of Chemistry/Brazil

... To understand the biological roles of identified proteins, the web version of FGENESB Suite of Bacterial Operon and Gene Finding Programs (http://www.softberry.com/) was used for the analysis of the genetic organization around the ORFs of the differentially expressed proteins ... 


BMC Genomics.
2010 Sep 8;11:489.

Markedly different genome arrangements between serotype a strains and serotypes b or c strains of Aggregatibacter actinomycetemcomitans

Kittichotirat W, Bumgarner R, Chen C.
Division of Periodontology, Diagnostic Sciences and Dental Hygiene, Herman Ostrow School of Dentistry of the University of Southern California, Los Angeles, CA, USA.

... fragments. Similar results were obtained using FGENESB (http://linux1.softberry.com/berry. phtml?topic=fgenesb&group=programs&subgroup= gfindb) (data not shown). Features of genome rearrangement breakpoints. Genome rearrangements ... 


PLoS Pathog
2010 6(4): e1000845. doi:10.1371/journal.ppat.1000845

A Genomic Survey of Positive Selection in Burkholderia pseudomallei Provides Insights into the Evolution of Accidental Virulence

Nandi et al.,
1 Genome Institute of Singapore, Singapore, Republic of Singapore, 2 Defense Medical and Environmental Research Institute, DSO National Laboratories, Singapore, Republic of Singapore

... Procedures) Act 1986. Genome Annotations and Comparative Analysis. Bp genes were predicted using FGENESB [http://linux1.softberry.com/berry.phtml??topic= fgenesb&group=help&subgroup=gfindb (Softberry)]. tRNA genes ... 


Gene.
2010 Dec 1;469(1-2):31-44. Epub 2010 Aug 12

Genome-wide survey for PilR recognition sites of the metal-reducing prokaryote Geobacter sulfurreducens

Krushkal et al.,
Department of Preventive Medicine, University of Tennessee Health Science Center, Memphis, TN 38163, USA

... Operon prediction The operon organization of the G. sulfurreducens genome (GenBank accession: AE017180) was predicted using the commercial version of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc; 2003-2008), as described earlier ... 


Methods Mol Biol.
2010, Volume 666, Part 2, 197-218, DOI: 10.1007/978-1-60761-820-1_14

Oral bacterial genome sequencing using the high-throughput Roche Genome Sequencer FLX System

Nicholas C.K. Heng and Jo-Ann L. Stanton
Faculty of Dentistry, Sir John Walsh Research Institute, University of Otago, Dunedin, New Zealand.

... 14.1). 2. Gene prediction can be performed using Web-based tools such as GeneMark.hmm (12) and FGENESB (http:// linux1.softberry.com/berry.phtml?topic= fgenesb&group= programs&subgroup=gfindb) (see Note 27). Another ...


Appl. Environ. Microbiol.
doi:10.1128/AEM.00473-09 2009

Comparative metagenomic analysis of a microbial community from 4000 m at Station ALOHA in the North Pacific Subtropical Gyre

Konstantinos T. Konstantinidis, Jennifer Braff, David M. Karl, and Edward F. DeLong

10 FGENESB pipeline for automatic annotation of bacterial genomes from Softberry 11 (http://www.softberry.com/berry.phtml), using the following parameters and cutoffs: general 12 ...


Plasmid
Volume 61, Issue 1, January 2009, Pages 52-64

Bioinformatic and partial functional analysis of pEspA and pEspB, two plasmids from Exiguobacterium arabatum sp. nov. RFL1109

Jakubauskas et al.,
aInstitute of Biotechnology, Graiciuno g. 8, Vilnius LT-02241, Lithuania bDepartment of Plant Physiology and Microbiology, Faculty of Natural Sciencies, Vilnius University, Ciurlionio g. 21/27, Vilnius LT-03101, Lithuania

... Additionally, the FgenesB program at SoftBerry (http://www.softberry.com) was employed for gene prediction using bacterial generic model. The predicted ORFs and the putative intergenic sequences were further examined by visual inspection. ...


Journal of Bacteriology
January 2009, p. 210-219, Vol. 191, No. 1

Interaction between Bacteriophage DMS3 and Host CRISPR Region Inhibits Group Behaviors of Pseudomonas aeruginosa

Zegans et al.,
Department of Microbiology and Immunology, Rm. 505 Vail Building, Dartmouth Medical School, Hanover, New Hampshire 03755,1 Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, New Hampshire 03756

... Transcriptional units were predicted with the help of FGENESB (SoftBerry, Mt. Kisco, NY) set to the generic bacterial genome setting and utilizing default settings. ... Kisco, NY; http://www.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Microbiology
155 (2009), 95-105; DOI 10.1099/mic.0.021873-0

Involvement of the oscA gene in the sulphur starvation response and in Cr(VI) resistance in Pseudomonas corrugata 28

Carlo Viti, Francesca Decorosi, Annalisa Mini, Enrico Tatti and Luciana Giovannetti
Dipartimento di Biotecnologie Agrarie, Sez. Microbiologia, Universita` degli Studi di Firenze, Piazzale delle Cascine 24, 50144 Firenze, Italy

... nlm.nih.gov). Identification of operons was performed using the FGENESB pattern/Markov chain-based prediction program from Softberry (http://softberry.com/ berry.phtml). RNA extraction and cDNA synthesis. For RNA extraction ...


Journal of Bacteriology
March 2009, p. 1910-1923, Vol. 191, No. 6

Regulation of Cyclic Lipopeptide Biosynthesis in Pseudomonas fluorescens by the ClpP Protease

I. de Bruijn and J. M. Raaijmakers
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands

... clpP was identified by sequencing the regions flanking the transposon insertions as described by De Sousa et al. (17). The flanking regions of clpP were sequenced by primer walking, and open reading frames (ORFs) were identified with the Softberry FGENESB program. ...


Applied and Environmental Microbiology
August 2009, p. 5345-5355, Vol. 75, No. 16

Comparative Metagenomic Analysis of a Microbial Community Residing at a Depth of 4,000 Meters at Station ALOHA in the North Pacific Subtropical Gyre

Konstantinos T. Konstantinidis,1, Jennifer Braff,1 David M. Karl,2 and Edward F. DeLong 1
Department of Civil and Environmental Engineering and Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts,1 University of Hawaii, Honolulu, Hawaii2

... Fosmid and untrimmed WGS sequences were annotated with the FGENESB pipeline for automatic annotation of bacterial genomes from Softberry, using the following parameters and cutoffs: general parameter file; open reading frame size, 90 nucleotide bases; expectation e ...


Appl Environ Microbiol.
2009 Jul;75(13):4599-615. Epub 2009 May 8.

Community genomic and proteomic analyses of chemoautotrophic iron-oxidizing "Leptospirillum rubarum" (Group II) and "Leptospirillum ferrodiazotrophum" (Group III) bacteria in acid mine drainage biofilms

Goltsman et al.,
University of California-Berkeley, 94720, USA.

... The numerous small contigs were manually curated into 10 scaffolds. Annotation. Gene predictions for Leptospirillum groups II and III were made using a combination of FgenesB (Softberry, Inc.), CRITICA (11), and Glimmer (21). ...


OMICS.
2009 Oct;13(5):439-49.

GSEL version 2, an online genome-wide query system of operon organization and regulatory sequence elements of Geobacter sulfurreducens

Qu Y et al.,
Department of Preventive Medicine, The University of Tennessee Health Science Center, Memphis, Tennessee 38163, USA

... Operon organization of the G. sulfur- reducens genome was predicted using a commercial version of the FGENESB software (V. Solovyev and A. Salamov, Soft- berry, Inc, 2003-2008) (Tyson et al., 2004), as described earlier (Krushkal et al., 2007; Mahadevan et al., 2008; Yan ...


BMC Genomics.
2009 Aug 24;10:395.

A draft genome sequence and functional screen reveals the repertoire of type III secreted proteins of Pseudomonas syringae pathovar tabaci 11528

Studholme et al.,
The Sainsbury Laboratory, Norwich, UK

... pseudomonads Using the FgenesB annotation pipeline (http://www.softberry.com), we identified 6,057 potential Page 7. ... We used Softberry's FgenesB pipeline (http://www. softberry.com) to predict genes encoding rRNAs, tDNAs and proteins. ...


Veterinary Microbiology
Volume 136, Issues 3-4, 12 May 2009, Pages 326-334

Characterisation of an extracellular vibriolysin of the fish pathogen Moritella viscosa

Bjornsdottir et al.,
aInstitute for Experimental Pathology, University of Iceland, Keldur, Vesturlandsvegi, 112 Reykjavik, Iceland bMatis-Prokaria, Gylfaflot 5, 112 Reykjavik, Iceland

... The NCBI Basic Local Alignment Search Tool (BLAST) was used for comparing protein sequences and CD search for detecting conserved domains. Putative open reading frames (ORF) were identified by the SoftBerry FGENESB program. ...


Nucleic Acids Research
doi:10.1093/nar/gkp327

Orphelia: predicting genes in metagenomic sequencing reads

Katharina J. Hoff 1,*, Thomas Lingner 1,2, Peter Meinicke 1 and Maike Tech 1
1Abteilung Bioinformatik, Institut fur Mikrobiologie und Genetik, Georg-August-Universitat Gottingen, Goldschmidtstr. 1, 37077 Gottingen, Germany and 2Center for Genomic Regulation, Comparative Bioinformatics Research Group, Biomedical Research Park, c/Dr. Aiguader 88, 08003 Barcelona, Spain

... Negro (12). Each sample was Sanger sequenced and contains 13 000 reads. The original gene annotation of those reads was created with the commercial program FGENESB (http://www.softberry.com). Note that FGENESB ...


PLoS Genet.
2009 March; 5(3): e1000439.

A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element

Rachel A. F. Wozniak 1,2,3 and Matthew K. Waldor 1,2,3*
1Channing Laboratory, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America 2Howard Hughes Medical Institute, Chevy Chase, Maryland, United States of America

... 5? RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for ...


BMC Microbiology
2009, 9:262 doi:10.1186/1471-2180-9-262

Molecular and biochemical characterization of urease and survival of Yersinia enterocolitica biovar 1A in acidic pH in vitro

Neeru Bhagat and Jugsharan S Virdi
Address: Microbial Pathogenicity Laboratory, Department of Microbiology, University of Delhi South Campus, Benito Juarez Road, New Delhi - 110 021, India

... The open reading frames (ORFs) in the compiled ure gene cluster were identified using GeneMark [26], Gene- Mark.hmm [27], FGENESB [28] and the NCBI ORF finder [29] programs... 28. FGENESB [http://www.softberry.com/berry.phtml] ...


BMC Genomics
2009, 10:3doi:10.1186/1471-2164-10-3

Genome sequence analysis of Helicobacter pylori strains associated with gastric ulceration and gastric cancer

McClain et al.,
1 Department of Medicine, Vanderbilt University School of Medicine, Nashville, TN 37232-2605, USA 2 Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232-2605, USA

... ORFs in the genomes of H. pylori strains 98-10 and B128 were predicted by FGENESB http:/ / www.softberry.com/ berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb webcite[56], an algorithm based on Markov chain models of coding regions and translation and ...


J. Bacteriol.
2008, doi:10.1128/JB.01558-08

Regulation of cyclic lipopeptide biosynthesis in Pseudomonas fluorescens by the ClpP protease

I. de Bruijn and J. M. Raaijmakers
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands

... 13 open reading frames (ORFs) were identified with the Softberry FGENESB program 14 (http://www.softberry.com/berry.phtml). The ...


Microbiology
154 (2008), 2589-2599; DOI 10.1099/mic.0.2008/017244-0

Highly conserved genes in Geobacter species with expression patterns indicative of acetate limitation

Carla Risso, Barbara A. Methe, Hila Elifantz, Dawn E. Holmes and Derek R. Lovley
Department of Microbiology, 203N Morrill Science Center IVN, University of Massachusetts Amherst, Amherst, MA 01003, USA J. Craig Venter Institute, 9712 Medical Center Drive, Rockville, MD 20850, USA

... Operons, promoters and terminators were predicted using the commercial version of the FGENES-B software package (Softberry Inc.) as previously described (Yan ...


FEMS Microbiology Ecology
2008, Volume 66 Issue 1, Pages 45 - 62

Comparative genomics of the pIPO2/pSB102 family of environmental plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas fungivorans Ter331

Mela et al.
Centre for Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands

... The complete nucleotide sequence of pTer331 (40 457 bp) was searched for ORFs using FGENESB (http://www.softberry.com) and by the automated genome ...


Applied and Environmental Microbiology,
December 2008, p. 7152-7162, Vol. 74, No. 23

Proteome-Based Comparative Analyses of Growth Stages Reveal New Cell Cycle-Dependent Functions in the Predatory Bacterium Bdellovibrio bacteriovorus

Mally Dori-Bachash, Bareket Dassa, Shmuel Pietrokovski, and Edouard Jurkevitch
Department of Plant Pathology and Microbiology, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot 76100, Israel,1 Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel

... Operons were predicted with the Softberry fgenesb program using the B. bacteriovorus 100 T genome sequence (http://www.softberry.com/berry.phtml?topic ...


PNAS
November 11, 2008 vol. 105 no. 45 17516-17521

Metagenome analysis of an extreme microbial symbiosis reveals eurythermal adaptation and metabolic flexibility

Grzymski et al.
aDivision of Earth and Ecosystem Sciences, Desert Research Institute, 2215 Raggio Parkway, Reno, NV 89512; bCollege of Marine and Earth Studies, University of Delaware, Lewes, DE 19958;

... We integrated several annotation tools, including BLAST (46), FgenesB (Softberry) for gene calling and COG assignment, PRIAM (47), and a custom Pfam database ...


Microbiology and Molecular Biology Reviews,
December 2008, p. 557-578, Vol. 72, No. 4

A Bioinformatician's Guide to Metagenomics

Victor Kunin, Alex Copeland, Alla Lapidus, Konstantinos Mavromatis, and Philip Hugenholtz
Microbial Ecology Program,1 Quality Assurance Department,2 Microbial Genomics Department,3 Genome Biology Program, DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California4

.. of the same or related organisms, can enhance the quality of the predicted genes for some of those programs (eg, fgenesB [http://www.softberry.com]), while ...


Biochem. J.
(2008) Immediate Publication, doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

Khurana et al.
Division of Entomology, CSIRO, Canberra, ACT 2601, Australia.

... Genomic and phylogenetic analysis. FGENESB (http://www.softberry.com) was used to detect open reading frames (ORFs), which were then manually confirmed. ...


J Bacteriol.
2008 May;190(9):3362-73. Epub 2008 Feb 29.

The sim operon facilitates the transport and metabolism of sucrose isomers in Lactobacillus casei ATCC 334

Thompson J, Jakubovics N, Abraham B, Hess S, Pikis A.
Microbial Biochemistry and Genetics Unit, NIDCR, National Institutes of Health, Bldg. 30, Rm. 325, Convent Dr. MSC-4350, Bethesda, MD 20892, USA

... The structure of operons was predicted by automated genome annotation using the fgenesB module of the MolQuest software (Softberry Inc.). ...


BMC Genomics
2008, 9:471 doi:10.1186/1471-2164-9-471

Comparative genomics of Geobacter chemotaxis genes reveals diverse signaling function

Hoa T Tran, Julia Krushka, Frances M Antommattei, Derek R Lovley and Robert M Weis
1Department of Chemistry, University of Massachusetts, Amherst, MA 01003, USA, 2Department of Preventive Medicine, University of Tennessee Health Science Center, Memphis, TN 38163, USA, 3Sharon Woods Technical Center, Procter and Gamble, Cincinnati, OH 45040, USA and 4Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... The organization of che gene operons in the Geobacter sp. was predicted with FGENESB (Softberry Inc., http:// www.softberry.com). FGENESB identifies protein-coding genes with Markov chain models of coding regions and translation start and termination sites, and annotates them with information from public databases. The sequence parameters (coding content, oligonucleotide composition, and gene length distribution) were estimated in FGENESB for each genome separately through an iterative procedure with the minimum ORF length set to 100 nt. ...


Expert Opinion on Drug Discovery
August 2008, Vol. 3, No. 8, Pages 903-929 (doi:10.1517/17460441.3.8.903)

Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery

Nishikant V Wase & Phillip C Wright
The University of Sheffield, Biological and Environmental Systems Group, Department of Chemical and Process Engineering, Mappin St., Sheffield, S1 3JD, UK +44 0 114 2227577; +44 0 114 2227501

... This can be done through software packages such as GLIMMER [61] and GENEMARK [62], and a list of software packages found on Softberry [63], including fgenesB ...


Journal of Microbiological Methods
Volume 75, Issue 3, December 2008, Pages 515-522

A procedure for the metagenomics exploration of disease-suppressive soils

J.D. van Elsas, A.J. Speksnijder and L.S. van Overbeek
aDepartment of Microbial Ecology, Centre for Ecological and Evolutionary Studies University of Groningen, Kerklaan 30, 9750AA Haren, The Netherlands bGGD Amsterdam, Nieuwe Amstergracht 100, 1018WT Amsterdam, The Netherlands cPlant Research International BV, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands

... Sequence assemblies were screened with the FgenesB programme (Softberry Inc.) and the PKS-NRPS search tool (http://www.nii.res.in/nrps-pks.html). ...


Trends in Genetics
Volume 24, Issue 3, March 2008, Pages 142-149

Bioinformatics challenges of new sequencing technology

Mihai Pop and Steven L. Salzberg
Center for Bioinformatics and Computational Biology, University of Maryland, MD 20742, USA

.. They compared fgenesb (www.softberry.com) with a pipeline combining CRITICA [43] and Glimmer [44], using three datasets of varied complexity constructed by ..


Foodborne Pathogens and Disease.
August 1, 2008, 5(4): 387-398. doi:10.1089/fpd.2008.0113.

Genomic Evidence for Interspecies Acquisition of Chromosomal DNA from Campylobacter jejuni by Campylobacter coli Strains of a Turkey-Associated Clonal Group (Cluster II)

Kamfai Chan, Driss Elhanafi, Sophia KathariouBowler et al.
Department of Food Science, North Carolina State University, Raleigh, North Carolina.

... Assembled DNA sequences were submitted to the web-based FgenesB program (Softberry Inc., http:==www.softberry.com) to identify open reading frames (ORFs). ...


Applied and Environmental Microbiology
July 2008, p. 4149-4163, Vol. 74, No. 13 doi:10.1128/AEM.02371-07

In Silico and In Vivo Evaluation of Bacteriophage fEF24C, a Candidate for Treatment of Enterococcus faecalis Infections

Jumpei Uchiyama, Mohammad Rashel, Iyo Takemura, Hiroshi Wakiguchi, and Shigenobu Matsuzaki
Departments of Pediatrics,1 Microbiology and Infection, Kochi Medical School, Oko-cho, Nankoku City, Kochi 783-8505, Japan2

... first predicted by the following gene predication tools: GeneMark VIORIN (http://opal.biology.gatech.edu/GeneMark/) (3), FGENESB (http://www.softberry.com/ ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


J. Bacteriol.
July 2008, p. 4859-4864, Vol. 190, No. 14 doi:10.1128/JB.02022-07

Genes and Enzymes of Azetidine-2-Carboxylate Metabolism: Detoxification and Assimilation of an Antibiotic

Carol Gross, Roderick Felsheim, and Lawrence P. Wackett
Department of Biochemistry, Molecular Biology and Biophysics and BioTechnology Institute, 140 Gortner Laboratory, University of Minnesota, St. Paul, MN 55108

... open reading frames were found in the seven kilobase fragment using BlastX on the 21 NCBI server and the Softberry program FGENESB. ...


Environmental Microbiology
Volume 10 Issue 1 Page 200-207, January 2008

Rapidly evolving CRISPRs implicated in acquired resistance of microorganisms to viruses

Gene W. Tyson, Jillian F. Banfield
Departments of 1Environmental Science, Policy and Management and 2Earth and Planetary Sciences, University of California, Berkeley, Berkeley, CA 94720, USA.

... Annotations were performed using fgenesb (Softberry) and were subsequently manually refined using artemis (Rutherford et al., 2000). ...


Antimicrob. Agents Chemother.
doi:10.1128/AAC.01643-07

Whole genome pyrosequencing of an epidemic multidrug resistant Acinetobacter baumannii of the European clone II

Iacono et al.,
National Research Council, Segrate, 20090 Milan; Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanita`; Department of Biology, University Roma Tre, Rome, Italy; Center for Biological Sequence Analysis, Technical University of Denmark, Lyngby, Denmark

... Coding genes were identified by crossing predictions from FGENESB package (24) 19 (http://www.softberry.com/), GeneMark (7) and GLIMMER (14). ...


Applied and Environmental Microbiology,
February 2008, p. 774-782, Vol. 74, No. 3

Enzymic Approach to Eurythermalism of Alvinella pompejana and Its Episymbionts

Charles K. Lee, S. Craig Cary, Alison E. Murray, and Roy M. Daniel
Department of Biological Sciences, University of Waikato, Hamilton, New Zealand, College of Marine and Earth Studies, University of Delaware, Lewes, Delaware, Division of Earth and Ecosystem Sciences, Desert Research Institute, Reno, Nevada

... The metagenomic sequences were annotated with a custom annotation pipeline based on the FGenesB package (SoftBerry Inc., Mount Kisco, NY), blastX, and PRIAM ...


OMICS: A Journal of Integrative Biology
March 1, 2008, 12(1): 33-59. doi:10.1089/omi.2007.0043.

Characterizing Regulation of Metabolism in Geobacter sulfurreducens through Genome-Wide Expression Data and Sequence Analysis

Radhakrishnan Mahadevan et al.,
Department of Microbiology, University of Massachusetts, Amherst, Massachusetts. Department of Preventive Medicine, University of Tennessee Health Science Center, 66 Memphis, Tennessee.

... Operons were predicted using the commercial version of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc., 2003-2005) that ...


FEMS Microbiology Ecology
Volume 65 Issue 2, Pages 238 - 250 doi:10.1111/j.1574-6941.2008.00436.x

Discovery of a bacterial gene cluster for catabolism of the plant hormone indole 3-acetic acid

Johan H.J. Leveau, Saskia Gerards
Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands

... FGENESB (SoftBerry, Mount Kisco, NY) and GenDB (Meyer et al., 2003) were used to annotate the consensus DNA of the largest contig. Results. ...


PLoS ONE
2008; 3(4): e1862.

The Airborne Metagenome in an Indoor Urban Environment

Susannah G. Tringe et al.,
1Department of Energy (DOE) Joint Genome Institute, Walnut Creek, California, United States of America 2Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, California, United States of America

... Protein prediction. All assembled contigs as well as all singlet reads that failed to assemble were annotated using Fgenesb (www.softberry.com). ...


Infection and Immunity
April 2008, p. 1485-1497, Vol. 76, No. 4

Further Characterization of Vibrio vulnificus Rugose Variants and Identification of a Capsular and Rugose Exopolysaccharide Gene Cluster

Brenda L. Grau et al.,
Department of Biological Sciences,1 Socolofsky Microscopy Center,2 Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana3

... Using the web-based FGENESB: Bacterial Operon and Gene Prediction algorithm (http://www.softberry.com/cgi-bin/programs/gfindb/fgenesb.pl), two operons were ...


Molecular Systems Biology
4 Article number: 198 doi:10.1038/msb.2008.35

Millimeter-scale genetic gradients and community-level molecular convergence in a hypersaline microbial mat

Kunin et al.,
Microbial Ecology Program, DOE Joint Genome Institute, Walnut Creek, CA, USA Structural and Computational Biology Unit, European Molecular Biology Laboratory, Heidelberg, Germany

... Genes were predicted on vector and quality-trimmed reads with fgenesb (http://www. softberry.com/) using a generic bacterial model, resulting in an average of ...


Journal of Bacteriology,
April 2008, p. 2777-2789, Vol. 190, No. 8

Massetolide A Biosynthesis in Pseudomonas fluorescens

I. de Bruijn,1 M. J. D. de Kock,1 P. de Waard,2 T. A. van Beek,3 and J. M. Raaijmakers1*
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands,1 Wageningen NMR Centre, Wageningen University, Wageningen, The Netherlands,2 Natural Products Chemistry Group, Laboratory of Organic Chemistry, Wageningen University, Wageningen, The Netherlands3

... Bacterial operons and genes were subsequently predicted by the Softberry FGENESB program (Softberry, Inc., Mount Kisco, NY), and the identified open reading ...


FEMS Microbiology Ecology
2008 doi:10.1111/j.1574-6941.2008.00472.x

Comparative genomics of the pIPO2/pSB102 family of environmental plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas fungivorans Ter331

Francesca Mela et. al.,
1Centre for Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands; 2Department of Microbial Ecology, University of Groningen, Haren, The Netherlands; and 3Argonne National Laboratory, Mathematics and Computer Science Division, Argonne, IL, USA

... The complete nucleotide sequence of pTer331 (40 457 bp) was searched for ORFs using FGENESB (http://www.softberry.com) and by the automated genome ...


Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0

Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes

Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry. com), were used for operon and gene predictions. RESULTS. ...


Infection and Immunity,
September 2007, p. 4482-4489, Vol. 75, No. 9

Genetic Basis for the New Pneumococcal Serotype, 6C

In Ho Park, Saeyoung Park, Susan K. Hollingshead, and Moon H. Nahm
Departments of Pathology,1 Microbiology, University of Alabama at Birmingham, 845 19th Street South, BBRB 614, Birmingham, Alabama 35294

... and genes, promoters, and transcription terminators in the capsule gene locus were identified using fgenesB, BPROM, and FindTerm (Softberry Inc.), which are ...


Microbiology
153 (2007), 3478-3498; DOI 10.1099/mic.0.2007/008250-0

Molecular analysis of the distribution and phylogeny of dissimilatory adenosine-5'-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and gene arrangement in operons was performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Microbiology
153 (2007), 2026-2044; DOI 10.1099/mic.0.2006/003152-0

Phylogeny of the alpha and beta subunits of the dissimilatory adenosine-5'-phosphosulfate (APS) reductase from sulfate-reducing prokaryotes – origin and evolution of the dissimilatory sulfate-reduction pathway

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and operons in genome data were performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Journal of Biotechnology
Volume 131, Issue 4, 30 September 2007, Pages 371-378

Characterization of the unique organization and co-regulation of a gene cluster required for phenol and benzene catabolism in Pseudomonas sp. M1

Pedro M. Santos and Isabel Sa'-Correia
BB, Institute for Biotechnology and Bioengineering, Centre for Biological and Chemical Engineering, Instituto Superior Te'cnico, Av. Rovisco Pais, 1049-001 Lisboa, Portugal

... This 9 kb chromosomal DNA sequence was analyzed using the gene prediction program FGENESB from the Softberry online package (http://www.softberry.com/), the ...


Applied and Environmental Microbiology
August 2007, p. 4984-4995, Vol. 73, No. 15

Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis

Gerald D. Baldridge, Nicole Y. Burkhardt, Roderick F. Felsheim, Timothy J. Kurtti, and Ulrike G. Munderloh
Department of Entomology, University of Minnesota, St. Paul, Minnesota 55108

... encoded by other bacteria (Table 2). Four pRM genes (pRM17 to pRM20) were identified as members of an operon by the FGENESB program (SoftBerry, Inc.), while ...


European Journal of Plant Pathology
Volume 119, Number 3 / November 2007 p. 279-300

The magic and menace of metagenomics: prospects for the study of plant growth-promoting rhizobacteria

Johan H. J. Leveau
Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands

... al. 2003), Artemis (Rutherford et al. 2000), Glimmer (Delcher et al. 1999), and FGenesB pipeline (www.softberry.com). These programmes ...


Functional & Integrative Genomics
Volume 7, Number 3 / July 2007 p. 229-255

Genome-wide expression profiling in Geobacter sulfurreducens : identification of Fur and RpoS transcription regulatory sites in a rel Gsu mutant

Julia Krushkal et.al.,
Department of Preventive Medicine, University of Tennessee Health Science Center, 66 N. Pauline Ste. 633, Memphis, TN 38163, USA

... 2003) using the commercial version of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc; 2003-2006). ...


Applied and Environmental Microbiology
July 2007, p. 4417-4424, Vol. 73, No. 14

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector

Ju-Hoon Lee, Jamie S. Halgerson, Jeong-Hwan Kim, and Daniel J. O'Sullivan
Department of Food Science and Nutrition and Center for Microbial and Plant Genomics, University of Minnesota, Cargill Building for Microbial and Plant Genomics, 1500 Gortner Ave., St. Paul, Minnesota 55108

... Prediction of open reading frames (ORFs) was conducted with GeneMark (4) and the FgenesB (Softberry, Inc., Mount Kisco, NY) programs. ...


Plasmid
Volume 58, Issue 3, November 2007, Pages 240-248

The polyhydroxyalkanoate genes of a stress resistant Antarctic Pseudomonas are situated within a genomic island

Nicolas D. Ayub, M. Julia Pettinari, Beatriz S. Mendez and Nancy I. Lopez
Departamento de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires, Argentina

... and bacterial operons were predicted by using GeneMark.hmm for Prokaryotes Version 2.4 (Lukashin and Borodovsky, 1998) and FGENESB (http://www.softberry.com). ...


Applied and Environmental Microbiology,
July 2007, p. 4226-4233, Vol. 73, No. 13

Possible Origins of CTnBST, a Conjugative Transposon Found Recently in a Human Colonic Bacteroides Strain

David J. Schlesinger, Nadja B. Shoemaker, and Abigail A. Salyers
Department of Microbiology, University of Illinois, Urbana, Illinois 61801

... reading frames (ORFs) were identified by using two Web-based ORF finding programs, GeneMark (2) and FGENESB: Bacterial Operon and Gene Prediction (Softberry Inc ...


PROTEOMICS
Volume 7, Issue 12 , Pages 2047 - 2058, 2007

Qualitative and comparative proteomic analysis of Xanthomonas campestris pv. campestris 17

Wei-Jen Chung et al.,
Sequencing Core, Genome Research Center, National Yang-Ming University, Taipei, Taiwan

... Operon predic- tion was carried out using FGENESB from Softberry, which predicts genes and operons as well as functional RNA (http://www.softberry.com/berry ...


Nature Biotechnology
25, 447 - 453 (01 Apr 2007)

Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338

Oliynyk et al.,
Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA, UK.

...sequence. Genome analysis and annotation. CDSs were predicted and annotated using the program fgenesB (http://www.softberry.com/), trained ab initio, and manually curated using Artemis (version 8) and a set of in-house PERL scripts....


Environmental Microbiology
Volume 9 Issue 4 Page 846-858, April 2007

Proteorhodopsin photosystem gene clusters exhibit co-evolutionary trends and shared ancestry among diverse marine microbial phyla

Jay McCarren and Edward F. DeLong**
Department of Civil and Environmental Engineering and Division of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA.

... Sequences were assembled with Sequencher v4.5 (Gene Codes, Ann Arbor, MI, USA) and annotated with both FGENESB (Softberry, Mount Kisco, NY, USA) and Artemis ...


BMC Evolutionary Biology
2007, 7:79 (18 May 2007)

Evolution of rhodopsin ion pumps in haloarchaea

Sharma AK et al.,,
1Department of Biochemistry and Molecular Biology, Dalhousie University, 5850 College St., Halifax, Nova Scotia, B3H 1X5, Canada
2Unidad de Microbiologia, Centro de Biologia Molecular y Celular, Universidad Miguel Hernandez, Campus de San Juan, 03550 San Juan, Alicante, Spain

and open reading frames (ORFs) were identified using the fgenesB option under operon and gene finding in bacteria at [66] with Halobacterium sp.


PNAS
| March 27, 2007 | vol. 104 | no. 13 | 5590-5595

Proteorhodopsin photosystem gene expression enables photophosphorylation in a heterologous host

A. Martinez*, A. S. Bradley, J. R. Waldbauer, R. E. Summons, and E. F. DeLong*,
*Department of Civil and Environmental Engineering, Division of Biological Engineering, and Department of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; and Joint Program in Chemical Oceanography, Woods Hole Oceanographic Institution and Massachusetts Institute of Technology, Cambridge, MA 02139

... complete DNA sequence was assembled by using Sequencher version 4.5 (Gene Codes Corporation, Ann Arbor, MI) and annotated with FGENESB (Softberry, Mount Kisco ...


Nature Methods
- 4, 495 - 500 (2007)

Use of simulated data sets to evaluate the fidelity of metagenomic processing methods

Konstantinos Mavromatis et al.,
Department of Energy Joint Genome Institute (DOE-JGI), 2800 Mitchell Drive, Walnut Creek, California 94598, USA.

...We assembled sampled reads using three commonly used genome assemblers (Phrap, Arachne and JAZZ), and predicted genes using two popular gene-finding pipelines (fgenesb and CRITICA/GLIMMER)....
... fgenesb: http://sun1.softberry.com/berry.phtml?topic= fgenesb&group=programs&subgroup=gfindb; FAMeS: http://fames.jgi-psf.org...


Nature Biotechnology
24, 1263 - 1269 (2006) Published online: 24 September 2006; | doi:10.1038/nbt1247

Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities

Hector Garcia Martin et al.,
DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California 94598, USA.

... Over 30,000 coding sequences were predicted in each Phrap assembly using ab initio gene predictions (fgenesb, http://www.softberry.com/). ...


BIOINFORMATICS
Vol. 22 no. 14 2006, pages e359 - e367 doi:10.1093/bioinformatics/btl217

An experimental metagenome data management and analysis system

Victor M. Markowitz et al.,
1Biological Data Management and Technology Center, Lawrence Berkeley National Lab, USA,
2Genome Biology Program, Joint Genome Institute, USA and 3Microbial Ecology Program, Joint Genome Institute, USA

... protein-coding genes (CDSs) are predicted on scaffolds and/or so called shrapnel sequences (single reads that are not incorporated into scaffolds) using microbial gene finders, such as Glimmer (Delcher et al., 1999) or Fgenesb (Soft- Berry, 2006)...


Journal of Bacteriology
December 2006, p. 8283-8293, Vol. 188, No. 23

Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391

Genevieve Girard et al.,
Leiden University, Institute of Biology, Clusius Laboratory, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands,
Leiden University, Leiden Institute of Chemistry, Department of Molecular Genetics, P.O. Box 9502, 2300 RA Leiden, The Netherlands

... gov/BLAST). A search for bacterial promoters and terminators was done using Softberry (http://www.softberry.com). Alignments of ...


Nature Biotechnology ,
24, 1263 - 1269 (01 Oct 2006) Research

Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities

Martin et al.,
DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California 94598, USA

..coding sequences were predicted in each Phrap assembly using ab initio gene predictions (fgenesb, http://www.softberry.com/). The genomic fragments were binned (classified) using a combination of read depth, % GC content,...


PNAS ,
August 22, 2006 vol. 103 no. 34 12897-12902

Deletion of TolC orthologs in Francisella tularensis identifies roles in multidrug resistance and virulence

Gil et al.,
Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120

... 42). The locations of promoters and operons were investigated by using the FGENESB and BPROM programs available from Softberry (Mt. Kisco, NY). ...


Applied and Environmental Microbiology ,
May 2006, p. 3154-3160, Vol. 72, No. 5

Isolation and Sequencing of a Temperate Transducing Phage for Pasteurella multocida

Susana Campoy,1, Jesus Aranda,2, Gerard Alvarez,2 Jordi Barbe,1,2 and Montserrat Llagostera1,2*
Centre de Recerca en Sanitat Animal (CReSA),1 Departament de Genetica i Microbiologia, Universitat Autonoma de Barcelona, Bellaterra, 08193 Barcelona, Spain2

... Open reading frames (ORFs) were identified using Glimmer 2.02 (http://nbc11.biologie. uni-kl.de/glimmer2.02) (8) and FGENESB (http://softberry.com) (34) for ...


Journal of Bacteriology ,
July 2006, p. 5228-5239, Vol. 188, No. 14

Global Transcriptome Analysis of Tropheryma whipplei in Response to Temperature Stresses

Nicolas Crapoulet,1 Pascal Barbry,2 Didier Raoult,1 and Patricia Renesto1*
Unite des Rickettsies, UMR 6020 CNRS, IFR48, Faculte de Medecine, 27, Boulevard Jean Moulin, Marseille, France,1 Institut de Pharmacologie Moleculaire et Cellulaire, UMR 6097 CNRS/UNSA, Sophia Antipolis, France2

... genome. Their coexpression thus confirms the bioinformatic dnaK operon prediction (FGENESB software; Softberry Inc., Mount Kisco, NY). ...


Microbiology ,
152 (2006), 1951-1968

Two novel conjugative plasmids from a single strain of Sulfolobus

Gael Erauso1,2, Kenneth M. Stedman3,4, Harmen J. G. van de Werken1, Wolfram Zillig3, and John van der Oost1
1 Laboratory of Microbiology, Wageningen University, Wageningen, The Netherlands

.. Identification of putative genes and operons was performed using the FGENESB pattern/Markov chain-based prediction program from Softberry (http://softberry.com ...


Molecular Microbiology ,
(2006) 61 (4), 960-977

Metagenomic DNA fragments that affect Escherichia coli mutational pathways

Yang, Hanjing, To, Kam H., Aguila, Sharon J. & Miller, Jeffrey H.
Department of Microbiology, Immunology and Molecular Genetics, and the Molecular Biology Institute, 1602 Molecular Sciences Building, 405 Hilgard Avenue, University of California, Los Angeles, CA 90095, USA

.. The ORFs on each clone were annotated by a bacterial operon and gene prediction program fgenesb ( http:/ / www.softberry.com ) and by comparison with known ...


Applied and Environmental Microbiology ,
May 2006, p. 3154-3160, Vol. 72, No. 5

Isolation and Sequencing of a Temperate Transducing Phage for Pasteurella multocida

Susana Campoy,1, Jesus Aranda,2, Gerard Alvarez,2 Jordi Barbe,1,2 and Montserrat Llagostera1,2*
Centre de Recerca en Sanitat Animal (CReSA),1 Departament de Genetica i Microbiologia, Universitat Autonoma de Barcelona, Bellaterra, 08193 Barcelona, Spain2

... Open reading frames (ORFs) were identified using Glimmer 2.02 (http://nbc11.biologie. uni-kl.de/glimmer2.02) (8) and FGENESB (http://softberry.com) (34) for ...


Applied and Environmental Microbiology,
February 2006, p. 1532-1541, Vol. 72, No. 2

Comparative Genomics of DNA Fragments from Six Antarctic Marine Planktonic Bacteria

Joseph J. Grzymski,1 Brandon J. Carter,1 Edward F. DeLong,2 Robert A. Feldman,3, Amir Ghadiri,3 and Alison E. Murray1
Desert Research Institute, 2215 Raggio Parkway, Reno, Nevada 89512,1 Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139,2 Amersham Biosciences, 928 E. Argues Avenue, Sunnyvale, California 940863

... Two gene finding programs, FgenesB (Softberry Inc.) and GLIMMER (TIGR), identified open reading frames (ORFs). The results from ...


Nature
439, 847-850 (16 February 2006)

Proteorhodopsin lateral gene transfer between marine planktonic Bacteria and Archaea

Niels-Ulrik Frigaard, Asuncion Martinez, Tracy J. Mincer & Edward F. DeLong
Department of Civil and Environmental Engineering and Division of Biological Engineering, Massachusetts Institute of Technology, Building 48, 15 Vassar Street, Cambridge, Massachusetts 02139, USA.

... Subcloning kit (Invitrogen) combined with sequence assembly with Sequencher v. 4.5 (Gene Codes Corporation) and annotation with FGENESB (Softberry) and Artemis ...


FEMS Microbiology Letters,
2006 257 (2), 177-181.

Isolation of a novel plasmid, pNi15, from Enterobacter sp. Ni15 containing a nickel resistance gene

Young-Keun Lee et al.,
Radiation Application Research Division, ARTI, Korea Atomic Energy Research Institute, Sinjeong-Dong, Jeongeup, Korea

... bp in size and it contains six ORFs (four in a plus strand and two in a minus strand) which were analyzed using the FGENESB program at http://www.softberry.com ...


PLoS Biol
2006 4(4): e95

Pathways of Carbon Assimilation and Ammonia Oxidation Suggested by Environmental Genomic Analyses of Marine Crenarchaeota

Steven J. Hallam et al.,
Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America,

... Fosmid sequences were annotated using the FGENESB pipeline for automatic annotation of bacterialgenomes from Softberry (http:/ / www.softberry.com/ berry.phtml ...


Applied and Environmental Microbiology
December 2005, p. 8506-8513, Vol. 71, No. 12

Sequence and Expression Analyses of Cytophaga-Like Hydrolases in a Western Arctic Metagenomic Library and the Sargasso Sea

Matthew T. Cottrell, Liying Yu, and David L. Kirchman
University of Delaware, College of Marine Studies, Lewes, Delaware 19958

... obtained from the Welcome Trust Sanger Institute (http://www.sanger.ac.uk/Software/ Artemis/) and using the FGENESB website (http://www.softberry.ru/) (Softberry ...


Infection and Immunity
August 2005, p. 4982-4992, Vol. 73, No. 8

Characterization of the cciIR Quorum-Sensing System in Burkholderia cenocepacia

Rebecca J. Malott,1 Adam Baldwin,2 Eshwar Mahenthiralingam,2 and Pamela A. Sokol
Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada T2N 4N1,1 Cardiff School of Biosciences, Cardiff University, Cardiff CF10 3TL, Wales2

... Cell-Cell Commun. Bacteria, 2004). The promoter regions for cciI and cciR were predicted in silico using SoftBerry BPROM (http://www.softberry.com). ...


Science,
2005 308 (5721) 554-557
Science Supporting Online Material

Comparative Metagenomics of Microbial Communities

Susannah Green Tringe, Christian von Mering, Arthur Kobayashi, Asaf A. Salamov, Kevin Chen, Hwai W. Chang, Mircea Podar, Jay M. Short, Eric J. Mathur, John C. Detter, Peer Bork, Philip Hugenholtz, Edward M. Rubin

... Functional annotation All genomic sequences from soil, whale falls and acid mine drainage were analyzed by the program FGENESB from Softberry, which predicts...


Nature
428, 37-43 (4 March 2004)

Community structure and metabolism through reconstruction of microbial genomes from the environment

Gene W. Tyson1, Jarrod Chapman3,4, Philip Hugenholtz1, Eric E. Allen1, Rachna J. Ram1, Paul M. Richardson4, Victor V. Solovyev4, Edward M. Rubin4, Daniel S. Rokhsar3,4 and Jillian F. Banfield1,2
1. Department of Environmental Science, Policy and Management, University of California, Berkeley, California 94720, USA
2. Department of Earth and Planetary Sciences, University of California, Berkeley, California 94720, USA
3. Department of Physics, University of California, Berkeley, California 94720, USA
4. Joint Genome Institute, Walnut Creek, California 94598, USA

...To identify protein and RNA genes in genomic sequences from an environmental sample we applied the Fgenesb_annotator pipeline developed by Softberry Inc (http://www.softberry.com/berry.phtml?topic=gfindb) which provides completely automatic comprehensive annotation of bacterial sequences...


Appl Environ Microbiol.
2004 April; 70(4): 2332-2341

Oxygen-Controlled Bacterial Growth in the Sponge Suberites domuncula: toward a Molecular Understanding of the Symbiotic Relationships between Sponge and Bacteria

Werner E. G. Muller,* Vladislav A. Grebenjuk, Narsinh L. Thakur, Archana N. Thakur, Renato Batel, Anatoli Krasko, Isabel M. Muller, and Hans J. Breter Institut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Universitat Mainz, D-55099 Mainz, Germany
*Corresponding author. Mailing address: Institut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Universitat Mainz, Duesbergweg 6, 55099 Mainz, Germany. Phone: 6131-3925910. Fax: 6131-3925243. E-mail: wmueller@mail.uni-mainz.de

... For genes and potential promoter prediction, we used the FGENESB-Pattern/Markov chain-based bacterial operon and gene prediction program from the SoftBerry ...


Molecular Microbiology
Volume 52 Issue 6 Page 1579 - June 2004 doi:10.1111/j.1365-2958.2004.04086.x

Gene conversion: a mechanism for generation of heterogeneity in the tprK gene of Treponema pallidum during infection

Arturo Centurion-Lara*, et al
Affiliations: Departments of Medicine and Pathobiology, University of Washington, Harborview Medical Center, Box 359779, 325 Ninth Ave., Seattle, WA 98104, USA.

... Using the fgenesb program, which identifies putative operons and genes in microbial genomes (Softberry; http:/ / www.softberry.com/ berry.phtml ), the tprK ORF ...


Journal of Theoretical Biology
230 (2004) 133-144

Computational prediction of conserved operons and phylogenetic footprinting of transcription regulatory elements in the metal-reducing bacterial family Geobacteraceae

Bin Yana, Barbara A. Methe´ b, Derek R. Lovleyc, Julia Krushkala,*
aDepartment of Preventive Medicine, Center of Genomics and Bioinformatics, University of Tennesee Health Science Center, 66 N. Pauline St., Ste. 633, Memphis, TN 38163, USA
bThe Institute for Genomic Research, Rockville, MD, USA
cDepartment of Microbiology, Morrill Science Center IV North, University of Massachusetts, 639 North Pleasant Str., Amherst, MA 01003, USA

... the conserved nature of the operons 2 . Operons in Geobacter sulfurreducens were predicted ab initio by the public version of program FGENESB (V. Solovyev and V ...


Molecular Microbiology
Volume 52 Issue 6 Page 1579 -1596 June 2004 doi:10.1111/j.1365-2958.2004.04086.x

Gene conversion: a mechanism for generation of heterogeneity in the tprK gene of Treponema pallidum during infection

Arturo Centurion-Lara*, Rebecca E. LaFond, Karin Hevner, Charmie Godornes, Barbara J. Molini, Wesley C. Van Voorhis and Sheila A. Lukehart

... Using the fgenesb program, which identifies putative operons and genes in microbial genomes (Softberry; http:/ / www.softberry.com/ berry.phtml ), the tprK ORF ...

Plasmid
Volume 52, Issue 2, September 2004, Pages 131-138

Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

Anders Clausen a, 1, 2, Marie Just Mikkelsen a, 2, Imke Schroder b and Birgitte K. Ahring
a Biocentrum-DTU, Building 227, DK-2800, Lyngby, Denmark b Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles, Los Angeles, CA, USA

... 1913), and orf61 (1897-2223) are predicted to represent genes, when a FGENESB gene prediction is run using Bacillus subtilis parameters at www.softberry.com. ...



Environmental Microbiology,
September 2004, vol. 6, no. 9, pp. 903-910(8) DOI: 10.1111/j.1462-2920.2004.00676.x

Different SAR86 subgroups harbour divergent proteorhodopsins

Gazalah Sabehi1; Oded Beja1; Marcelino T. Suzuki2; Christina M. Preston3; Edward F. DeLong4 Affiliations: 1: Department of Biology, Technion-Israel Institute of Technology, Haifa 32000, Israel. 2: Chesapeake Biological Laboratory, University of Maryland Center for Environmental Sciences, Solomons, MD 20688, USA. 3: Monterey Bay Aquarium Research Institute, 7700 Sandholdt Road, Moss Landing, CA 95039, USA. 4: Massachusetts Institute of Technology, Cambridge, MA 02139, USA.

... program. FGENESB (Softberry), and the annotation was subsequently refined and curated manually using ARTEMIS (Sanger Center). Fig. ...


Proc Natl Acad Sci U S A.
2003 October 28; 100(22): 12830-12835. doi: 10.1073/pnas.2133554100. Published online 2003 October 17.
Evolution

Proteorhodopsin genes are distributed among divergent marine bacterial taxa

Jose R. de la Torre, Lynne M. Christianson, Oded Beja, Marcelino T. Suzuki, David M. Karl, John Heidelberg,** and Edward F. DeLong
Monterey Bay Aquarium Research Institute, 7700 Sandholdt Road, Moss Landing, CA 95039; §Department of Biology, Technion-Israel Institute of Technology, Haifa 32000, Israel; Chesapeake Biological Laboratory, University of Maryland, Solomons, MD 20688; Department of Oceanography, University of Hawaii, Manoa, HI 96822; and **Institute for Genomic Research, Rockville, MD 20850 Edited by Sallie W. Chisholm, Massachusetts Institute of Technology, Cambridge, MA, and approved August 21, 2003, (received for review 2003 June 10)
Present address: Department of Civil and Environmental Engineering, University of Washington, Seattle, WA 98195.
To whom correspondence should be addressed. E-mail: delong@mbari.org.

... Analysis of the potential genes and protein-coding regions was performed by using a combination of the BLAST (11), GLIMMER 2.02 (TIGR) (12, 13), FGENESB (Softberry, Mount Kisco, NY), and ARTEMIS (Sanger Center, Cambridge University, U.K.) (14) software packages.


BPROM

Infection and Immunity
2016, 84(9), 2566-2574. doi: 10.1128/IAI.00297-16

Evidence that BosR (BB0647) is a positive autoregulator in Borrelia burgdorferi

Ouyang, Z., Zhou, J., Norgard, M. V.
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas, USA

... To investigate further the regulation of bosR expression in B. burgdorferi, we analyzed the 5? putative regulatory region upstream of bb0648 using BPROM (SoftBerry), a bacterial promoter prediction program. A typical bacterial ? 70 promoter (P1) (Fig. ...


Research in microbiology
2016, 167(2), 90-102. http://dx.doi.org/10.1016/j.resmic.2015.10.004

Insights into aureocin A70 regulation: participation of regulator AurR, alternative transcription factor sB and phage f11 regulator cI

Coelho, M. L. V., Fleming, L. R., & de Freire Bastos, M. D. C.
a Departamento de Microbiologia Geral, Instituto de Microbiologia Paulo de Goes, UFRJ, Rio de Janeiro, Brazil b Instituto Nacional da Propriedade Industrial, INPI, Brazil

... operon, a region of 240 nucleotides immediately upstream of this operon was analyzed using programs PPP (http://bioinformatics. biol.rug.nl/websoftware/ppp/ppp_start.php) and BPROM (http://linux1.softberry.com). ...


Applied and environmental microbiology
2016, 82(12), 3503-3514. doi: 10.1128/AEM.00299-16

Agrobacterium tumefaciens Zur Regulates the High-Affinity Zinc Uptake System TroCBA and the Putative Metal Chaperone YciC, along with ZinT and ZnuABC, for Survival under Zinc-Limiting Conditions

Chaoprasid, P. et al.,
aLaboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok, Thailand bEnvironmental Toxicology, Chulabhorn Graduate Institute, Lak Si, Bangkok, Thailand

... 300 bp (Fig. 1B). The transcriptional start sites of troC (at the A residue) and of yciC (at the A residue) were determined by 5? RACE, and the ?10 and ?35 sequences were predicted using BPROM (Softberry) (Fig. 1B). A Zur ...


BMC Genomics
2016, 17:326 DOI: 10.1186/s12864-016-2680-8

Xylan degradation by the human gut Bacteroides xylanisolvens XB1A T involves two distinct gene clusters that are linked at the transcriptional level

Despres, J. et al.,
Institut National de la recherche Agronomique (INRA), UR454 Microbiologie; INRA, Plate-forme d’Exploration du Metabolisme

... Putative promoters and terminators were searched within intergenic sequences (>100 bp) using different tools (BPROM, PPP, Arnold) available at http://molbiol-tools.ca/Promoters.htm. Operon prediction was carried out using FGENESB, which is based on distances between ORFs and frequencies of different genes neighboring each other in known bacterial genomes, as well as on promoter and terminator predictions (http://www.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...


Applied and environmental microbiology
2016, 82(4), 1274-1285. doi: 10.1128/AEM.03111-15

A new N-Acyl homoserine lactone synthase in an uncultured symbiont of the Red Sea sponge Theonella swinhoei

Britstein, M. et al.,
aDepartment of Marine Biology, Leon H. Charney School of Marine Sciences, University of Haifa, Haifa, Israel bBacteriology Group, International Centre for Genetic Engineering & Biotechnology, Padriciano, Trieste, Italy cArgonne National Laboratory, Institute for Genomic and Systems Biology, Argonne, Illinois, USA

... The intergenic region between TswR and TswI, predicted to contain the promoter region of the TswI AHL synthase (based on Predictions of Bacterial Promoters [BPROM]; Softberry), and the intergenic region between TswR-t and TswR, predicted to contain the promoter region ...


SpringerPlus
2016 65:1060 DOI: 10.1186/s40064-016-2693-4

Characterization of antimicrobial substance from Lactobacillus salivarius KL-D4 and its application as biopreservative for creamy filling

Therdtatha, P. et al.,
Specialized Research Unit, Probiotics and Prebiotics for Health, Department of Biotechnology, Faculty of Agro-Industry, Kasetsart University Center for Advanced Studies for Agriculture and Food (CASAF), Kasetsart University Institute for Advanced Studies (NRU-KU), Kasetsart University

... Bacterial promoter prediction was performed using BROM on the Softberry (online program) on August 4th, 2015 ...


Molecular microbiology
2016, 99(3), 453-469. DOI: 10.1111/mmi.13128

Vibrio cholerae phosphatases required for the utilization of nucleotides and extracellular DNA as phosphate sources

McDonough, E., Kamp, H., Camilli, A.
Howard Hughes Medical Institute and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA

... Using the online promoter prediction tool, Softberry BRPOM (Solovyev and Salamov, 2011), we identified two putative CRP binding sites in the V.?cholerae cpdB promoter. ...


PloS one
2016, 11(7), e0158895. http://dx.doi.org/10.1371/journal.pone.0158895

Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis

Gopalani, M., Dhiman, A., Rahi, A., Kandari, D., & Bhatnagar, R.
Laboratory of Molecular Biology and Genetic Engineering, School of Biotechnology, Jawaharlal Nehru University, New Delhi-110067, India

... search. Promoter predictions were done using PromBase [27] and Bprom program (Softberry) wherever needed. ...


Environmental Microbiology
2016 DOI: 10.1111/1462-2920.13419

The guanidinobutyrase GbuA is essential for the alkylquinolone-regulated pyocyanin production during parasitic growth of Pseudomonas aeruginosa in co-culture with Aeromonas hydrophila

Jagmann, N., Bleicher, V., Busche, T., Kalinowski, J., & Philipp, B.
Institut fur Molekulare Mikrobiologie und Biotechnologie, Westfalische Wilhelms-Universitat (WWU) Munster, Munster, Germany Center for Biotechnology (CeBiTec), Universitat Bielefeld, Bielefeld, Germany

... With the bacterial promoter prediction program BProm (www.softberry.com), however, another putative promoter could be identified within the gene ...


Frontiers in Microbiology
26 May 2016, 7, 782 http://dx.doi.org/10.3389/fmicb.2016.00782

When Genome-Based Approach Meets the "Old but Good": Revealing Genes Involved in the Antibacterial Activity of Pseudomonas sp. P482 against Soft Rot Pathogens

Krzyzanowska, D. M. et al.,
1Laboratory of Biological Plant Protection, Department of Biotechnology, Intercollegiate Faculty of Biotechnology of University of Gdansk and Medical University of Gdansk, Gdansk, Poland 2Laboratory of Molecular Bacteriology, Department of Medical Biotechnology, Intercollegiate Faculty of Biotechnology University of Gdansk and Medical University of Gdansk, Medical University of Gdansk, Gdansk, Poland 3School of Life Sciences, Faculty of Medicine and Health Sciences, University of Nottingham, Nottingham, UK

... The sequence of interest (contig JHTS01000055.1, range 27,755–36,623) was analyzed for the presence of sigma housekeeping promoter sequence by three different programs: PromoterHunter9 (Klucar et al., 2010), Promoter prediction10 (Reese, 2001) and BPROM 11 (Solovyev and Salamov, 2011). ...


RNA
2016, 22(9), 1373-1385. doi: 10.1261/rna.055129.115

A computational strategy for the search of regulatory small RNAs in Actinobacillus pleuropneumoniae

Rossi, C. C. et al.,
1Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Instituto de Biotecnologia Aplicada a Agropecuaria–BIOAGRO, Universidade Federal de Vicosa, Vicosa, 36570-900, Brazil 2Section of Paediatrics, Imperial College London, St. Mary's Campus, London W2 1PG, United Kingdom

... All the candidates had putative Rho-independent terminator regions and promoter elements in the close upstream region of each designated gene, as predicted by BPROM (software Softberry, available at www.softberry.com, Supplemental Fig. S2). ...


Biochemistry (Moscow)
2016, 81(8), 884-891. doi:10.1134/S0006297916080095

Features of gene expression of Bacillus pumilus metalloendopeptidase

Rudakova, N. L. et al.,
Kazan (Volga Region) Federal University

... trpC2; ?glnK – strain deficient in the glnK gene, CmR Page 3. 886 RUDAKOVA et al. BIOCHEMISTRY (Moscow) Vol. 81 No. 8 2016 metalloendopeptidase gene using the Softberry BPROM network [10]. The results were statistically processed in Microsoft Excel. ...


Microbial Drug Resistance
2016 doi:10.1089/mdr.2016.0047.

Biochemical Characterization of ?-Lactamases from Mycobacterium abscessus Complex and Genetic Environment of the ?-Lactamase-Encoding Gene

Ramirez, A. et al.,
1Universidad de Los Andes, Facultad de Farmacia y Bioanalisis, Laboratorio de Microbiologia Molecular, Merida, Venezuela. 2Universidad de Buenos Aires, Facultad de Farmacia y Bioquimica, Laboratorio de Resistencia Bacteriana, Buenos Aires, Argentina.

... 60 sec. Putative gene promoter sequences (?35) were recognized using the BPROM program (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb). DNA sequencing and analysis PCR products ...


Int J Nano Stud Technol
2016, S3:001, 1-8.

Removal of Heavy Metals by Indigenous Microorganisms and Identification of Gene Responsible for Remediation

M.H. Fulekar
1 School of Environment and Sustainable Development, Central University of Gujarat, Gandhinagar, India. 2 Environmental Biotechnology Laboratory,Department of Life Sciences, University of Mumbai, Vidyanagari, Santacruz (E) Mumbai, India.

... biology tools, ExPASy. The restriction endonuclease sites of the gene was determined with the help of online analysis tools. The promoter region was determined by Softberry-BRPROM program. Result and Discussion The ...


Frontiers in Microbiology
2016, 7: 1115. doi: 10.3389/fmicb.2016.01115

Thusin, a novel two-component lantibiotic with potent antimicrobial activity against several Gram-positive pathogens

Xin, B. et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China

.. The putative promoter and terminator in the thusin gene cluster were detected using the Softberry BPROM and Find Term software programs ...


Viruses
2016, 8(8), 213; doi:10.3390/v8080213

Binding Specificities of the Telomere Phage ?KO2 Prophage Repressor CB and Lytic Repressor Cro

Hammerl, J. A., Jackel, C., Lanka, E., Roschanski, N., Hertwig, S.
1 Bundesinstitut fur Risikobewertung (Federal Institute for Risk Assessment), Department of Biological Safety, Diedersdorfer Weg 1, D-12277 Berlin, Germany 2 Max-Planck-Institut fur Molekulare Genetik, Ihnestra?e 63-73, D-14195 Berlin, Germany

... In silico promoter identification was performed by using BPROM (Softberry, Mount Kisco, NY, USA ...


Frontiers in microbiology
2016, 7: 687. doi: 10.3389/fmicb.2016.00687

The rnc Gene Promotes Exopolysaccharide Synthesis and Represses the vicRKX,/i> Gene Expressions via MicroRNA-Size Small RNAs in Streptococcus mutans

Mao, M. Y. et al.,
1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China 2Department of Dentistry, Yan'an Hospital Affiliated to Kunming Medical University, Kunming, China

... We first analyzed these intergenic noncoding sequences by FGENESB and BPROM programs for operon and promoter prediction, respectively (http://linux1.softberry.com/berry.phtml) (Solovyev and ...


Plasmid
2016, Volumes 84–85, March–May 2016, Pages 36–43. doi:10.1016/j.plasmid.2016.02.005

The ancient small mobilizable plasmid pALWED1. 8 harboring a new variant of the non-cassette streptomycin/spectinomycin resistance gene aadA27

Kurakov, A. et al.,
a Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov sq. 2, 123182 Moscow, Russia b Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, 119071 Moscow, Russia

.. Putative ORFs and promoters were detected using BPROM, FGENESB (http://www.softberry.com/berry.html), and GeneMark.hmm for ...


PloS one
2016, 11(7), e0158793. doi: 10.1371/journal.pone.0158793

In Vitro Analysis of Predicted DNA-Binding Sites for the Stl Repressor of the Staphylococcus aureus SaPIBov1 Pathogenicity Island

Papp-Kadar, V., Szabo, J. E., Nyiri, K., Vertessy, B. G.
Department of Applied Biotechnology and Food Science, Budapest University of Technology and Economics, Budapest, 1111, Hungary, Laboratory of Genome Metabolism and Repair, Institute of Enzymology, Research Centre for Natural Sciences, Hungarian Academy of Sciences, Budapest, 1117, Hungary

... For promoter prediction the BRPOM software was used (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) [29]. ...


Molecular Microbiology
2016, doi: 10.1111/mmi.13403

A novel flagellar sheath protein, FcpA, determines filament coiling, translational motility and virulence for the Leptospira spirochete

Author et al.,
1Department of Epidemiology of Microbial Disease, Yale School of Public Health, New Haven, CT 06520, USA. 2Gonc?alo Moniz Research Center, Oswaldo Cruz Foundation, Brazilian Ministry of Health, Salvador, Bahia 40296-710, Brazil

... For complementation, the fcpA gene with its native promoter region (a 400bp-region upstream the start codon as identified by the Softberry software; http://linux1.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)


Applied and environmental microbiology
2016, 82(6), 1789-1798. doi: 10.1128/AEM.03526-15

A 1, 3-1, 4-b-Glucan Utilization Regulon in Paenibacillus sp. Strain JDR-2

Chow, V. et al.,
aDepartment of Microbiology and Cell Science, University of Florida, Gainesville, Florida, USA bInstitute for Microbial and Biochemical Technology, Forest Products Laboratory, USDA Forest Service, Madison, Wisconsin, USA

... Bioinformatic analyses by BPROM software (SoftBerry) and ARNold software (http://rna.igmors. u-psud.fr/toolbox/arnold/index.php) identified putative promoters and terminators within the genome sequence that includes the bgl16A 1 and bg16lA 2 genes and adjacent genes ...


Applied microbiology and biotechnology
June 2016, Volume 100, Issue 12, pp 5467–5477 DOI: 10.1007/s00253-016-7354-6

New tools for chloroplast genetic engineering allow the synthesis of human growth hormone in the green alga Chlamydomonas reinhardtii

Wannathong, T., Waterhouse, J. C., Young, R. E., Economou, C. K., Purton, S.
Department of Biology, Faculty of ScienceSilpakorn University Algal Research Group, Institute of Structural and Molecular BiologyUniversity College London

... Promoter prediction software, softberry BPROM, indicates a possible –35 element (TTGTAA) upstream of the –10 element. ...


Journal of biosciences
2016, 41(2), 193-203. DOI: 10.1007/s12038-016-9608-y

In situ real-time evaluation of radiation-responsive promoters in the extremely radioresistant microbe Deinococcus radiodurans

Anaganti, N., Basu, B., Apte, S. K.
1. Molecular Biology Division, Bhabha Atomic Research Centre, Mumbai, 400 085, India

.. start site in D. radiodurans in 500bp upstream DNA sequence of selected ORFs was carried out by using software ( http://www.fruitfly.org/seq_tools/ promoter.html ) (Reese 2001) or BPROM software ( http://linux1.softberry.com/berry ...


Journal of molecular biology
2016, 428(2), 477-491. doi:10.1016/j.jmb.2015.12.010

The gene transfer agent RcGTA contains head spikes needed for binding to the Rhodobacter capsulatus polysaccharide cell capsule

Westbye, A. B., Kuchinski, K., Yip, C. K., Beatty, J. T.
1 Department of Microbiology and Immunology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3 2 Department of Biochemistry and Molecular Biology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3

... 1) was predicted using Softberry ¶ BPROM [28], and a segment of DNA containing 355 bp 5? of the annotated start codon, including this putative promoter, was found to initiate transcription after fusion to lacZ ...


PloS one
2016, 11(7), e0158447 doi: 10.1371/journal.pone.0158447

Promoter Screening from Bacillus subtilis in Various Conditions Hunting for Synthetic Biology and Industrial Applications

Song, Y. et al.,
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China, Key Laboratory of Systems Microbial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China

... We selected seven strongest promoter candidates and predicted the -35, -10 elements and the lengths of the spacers (Fig 3A) using Softberry Inc., (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Journal of applied microbiology
2016, 120(1), 126-137.

Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001

Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China

... Promter prediction was performed by the online available program neural network promoter prediction (http://www.fruitfly. org/seq_tools/promoter.html) and softberry bprom (http://linux1.softberry.com/berry ...


PloS one
2016, 11(7), e0159408. doi: 10.1371/journal.pone.0159408

Identification of Preferred DNA-Binding Sites for the Thermus thermophilus Transcriptional Regulator SbtR by the Combinatorial Approach REPSA

Van Dyke, M. W. et al.,
Department of Chemistry and Biochemistry, Kennesaw State University, Kennesaw, Georgia, United States of America Department of Molecular and Cellular Biology, Kennesaw State University, Kennesaw, Georgia, United States of America

...Sequences ±200 bp of the genomic SbtR site was analyzed using both Softberry BPROM and University of Groningen PePPER to identify potential promoters [49,50]. ...


Journal of Biotechnology
2016, 233, 17-25. doi:10.1016/j.jbiotec.2016.06.024

Rex in Clostridium kluyveri is a global redox-sensing transcriptional regulator

Hu, L. et al.,
a State Key Laboratory of Microbial Technology, School of life science, Shandong University, Jinan, People’s Republic of China b Institute of Basic Medicine, Shandong Academy of Medical Science, Jinan, People’s Republic of China

... To predict promoter, we used the software as follows: BPROM (Softberry, Inc, NY, USA ...


Applied microbiology and biotechnology
2016, 100(3), 1501-1510. DOI: 10.1007/s00253-015-7124-x

Metabolic potential of Bacillus subtilis 168 for the direct conversion of xylans to fermentation products

Rhee, M. S. et al.,
Xycrobe Therapeutics, Inc, College of ForestryNorthwest A&F University, Department of Microbiology and Cell Science, IFASUniversity of Florida

... Using BPROM (Softberry) to identify sequences qualifying as potential promoters, a single promoter with ?35 and ?10 elements was identified upstream from a transcriptional start site 301 bp upstream of the sequence for a ribosomal binding site and 331 bp upstream of an ATG ...


Toxins
2016, 8(4), 113. doi:10.3390/toxins8040113

Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa

Li, G. et al.,
Department of Microbiology, Third Military Medical University, Chongqing 400038, China

... The putative promoter and terminator were predicted by BPROM (http://linux1.softberry.com/berry. phtml) and FindTerm (http://www.softberry.com/berry.phtml?topic=findterm&group= programs&subgroup=gfindb), respectively. 4.3. DNA Extraction, RNA Purification and RT-PCR. ...


Microbiology
2016, 162(5), 777-788. doi: 10.1099/mic.0.000270

Regulation and production of Tcf, a cable-like fimbriae from Salmonella enterica serovar Typhi

Leclerc, J. M. et al.,
1? Department of Microbiology, Infectiology and Immunology, Universite de Montreal,CP 6128 Succursale Centre-Ville, Montreal, Quebec H3C 3J7,Canada 2? INRS-Institut Armand-Frappier,531 boulevard des Prairies, Laval, Quebec H7V 1B7,Canada

... tcfA promoter region was performed. Putative binding sites for H-NS, RcsB, Fur and ArgR were identified using the bacterial promoter analysis software Softberry Bprom (www.softberry.com) (Fig. 4a). Putative regulation by the ...


Microorganisms
2016, 4(1), 3. doi:10.3390/microorganisms4010003

In Silico Analysis of a Novel Plasmid from the Coral Pathogen Vibrio coralliilyticus Reveals Two Potential "Ecological Islands"

Wachter, J., Hill, S. A.
Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA

... Enzyme restriction sites were identified with the NEBcutter V2.0 tool made available through New England Biolabs [21]. Putative promoters for each orf were identified using BPROM available on Softberry [22]. tRNAs were identified using the tRNAscan-SE program [23]. ...


Biotechnology and Bioprocess Engineering
2016, 21(1), 68-78. DOI: 10.1007/s12257-015-0618-7

Explored a cryptic plasmid pSXM33 from Shewanella xiamenensis BC01 and construction as the shuttle vector

Zhou, Y., Ng, I. S.
1. Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361-005, China 2. Department of Chemical Engineering, National Cheng Kung University, Tainan, 70101, Taiwan 3. Research Center for Energy Technology and Strategy, National Cheng Kung University, Tainan, 70101, Taiwan

... edu.cn/ Ori-Finder/. Prediction of transcriptional promoters was carried out with a Web-based BPROM program in http:// www.softberry.com/. The tandem repeats were searched in http://www.loria.fr/mreps. Circular plasmid map ...


In Vitro Cellular & Developmental Biology-Animal
2016, 52(1), 77-88.DOI: 10.1007/s11626-015-9949-0

he Wolbachia WO bacteriophage proteome in the Aedes albopictus C/wStr1 cell line: evidence for lytic activity?

Baldridge, G. D. et al.,
Department of Entomology University of Minnesota Department of Biochemistry, Molecular Biology and BiophysicsUniversity of Minnesota

... Sequences of the non-coding 125-bp region upstream of WD0612 (A) and the 95-bp region downstream of WD0618 (B) were annotated using Softberry BPROM prediction (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb; Solovyev and Salamov 2011). ...


Journal of Molecular Catalysis B: Enzymatic
2016, 130, 1-8. doi:10.1016/j.molcatb.2016.04.002

Gene cloning, expression and characterization of a novel cold-adapted protease from Planococcus sp

Zhang, H. et al.,
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Bioengineering, Tianjin University of Science & Technology, Tianjin 300457, PR China

... The sequence assembly was performed using the Vector NTI software (Invitrogen). The promoter and RBS sites were predicted using the online software of BPROM (http://linux1.softberry.com/ berry.phtml). Alignments of multiple sequences were performed using ClustalX. ...


Microbial cell factories
2016, 15(1), 1. DOI: 10.1186/s12934-016-0448-0

Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum

Heiss, S. et al.,
Christian Doppler Laboratory for Genetically Engineered Lactic Acid Bacteria, Department of Biotechnology, University of Natural Resources and Life Sciences

... codon. The ?35 and ?10 promoter region were identified (SoftBerry, BPROM) and are underlined. Primer binding sites for negative controls (for construction of negative controls without promoter) are underlined in dashed line. ...


PloS one
2016, 11(2), e0148221. http://dx.doi.org/10.1371/journal.pone.0148221

The Symbiotic Performance of Chickpea Rhizobia Can Be Improved by Additional Copies of the clpB Chaperone Gene

Paco, A., Brigido, C., Alexandre, A., Mateos, P. F., Oliveira, S.
ICAAM–Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal, IIFA–Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002–554, Evora, Portugal

... The identification of the putative promoter and terminator regions was previously performed using BPROM-Prediction of bacterial promoters software (http://www.softberry.com) and ARNold Finding Terminators at IGM—Web Server (http://rna.igmors.u-psud.fr/toolbox/arnold ...


PloS one
2016, 11(3), e0150234. http://dx.doi.org/10.1371/journal.pone.0150234

Characterization of salA, syrF, and syrG Genes and Attendant Regulatory Networks Involved in Plant Pathogenesis by Pseudomonas syringae pv. syringae B728a

Vaughn, V. L., Gross, D. C.
Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas, United States of America

... Computer analysis. Nucleotide sequences that were 100-bp upstream of identified transcriptional start sites were analyzed using the Softberry Bprom algorithm (http://linux1.softberry.com/berry.phtml) to identify putative ? 70 -dependent promoters. ...


Frontiers in microbiology
2016, 7: 146. doi: 10.3389/fmicb.2016.00146

Characterization of Vibrio fluvialis qnrVC5 gene in native and heterologous hosts: Synergy of qnrVC5 with other determinants in conferring quinolone resistance

Vinothkumar, K., Kumar, G. N., Bhardwaj, A. K.
1Molecular Biology of Diseases, Department of Human Health and Diseases, School of Biological Sciences and Biotechnology, Indian Institute of Advanced Research, Gandhinagar, India 2Department of Bio-Chemistry, Faculty of Science, The Maharaja Sayajirao University of Baroda, Vadodara, India

... Softberry-BPROM, a promoter prediction tool was used to find the promoters and other regulatory elements in qnrVC5 gene cassette 3 . The structure of QnrVC5 was predicted by I-TASSER server using automated mode, as it employs hierarchical method for protein structure ...


PloS one
2016, 11(5), e0155397. http://dx.doi.org/10.1371/journal.pone.0155397

Regulation of Motility and Phenazine Pigment Production by FliA Is Cyclic-di-GMP Dependent in Pseudomonas aeruginosa PAO1

Lo, Y. L. et al.,
Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan Molecular Infectious Disease Research Center, Division of Pediatric Infectious Diseases, Department of Pediatrics, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan

... Restriction sites and oligonucleotide primer sequences were identified using Vector NTI Advance ® software (Invitrogen). Promoter regions were predicted using BPROM software (Softberry, Inc). Flagellar observation through transmission electron microscopy. ...


BMC genomics
2016, 17:47. DOI: 10.1186/s12864-016-2376-0

Discovery and profiling of small RNAs responsive to stress conditions in the plant pathogen Pectobacterium atrosepticum

Kwenda, S. et al.,
Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria Kazan Institute of Biochemistry and Biophysics, Kazan Scientific Center, Russian Academy of Sciences Division of Plant Sciences, College of Life Sciences, University of Dundee (at The James Hutton Institute)

... and fundamental types of the detected 3? UTR sRNAs based on their biogenesis, we extracted each sRNA sequence plus 200 nt upstream of the start position of each sRNA and performed promoter predictions using BPROM program (http://?www.?softberry.?com/?berry ...


Journal of applied microbiology
2016, 120(1), 126-137. DOI: 10.1111/jam.12990

Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001

Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China

... Promter prediction was performed by the online available program neural network promoter prediction (http://www.fruitfly.org/seq_tools/promoter.html) and softberry bprom (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Biochemistry and Biophysics Reports
2016, 6, 124-134. doi:10.1016/j.bbrep.2016.03.012

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression

Rajasree, K., Fasim, A., Gopal, B.
Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560012, India

... the identification of the P1 promoter between the PvuII and RsaI restriction sites in the agr operon [3]. The region between these two restriction sites was used as an input sequence for the BPROM server, a web-based bacterial promoter prediction server, (Softberry, Inc., Mount ...


Frontiers in microbiology
2016, 7: 545. doi: 10.3389/fmicb.2016.00545

Genomics of three new bacteriophages useful in the biocontrol of Salmonella

Bardina, C. et al.,
Departament de Genetica i de Microbiologia, Molecular Microbiology, Universitat Autonoma de Barcelona, Barcelona, Spain

... Potential promoter regions and transcription terminators were predicted using the Softberry programs BProm (http://linux1.softberry.com/berry.phtml), FindTerm (Solovyev and Salamov, 2011), and TransTerm (Ermolaeva et al., 2000). ...


FEBS open bio
2015, 5, 813-823. doi:10.1016/j.fob.2015.09.004

House dust mites possess a polymorphic, single domain putative peptidoglycan d, l endopeptidase belonging to the NlpC/P60 Superfamily

Tang, V. H., Stewart, G. A., Chang, B. J.
Microbiology & Immunology, School of Pathology and Laboratory Medicine, The University of Western Australia, Crawley, WA, Australia

... sequences were analysed for the presence of prokaryotic promoters using the Neural Network Promoter Prediction (NNPP) program at the Berkeley Drosophila Genome Project (BDGP) (www.fruitfly.org/seq_tools/promoter.html) and the program Softberry BPROM (Softberry, Inc ...


Genetics and molecular research: GMR
2015, 14(1), 190. DOI http://dx.doi.org/10.4238/2015.January.16.2

Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii

Zhang, J., Liu, X., Li, X. J.
1Department of Geriatrics Medicine, The Third People’s Hospital of Chongqing, Chongqing, China 2Department of General Internal Medicine, The First Brand, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China

... Transcription terminators in the phage AB3 genome were predicted using the FindTerm program available from Softberry and promoters in the phage AB3 genome were predicted using the BPROM program on the Softberry website (linux1. softberry.com/berry.phtml). ...


Journal of bacteriology
2015, 197(2), 354-361. 4doi: 10.1128/JB.01948-14

The Putative Eukaryote-Like O-GlcNAc Transferase of the Cyanobacterium Synechococcus elongatus PCC 7942 Hydrolyzes UDP-GlcNAc and Is Involved in Multiple Cellular Processes

Sokol, K. A., Olszewski, N. E.
aDepartment of Genetics, Cell Biology, and Development, University of Minnesota, Saint Paul, Minnesota, USA bDepartment of Plant Biology, University of Minnesota, Saint Paul, Minnesota, USA

... two (NSII) of the ?ogt strain. The Softberry bacterial promoter prediction software BPROM (Softberry, Inc., Mount Kisco, NY) predicts that the SeOGT promoter is 293 bp upstream of the start codon. Wild-type SeOGT with 697 ...


PloS one
2015, 10(7), e0131676. DOI: 10.1371/journal.pone.0131676

Structure and Assembly of TP901-1 Virion Unveiled by Mutagenesis

Stockdale et al.,
School of Microbiology, University College Cork, Western Road, Cork, Ireland Department of Food Biosciences, Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland

... BLAST, Pfam and HHpred analyses were used for functional annotations of proteins [61–64]. Putative promoter sequences of NZ9000 prophage t712 were identified using SoftBerry BPROM (http://www.softberry.com). Significant ...


PloS one
2015, 10(1). DOI: 10.1371/journal.pone.0116611

Genetic Acquisition of NDM Gene Offers Sustainability among Clinical Isolates of Pseudomonas aeruginosa in Clinical Settings

Mishra et al.,
Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, 221005, India Department of Biotechnology and Bioinformatics, North Eastern Hill University, Shillong, Meghalaya, India

... (http://www.ncbi.nlm.nih.gov/BLAST/). Further, promoter sites were also determined by using SoftBerry BPROM software (http://linux1.softberry.com/berry.phtml??topic=bprom&group= programs&subgroup=gfin?db). Results. Genetic context of bla NDM. ...


Journal of Applied Microbiology
2015 DOI: 10.1111/jam.13036

Occidiofungin is an Important Component Responsible for the Antifungal Activity of Burkholderia pyrrocinia Strain Lyc2

Wang, X. Q. et al.,
Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai'an, Shandong, China Collaborative Innovation Centre for Annually High Yield and High Efficiency Production of Wheat and Corn, Shandong Agricultural University, Tai'an, Shandong, China

... Biosciences, Carlsbad, CA) and Geneious R8 (Biomatters Ltd.). Open reading frames (ORFs) and genes were predicted by the Softberry FGENESH program (Salamov and Solovyev ... prediction was accomplished using the web-based software BRROM in the Softberry Page 9. ...


International journal of bioinformatics research and applications
2015, 11(4), 347-365. DOI: http://dx.doi.org/10.1504/IJBRA.2015.070140

Opposite nucleotide usage biases in different parts of the Corynebacterium diphtheriae spaC gene

Khrustalev, V. V., Barkovsky, E. V., Kolodkina, V. L., & Khrustaleva, T. A.

... We used three methods for promoter prediction: the 'BPROM' available via the SoftBerry server (http://linux1.softberry.com); the 'NNPP' program (http://fruitfly.org/ seq_tools/promoter. html) (Reese, 2001); the 'PromPredict' (http://nucleix.mbu.iisc. ...


Infection and immunity
2015, 83(9), 3497-3505. doi: 10.1128/IAI.00597-15

Expression of the oligopeptide permease operon of Moraxella catarrhalis is regulated by temperature and nutrient availability

Jones, M. M., Murphy, T. F.
aDepartment of Microbiology and Immunology, University at Buffalo, The State University of New York, Buffalo, New York, USA bClinical and Translational Research Center, University at Buffalo, The State University of New York, Buffalo, New York, USA

... We identified a putative promoter region, using SoftBerry BPROM bacterial promoter prediction software (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup= gfindb), in the 204-bp intergenic region between oppF and oppA. ...


Gene
2015, 564(1), 81-86. doi:10.1016/j.gene.2015.03.044

Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC

Cerveau, N. et al.,
a Universite de Poitiers, UMR CNRS 7267 Ecologie et Biologie des Interactions, Equipe Ecologie Evolution Symbiose, 5 Rue Albert Turpin, 86073 Poitiers Cedex 9, France b Department of Biology, University of Copenhagen, 2200N Copenhagen, Denmark

... 2.2. Bioinformatics analyses. To identify ? 35/? 10 box promoters, the nucleotide sequence of each IS copy was analyzed using the BPROM software from the SoftBerry suite (http://linux1.softberry.com/berry.phtml?topic=bprom&gro.


PloS one
2015, 10(7), e0131695. DOI: 10.1371/journal.pone.0131695

Bioinformatic Analysis of Chlamydia trachomatis Polymorphic Membrane Proteins PmpE, PmpF, PmpG and PmpH as Potential Vaccine Antigens

Nunes, A., Gomes, J. P., Karunakaran, K. P., Brunham, R. C.
Bioinformatics Unit, Department of Infectious Diseases, National Institute of Health, Lisbon, Portugal Vaccine Research Laboratory, University of British Columbia Centre for Disease Control, Vancouver, Canada

... For each operon, in silico promoter predictions were made by using both the Neural Network Promoter Prediction (NNPP, http://www.fruitfly.org/seq_tools/promoter.html) and the BPROM software (Softberry, http://linux1.softberry.com/berry.phtml?topic=bprom&group ...


Journal of microbiological methods, 118, 75-77.
2015, 118, 75-77. doi:10.1016/j.mimet.2015.08.016

An improved Tn7-lux reporter for broad host range, chromosomally-integrated promoter fusions in Gram-negative bacteria

Glassing, A., Lewis, T. A.
Department of Biological and Physical Sciences, Montana State University Billings, Billings, MT 59101, United States

... A scan of that sequence using a bacterial promoter-finding software (BPROM, Softberry, Inc.) found a potential promoter within that region (nt 2338 of GenBank accession #AY962893.1). We attempted cloning of bacterial promoters into pUC18-mini-Tn7T-Gm-lux using an XcmI ...


Bone & Joint Journal Orthopaedic Proceedings Supplement
2015, 97(SUPP 15), 38-38

THE STRUCTURE AND THE ROLE OF SDR REGION OF STAPHYLOCOCCUS AUREUS GENE IN BONE INFECTIONS

Sitkiewicz, I., Babiak, I.
1Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Warsaw, Poland 2Department of Orthopedics and Traumatology, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcriptional organization of the sdr region was detected using BPROM and FGENESB algorithms (www.softberry.com) based on region 611262bp- 623152bp (GeneBank number CP000730.1) of the Staphylococcus aureus subsp. ...


Food Science and Biotechnology
2015, 24(5), 1749-1753. DOI: 10.1007/s10068-015-0227-4

Prediction and identification of an acid-inducible promoter from Lactococcus lactis ssp. cremoris MG1363

Yu, H. et al.,
1. Laboratory of Food Safety and Molecular Biology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China 2. The Supervision, Inspection & Testing Center of Genetically Modified Organisms, Ministry of Agriculture, Beijing, 100083, China

... cremoris MG1363 (16). In addition, the online promoter prediction tools: Neural Network Promoter Prediction (http:// www.fruitfly.org/seq tools/promoter.html) and SofeBerry (http:// linux1.softberry. com/berry.phtml?topic=bprom&group=programs& subgroup=gfindb) were used. ...


FEMS microbiology letters
2014, 353(2), 98-105. DOI:10.1111/1574-6968.12411

The pqqC gene is essential for antifungal activity of Pseudomonas kilonensis JX22 against Fusarium oxysporum f. sp. lycopersici

Xu, J. et al.,
1 Key Laboratory of Control Technology and Standard for Agro-product Safety and Quality, Ministry of Agriculture/Jiangsu Academy of Agricultural Sciences, Nanjing, China 2 Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS, USA

... Promoter prediction was conducted using the web-based software bprom in the Softberry package (Solovyev & Salamov, 2011). Illumina sequencing was used to determine the pqq gene cluster of P. kilonensis JX22, as described previously (Jalan et al., 2011). ...


Microbiology
2014, 160(Pt 1), 102-112. DOI:10.1099/mic.0.070664-0

OxyR-dependent expression of a novel glutathione S-transferase (Abgst01) gene in Acinetobacter baumannii DS002 and its role in biotransformation of organophosphate insecticides

Longkumer, T., Parthasarathy, S., Vemuri, S. G., Siddavattam, D.
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad 500 046, India

... ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict ORFs and bprom software (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb) was used for promoter predictions. ...


ACS synthetic biology
April 4, 2014 DOI:10.1021/sb4001189

A synthetic anhydrotetracycline-controllable gene expression system in Ralstonia eutropha H16

Li H., Liao J. C.
†Department of Chemical and Biomolecular Engineering, ‡The Molecular Biology Institute, §Department of Chemistry & Biochemistry, Institute of Genomics and Proteomics, University of California, Los Angeles, California 90095, United States

... Using the bioinformatic tool (BPROM, Softberry), we identified the putative ?10 and ?35 elements of the P rrsC and the transcriptional start site (Figure 1A). There are two different tetO operators (tetO1 and tetO2) that can both be recognized by the tetR repressor.(13) We took a ...


Annals of Microbiology
2014, 64(2), 809-814. DOI: 10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Fu, Y., Zhai, Z., An, H., Hao, Y.
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


International journal of food microbiology
2014, 177, 89-97. DOI: 10.1016/j.ijfoodmicro.2014.02.011

Response of S. thermophilus LMD-9 to bacitracin: Involvement of a BceRS/AB-like module and of the rhamnose–glucose polysaccharide synthesis pathway

Thevenard B. et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... The presence of putative promoters, terminators, and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml), BDGP (http://www.fruitfly.org/seq_tools/promoter.html), FINDTERM (http://linux1.softberry.com/berry.phtml), TranstermHP (http://transterm.cbcb ...


Microbiology
2014, 160(Pt 2), 406-417. DOI: 10.1099/mic.0.074773-0

Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters

Gallarato L. A. et al.,
1Departamento de Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto, Ruta 36-Km 601, (5800) Rio Cuarto, Cordoba, Argentina 2Departamento de Ingenieria Celular y Biocatalisis, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos 62210, Mexico

... 1999). prodoric was used to determine the integration host factor (IHF) consensus (Munch et al., 2003). The bprom tool from the SoftBerry server (http://linux1.softberry. com) was used to identify ? 70 -dependent promoters. NtrC ...


PloS one
2014, 9(2), e90087. DOI: 10.1371/journal.pone.0090087

New Hydrocarbon Degradation Pathways in the Microbial Metagenome from Brazilian Petroleum Reservoirs

Sierra-Garcia I. N. et al.,
Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas - UNICAMP, Campinas, Brazil Laboratory of Genomics and Expression, University of Campinas - UNICAMP, Campinas, Brazil

... several tools available for gene prediction in prokaryotes through heuristic approaches: Metagene [14] http://metagene.cb.ku-tokyo.ac.jp/) and MetaGeneMark [15] designed for metagenomic sequences, GLIMMER 3.02 [16], [17] and FGENESB (http://linux1.softberry.com/berry ... ...Putative ribosomal binding sites were identified using RBSFINDER [22], and the presence of bacterial promoters and transfer RNA genes was predicted using the programs BPROM (http://linux1.softberry.com/berry.phtml) and tRNAscan-SE [23], respectively. ...


Plasmid
Volume 74, July 2014, Pages 32–38 DOI: 10.1016/j.plasmid.2014.05.003

Construction of a Novel Inducible Expression Vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21.

Maidin M. S. T. et al.,
a Department of Cell and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia

... The potential Pribnow box and -35 site of P hsp were predicted with BPROM (Softberry, USA), an online bacterial ? 70 promoter (major E. coli promoter class) recognition program with about 80% accuracy and specificity that can be accessed freely at (http://linux1.softberry.com ...


Journal of proteomics
2014, 108, 78-88. DOI: 10.1016/j.jprot.2014.05.005

Phosphate regulated proteins of Xanthomonas citri subsp. citri: A proteomic approach

Pegos, V. R., Nascimento, J. F., Sobreira, T. J. P., Pauletti, B. A., Paes-Leme, A., & Balan, A.
a Laboratorio Nacional de Biociencias — LNBio, Centro de Pesquisas em Energia e Materiais — CNPEM, Campinas, SP, Brazil b Universidade Estadual de Campinas — UNICAMP, Instituto de Biologia, Campinas, SP, Brazil

... the promoter regions of the X. citri Pho regulon genes, we submitted a sequence of 100 nucleotides upstream of the start codon of isolated genes or from the first gene belonging to an operon, to the bacterial promoter prediction programme BPROM from the SoftBerry server (http ...


PloS one
2014, 9(3), e90603. Volume DOI: 10.1371/journal.pone.0090603

Analysis of the Promoters Involved in Enterocin AS-48 Expression

Cebrian R et al.,
Departamento de Microbiologia, Facultad de Ciencias, Universidad de Granada, Granada, Spain

... as-48 or bac regions (GenBank KJ146793 and Y12234.1, and D85752.1, respectively [9], [6]) were analysed with the bioinformatic programs Promoter Prediction by Neural Network (NNPP) [31] (http://s.fruitfly.org/seq_tools/promoter?.html) and BPROM (Softberry Inc., Mount ...


Nature communications
2014 , 5. Article number: 4076 DOI: 10.1038/ncomms5076

Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population

Bailey, S. F., Hinz, A., Kassen, R.
Department of Biology, University of Ottawa, Ottawa, Ontario, Canada K1N 6N5

... Bent arrows indicate promoters predicted by the Softberry BPROM program ( http://linux1.softberry.com/berry.phtml). ...


Microbiology
February 2013 vol. 159 no. Pt 2 230-242 DOI:10.1099/mic.0.061614-0

A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants

Betina Agaras †, Patricio Sobrero † and Claudio Valverde
Laboratorio de Bioquimica, Microbiologia e Interacciones Biologicas en el Suelo, Departamento de Ciencia y Tecnologia, Universidad Nacional de Quilmes, Roque Saenz Pena 352 – Bernal B1876BXD – Buenos Aires, Argentina

... The rsmA Sm coding sequence is shaded in dark grey. The sequence of the divergently encoded ORF II gene is shaded in light grey. Putative ? 70 -dependent promoters (boxed) were identified via the Softberry Bprom algorithm (http://linux1.softberry.com/berry.phtml). ...


PLOS ONE
February 08, 2013DOI: 10.1371/journal.pone.0056321

Generation of an Artificial Double Promoter for Protein Expression in Bacillus subtilis through a Promoter Trap System

Yang et al.,
College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province, People's Republic of China Department of Animal Science, McGill University, Quebec, Canada

... The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk); promoter region was predicted by the BPROM program (Softberry Inc., Mount Kisco, NY, USA; http://linux1.softberry.com). Sub-cloning of promoter regions. ...


Microbiology
January 2013 vol. 159 no. Pt 1 96-106 DOI:10.1099/mic.0.062349-0

Transcriptional regulation of the Rhodobacter capsulatus response regulator CtrA

Molly M. Leung †, Cedric A. Brimacombe and J. Thomas Beatty
Department of Microbiology and Immunology, The University of British Columbia, 2350 Health Sciences Mall, Vancouver, BC V6T 1Z3, Canada

... Promoter sequence analysis, RNA 5?end-mapping and ?-galactosidase assays. Analysis of sequences for putative promoter –10 and –35 sites was done using the Softberry bacterial promoter prediction computer program BPROM (http://www.softberry.com/all.htm). ...


PloS one
February 13, 2013DOI: 10.1371/journal.pone.0056063

A Two-Component System (XydS/R) Controls the Expression of Genes Encoding CBM6-Containing Proteins in Response to Straw in Clostridium cellulolyticum

Celik et al.,
Aix-Marseille Universite, CNRS, UMR7283, Marseille, France Institut fur Mikrobiologie, Ernst-Moritz-Arndt Universitat, Greifswald, Germany

... D) Genetic organization of xydS/R and xyl-doc genes as in (A) with schematic localizations of promoters (thin arrow) and terminators (stem-loop) predicted by BPROM and FindTerm programs (http://linux1.softberry.com). doi:10.1371/journal.pone.0056063.g001. ...


F1000Research
2013, 2:99 (doi: 10.12688/f1000research.2-99.v1

Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [v1; ref status: approved with reservations 2, http://f1000r.es/p3]

Erica L Fonseca, Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil - See more at: http://f1000research.com/articles/2-99#sthash.epID3u3g.dpuf

... The 5'UTR from gcu14 were submitted to the promoter predictor programs Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/ index.html) and BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml). ...


PloS one
October 16, 2013 DOI: 10.1371/journal.pone.0076685

The Global Anaerobic Regulator Anr, Is Involved in Cell Attachment and Aggregation Influencing the First Stages of Biofilm Development in Pseudomonas extremaustralis

Paula M. Tribelli, Anthony G. Hay, Nancy I. Lopez
IQUIBICEN-CONICET and Dpto. de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina Department of Microbiology, Cornell University, Ithaca, New York, United States of America

... support [37], and in an intergenic genomic zone. Putative ? 70 dependent promoters were identified using the Softberry Bprom algorithm (http://linux1.softberry.com/berry. phtml). Sequence logos was performed using 5 Anr-boxes ...


Microbiology
September 2013 vol. 159 no. Pt 9 1911-1919 DOI: 10.1099/mic.0.064709-0

Identification and characterization of biofilm formation-defective mutants of Xanthomonas citri subsp. citri

Malamud et al.,
1Instituto de Ciencia y Tecnologia Dr Cesar Milstein, Fundacion Pablo Cassara, CONICET, Saladillo 2468, C1440FFX Ciudad de Buenos Aires, Argentina 2Embrapa Recursos Geneticos e Biotecnologia and Centro APTA Citros Sylvio Moreira, Instituto Agronomico de Campinas, Cordeiropolis, Sao Pablo, Brazil

... Tn5. An analysis was performed for each mutant, taking into account the relative position of the transposon and the presence of promoter regions predicted by BProm (Softberry, http://linux1.softberry.com/berry.phtml) (Fig. S2 ...


Microbiology
November 2013 mic.0.074773-0 DOI:10.1099/mic.0.074773-0

Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors and its expression is controlled by NtrC and PhoB, acting at two interspaced promoters.

Gallarato et al.,
1 Dep Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto; 2 Dep Ingenieria Celular y Biocatalisis, Inst Biotecnologia, UNAM, Cuernavaca

... PRODORIC was used to determine the Integration 182 Host Factor (IHF) consensus (Munch et al., 2003). The BPROM tool from the SoftBerry server 183 (http://linux1.softberry.com) was used to identify ?70-dependent promoters. NtrC and PhoB 184 ...


Antimicrob. Agents Chemother.
July 2013 vol. 57 no. 7 3430-3433 DOI:10.1128/AAC.00515-13

SatR Is a Repressor of Fluoroquinolone Efflux Pump SatAB

Escudero et al.,
Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spaina Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spainb

... Positive results were obtained for both strains, proving that satR is part of the satRAB operon (data not shown). Upstream from satRAB, we found two 9-bp pseudopalindromic regions overlapping the predicted ?10 box (BPROM software; Softberry) (Fig. ...


Archives of Virology
Volume 158, Issue 11 , pp 2409-2413 DOI:10.1007/s00705-013-1726-3

Genome sequence analysis of the Vibrio parahaemolyticus lytic bacteriophage VPMS1

Martin Ramirez-Orozco, Vania Serrano-Pinto, Norma Ochoa-Alvarez, Roman Makarov, Sergio F. Martinez-Diaz
1. Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Instituto Politecnico Nacional, 195, Col. Playa Palo de Santa Rita Sur, 23096, La Paz, B.C.S, Mexico 2. Centro Interdisciplinario de Ciencias Marinas-IPN (CICIMAR), Av. Instituto Politecnico Nacional, s/n Col. Playa Palo de Santa Rita, 23096, La Paz, B.C.S, Mexico

... results were visually inspected. Results were taken as significant when e-values were under 0.01. Promoter candidates were determined using the BPROM 0.3.2 software (Softberry, Mount Kisco, NY). A CD search to identify ...


BMC Biotechnol.
2013; 13: 25. DOI: 10.1186/1472-6750-13-25

Development of a Fur-dependent and tightly regulated expression system in Escherichia coli for toxic protein synthesis

Lingyu Guan, 1 Qin Liu, 1 Chao Li,1 and Yuanxing Zhang 1
1State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, P. R. China

... Its characteristic regions were demonstrated as the same result by three online promoter prediction tools-Softberry, BDGP and SCOPE. ... PfhuA characteristic regions were predicted by online tools: BPROM-bacterial promoter prediction program from Softberry ...


Tuberculosis
Volume 93, Issue 4, July 2013, Pages 389–397 DOI:10.1016/j.tube.2013.03.007

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis

Rathor et al.,
a Department of Microbiology, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi 110007, India b Medicinal Chemistry Division, Dr B.R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi 110007, India

... (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). To know fidelity of these softwares, known promoter sequences of purC (Rv0780), katG (Rv1908c), rpsl (Rv0682) and recA (Rv2737c) genes of M. tuberculosis were also analyzed. ...


Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


Biochemical and Biophysical Research Communications
Volume 435, Issue 1, 24 May 2013, Pages 28–33 DOI:10.1016/j.bbrc.2013.04.017

Structural and genomic DNA analysis of a putative transcription factor SCO5550 from Streptomyces coelicolor A3(2): Regulating the expression of gene sco5551 as a transcriptional activator with a novel dimer shape

Hayashi et al.,
a Department of Food and Fermentation Science, Faculty of Food and Nutrition, Beppu University, Beppu 874-8501, Japan b Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810, Japan c Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Sapporo 062-8517, Japan

... 4A. The translational start site, putative ribosomal binding site (RBS), putative –10, and –35 promoter elements of the sco5550 and sco5551 were found using the bacterial promoter predictor BPROM program (SoftBerry, Mt. ...


J. Bacteriol. December
2013 vol. 195 no. 23 5370-5380 DOI:10.1128/JB.00615-13

The sll1951 Gene Encodes the Surface Layer Protein of Synechocystis sp. Strain PCC 6803

Christoph Trautner and Wim F. J. Vermaas
School of Life Sciences, Arizona State University, Tempe, Arizona, USA

... A possible ribosome-binding site (AGGAG) is located at bp ?19 from the start codon, whereas the most probable ?10 and ?35 transcriptional signals, as predicted via BPROM (Softberry Inc., Mount Kisco, NY), appear to be distant at positions ?95 (TGCTATGAT) and ?114 ...


Appl. Environ. Microbiol.
February 2013 vol. 79 no. 4 1150-1159 DOI:10.1128/AEM.03556-12

Genomic Plasticity Enables a Secondary Electron Transport Pathway in Shewanella oneidensis

M. Schicklberger, G. Sturm and J. Gescher
Institute for Applied Biosciences (IAB), Department of Applied Biology, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany

... (35). Promoter prediction.The BPROM bacterial promoter predictor was used to identify entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco, NY). ... Analysis of the hybrid region by use of bioinformatic tools (BPROM; SoftBerry, Mt. ...


PloS one
October 07, 2013DOI: 10.1371/journal.pone.0076630

Evolutionary Insight into the Functional Amyloids of the Pseudomonads

Morten S. Dueholm, Daniel Otzen, Per Halkj?r Nielsen
Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aarhus, Denmark Interdisciplinary Nanoscience Center (iNANO), Centre for Insoluble Protein Structures (inSPIN), Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark

... to fapF. A promoter region containing -35 and -10 regions could be identified in front of the lone fapF in Chromobacterium using the prokaryotic promoter prediction tool Softberry-BPROM (http://linux1.softberry.com). No promoter ...


Biotechnology Letters
Volume 35, Issue 8 , pp 1331-1337 DOI:10.1007/s10529-013-1209-3

Expression of mosquito-larvicidal toxin genes under the control of a native promoter in Enterobacter amnigenus An11

Wachiraporn Toopaang, Boonsri Jongsareejit, Sumarin Soonsanga, Boonhiang Promdonkoy
1. Department of Microbiology, Faculty of Science, Silpakorn University, Nakhon Pathom, 73000, Thailand 2. National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, 113 Pahonyothin Road, Khlong Nueng, Khlong Luang, Pathum Thani, 12120, Thailand

... Promoter sequence of the inserted fragment was analyzed using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/ promoter.html) programs. Measurement of GFP intensity. Enterobacter ...


PLoS Pathog
2013 June; 9(6): e1003428. DOI:10.1371/journal.ppat.1003428

A Novel Two-Component Signaling System Facilitates Uropathogenic Escherichia coli's Ability to Exploit Abundant Host Metabolites

Cai et al.,
1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America 2Laboratory Animal Resources, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America

... The promoter regions of c5032 and c5038 were predicted by BProm program (http://linux1.softberry.com) [45]. . ...


Extremophiles
Volume 17, Issue 5 , pp 809-819 DOI:10.1007/s00792-013-0562-4

Characterization of a cold-adapted and salt-tolerant esterase from a psychrotrophic bacterium Psychrobacter pacificensis

Guojie Wu, Gaobing Wu, Tao Zhan, Zongze Shao, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China 2. College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml), amino acid alignments by BLASTP (http://www.ncbi.nlm.nih.gov/), and Signal peptide by the SignaIP 4.0 ...


American Journal of Bioinformatics Research
2013; 3(2): 11-20 doi:10.5923/j.bioinformatics.20130302.01

nsilico Analysis of Novel hipAB, ccdBA, and yoeB-yefM Toxin-Antitoxin Homolog’s from the Genome of Xenorhabdus nematophila

Jitendra Singh Rathore, Mahendra Pal Singh, Pradeep Gautam
School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, 201308, India

... 2.5. Promoter Analysis. Identification of putative pro- moters associated with ORFs was determined by software BPROM (www.softberry.com). 2.6. Genomic DNA Isolation. X. nematophila culture was inoculated from glycerol stock in 50 ml and grown overnight at 28?, 200 rpm. ...


Microbiology
May 2013 mic.0.066332-0 DOI:10.1099/mic.0.066332-0

A modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius

Jeremy Bartosiak-Jentys, Ali H. Hussein, Claire J. Lewis and David J. Leak1
University of Bath

... 113 A 293nt DNA fragment containing the cellobiose specific phosphotransferase system operon's 114 promoter sequence (P?glu), predicted using BPROM software (SoftBerry), was amplified using primers 115 SalI_P?glu_F and XmaI_ClaI_P?glu_R. ...


Biochemical Genetics
Volume 51, Issue 9-10 , pp 766-779 DOI:10.1007/s10528-013-9605-x

Molecular Characterization of a Fungicidal Endoglucanase from the Cyanobacterium Calothrix elenkinii

Chitra Natarajan, Vishal Gupta, Kanika Kumar, Radha Prasanna
1. Division of Microbiology, Indian Agricultural Research Institute, New Delhi, 110012, India 3. Centre for Cellular and Molecular Biology (CCMB), Council of Scientific and Industrial Research (CSIR), Hyderabad, 500007, Andhra Pradesh, India 2. National Research Centre for Plant Biotechnology, IARI, New Delhi, 110012, India

... For each sequence, SignalP-HMM reports the overall signal peptide probability, equal to the posterior probability of signal peptide (S) for position 1. The bacterial promoter prediction program BPROM (http://linux1.softberry.com/berry.html) was used to identify the position of the ...


Journal of Molecular Catalysis B: Enzymatic
Volume 98, 30 December 2013, Pages 119–126 DOI:10.1016/j.molcatb.2013.10.012

A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance

Guojie Wu a, Shuo Zhang a, Houjin Zhang b, Shanshan Zhang a, Ziduo Liu a,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China b School of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430070, PR China

... of the esterase-encoding gene, est12, was carried out by Basic Local Alignment Search Tool (BLAST) program on the NCBI online database (http://www.ncbi.nlm.nih.gov), and the promoter region was analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml ...


DNA Res
(2013) doi: 10.1093/dnares/dst050 First published online: November 25, 2013

Global Transcriptional Response to Heat Shock of the Legume Symbiont Mesorhizobium loti MAFF303099 Comprises Extensive Gene Downregulation

Ana Alexandre 1,2, Marta Laranjo 1,2 and Solange Oliveira 1
1ICAAM – Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002-554 Evora, Portugal 2IIFA – Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002-554 Evora, Portugal

... MicrobesOnline Operon Predictions (www.micro-besonline.org/operons/) was used for operon prediction. 36 The identification of putative promoter sequences was performed using BPROM-Prediction of bacterial promoters software (www.softberry.com). ...


J. Bacteriol.
September 2013 vol. 195 no. 18 4264-4273 DOI:10.1128/JB.00471-13

Gene Content and Diversity of the Loci Encoding Biosynthesis of Capsular Polysaccharides of the 15 Serovar Reference Strains of Haemophilus parasuis

Howell et al.,
Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdoma The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, United Kingdomb

... Each capsule locus was analyzed for the presence of promoters using BPROM (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), where the top scores were found and mapped to within 150 bp preceding the start codon of each CDS of ...


Russian Journal of Genetics
Volume 49, Issue 5 , pp 477-486 DOI:10.1134/S1022795413050116

Organization and maintenance features of IncP-7 naphthalene degradation plasmid pFME5 basic replicon

O. V. Volkova, I. A. Kosheleva, A. M. Boronin
19806. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, 142290, Russia 29806. Pushchino State Educational Institute of Natural Sciences, Pushchino, 142290, Russia

... substituted nucleotides are underlined. Page 4. 480 RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 5 2013 VOLKOVA et al. SOSUI, and BPROM (Softberry) software available online. RESULTS AND DISCUSSION pFME5 Basic ...


PloS one
January 28, 2013DOI: 10.1371/journal.pone.0054479

A Non-Classical LysR-Type Transcriptional Regulator PA2206 Is Required for an Effective Oxidative Stress Response in Pseudomonas aeruginosa

F. Jerry Reen, Jill M. Haynes, Marlies J. Mooij, Fergal O'Gara
BIOMERIT Research Centre, Department of Microbiology, University College Cork, Cork, Ireland

... Genome sequences were obtained from the www.pseudomonas.com resource [24] and compared using the ARTEMIS Comparison Tool on the www.webact.org site [25]. Promoter predictions were performed using BProm software on the http://linux1.softberry.com site. ...


mBio
doi: 10.1128/mBio.00366-13 27 August 2013 vol. 4 no. 5 e00366-13

Vibrio cholerae ToxR Downregulates Virulence Factor Production in Response to Cyclo(Phe-Pro)

X. Renee Bina, Dawn L. Taylor, Amit Vikram, Vanessa M. Ante, James E. Bina
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

... encoding a hypothetical protein. Analysis of the leuO locus using BPROM promoter prediction software (http://www.softberry.com) indicated the presence of a single promoter upstream of VC2486. Consistent with this, VC2486 ...


Genome Biol Evol
(2013) 5 (2): 418-438. doi: 10.1093/gbe/evt008

Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists

Gertraud Burger 1,*, Michael W. Gray 2, Lise Forget 1 and B. Franz Lang 1
1Department of Biochemistry, Robert-Cedergren Center in Bioinformatics and Genomics, Universite de Montreal, Montreal, Quebec, Canada 2Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada

... Potential bacteria-like promoters were predicted with BPROM (http://linux1.softberry.com), which was chosen among various public web-accessible predictors, because it yields for jakobid mtDNAs a reasonable number (in the order of 200) of potential sites per genome, instead ...


PloS one
October 21, 2013DOI: 10.1371/journal.pone.0076030

Divergent Control of Two Type VI Secretion Systems by RpoN in Pseudomonas aeruginosa

Thibault G. Sana, Chantal Soscia, Celine M. Tonglet, Steve Garvis, Sophie Bleves
Laboratoire d’Ingenierie des Systemes Macromoleculaires (UMR7255), CNRS & Aix-Marseille Univ, Marseille, France

... 2C). The BProm algorithm identified one ? 70 dependent promoter upstream of the lip3 gene and another, in the opposite direction, upstream of the hsiB3 gene (http://linux1.softberry.com/ berry.phtml??topic=bprom&group=programs&subgroup=gfin?db) (Fig. 2C). ...


BMC Genomics
2013, 14:73 doi:10.1186/1471-2164-14-73

Genomic analysis of the regulatory elements and links with intrinsic DNA structural properties in the shrunken genome of Buchnera

Lilia Brinza 123, Federica Calevro 1 and Hubert Charles 12
1 UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Villeurbanne, France 2 BAMBOO, INRIA Rhone-Alpes, Montbonnot Saint-Martin, France 3 Present address: Universite de Lyon, Universite Lyon1, CNRS, UMR 5558, Laboratoire de Biometrie et Biologie Evolutive, Lyon, France

... Promoters and transcription starts were predicted, in the four Buchnera strains, using the software BPROM © (http://linux1.softberry.com/berry.phtml webcite) and MacVector (MacVector, Cary, NC, USA) for ? 70 and ? 32 promoters, respectively. ...


Microbiology
June 2013 vol. 159 no. Pt 6 1097-1108 DOI:10.1099/mic.0.065763-0

Identification of multiple putative S-layer genes partly expressed by Lysinibacillus sphaericus JG-B53

Lederer et al.,
1Helmholtz-Institute Freiberg for Resource Technology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany 2Institute of Resource Ecology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany

... Miller, 1991). The analyses of the promoter regions were performed with the program BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb; Solovyev & Shahmuradov, 2003). The ...


Microbiology
April 2013 vol. 159 no. Pt 4 737-747 DOI:10.1099/mic.0.064782-0

Type 1 and type 2 strains of Mycoplasma pneumoniae form different biofilms

Simmons et al.,
1Department of Genetics, University of Alabama at Birmingham, Birmingham, AL 35294, USA 2Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA

... Artemis (version 14.0.0; Wellcome Trust Sanger Institute). Promoter sequences were analysed using bprom (Prediction of Bacterial Promoters; http://linux1.softberry.com). The genome reference sequences for M. pneumoniae ...


Appl. Environ. Microbiol.
June 2013 vol. 79 no. 11 3494-3502 DOI:10.1128/AEM.03693-12

Identification and Expression of Genes Involved in the Conversion of Daidzein and Genistein by the Equol-Forming Bacterium Slackia isoflavoniconvertens

Christine Schroder a, Anastasia Matthies a, Wolfram Engst b, Michael Blaut a and Annett Braune a
Department of Gastrointestinal Microbiologya Analytics Group,b German Institute of Human Nutrition Potsdam-Rehbruecke, Nuthetal, Germany

... blast). Searching for putative transcription promoter and terminator sequences was done using the Web-based programs BPROM (Softberry, Mount Kisco, NY) and ARNold (http://rna.igmors.u-psud.fr/toolbox/arnold), respectively. ...


J. Bacteriol.
April 2013 vol. 195 no. 7 1504-1514 DOI:10.1128/JB.01999-12

Identification of the Mutation Responsible for the Temperature-Sensitive Lipopolysaccharide O-Antigen Defect in the Pseudomonas aeruginosa Cystic Fibrosis Isolate 2192

Michael R. Davis Jr et al.,
aDepartment of Microbiology, Immunology, and Cancer Biology, University of Virginia Health Sciences Center, Charlottesville, Virginia, USA bComplex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA

... The deletion in this strain was verified by PCR and sequencing. Promoter identification.An approximately 1 kb sequence located directly 5? of the wbpM start codon was scanned for promoters by using the neural network promoter prediction program BPROM (Softberry). ...


PloS one
October 02, 2013DOI: 10.1371/journal.pone.0076198

Pseudomonas putida AlkA and AlkB Proteins Comprise Different Defense Systems for the Repair of Alkylation Damage to DNA – In Vivo, In Vitro, and In Silico Studies

Mielecki et al.,
Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland Department of Genetics, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia

... Also, the putative -35 and -10 boxes responsible for RNA polymerase interaction are marked in pink (retrieved from RegulonDB, http://regulondb.ccg.unam.mx) or grey (SoftBerry BPROM prediction tool, http://linux1.softberry.com). ...


Appl. Environ. Microbiol.
July 2013 vol. 79 no. 13 3967-3973 DOI:10.1128/AEM.00867-13

Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces

Shannon M. Hinsa-Leasur a, Cassandra Koid a, James M. Tiedj b and Janna N. Schultzhaus a
Biology Department, Grinnell College, Grinnell, Iowa, USAa Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USAb

... with 64 bp separating the two genes. Based on results of the sequence analysis programs FGENESB and BPROM (SoftBerry), the Psyc_1602-encoding gene and cat1 reside in an operon. Located 379 bp downstream of cat1 ...


AEM
01197-13 DOI:10.1128/AEM.01197-13

Lytic infection of Lactococcus lactis by bacteriophages Tuc2009 and c2 trigger alternative transcriptional host responses

Stuart Ainsworth 1, Aldert Zomer 2, Jennifer Mahony 1 and Douwe van Sinderen 1, 3
1Department of Microbiology, University College Cork, Western Road, Cork, Ireland 2Centre for Molecular and Biomolecular Informatics, Nijmegen Centre for Molecular Life Sciences, Radboud University Medical Centre, Nijmegen 3Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Western Road, Cork, Ireland

... orf10. Analysis using BPROM 208 (http://www.softberry.com/berry.html) suggests a previously undetected promoter upstream of 209 orf10 (with proposed -35 and (extended) -10 sequences that correspond to ATGTAT and 210 ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 113, Issue 3 , pp 387-396 DOI:10.1007/s11240-012-0278-7

Plant tissue-specific promoters can drive gene expression in Escherichia coli

Jopcik et al.,
1. Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, P.O. Box 39A, 950 07, Nitra, Slovak Republic 2. Animal Production Research Centre, 951 41, Nitra, Slovak Republic 3. Constantine the Philosopher University, 949 74, Nitra, Slovak Republic

... elements and are capable to trigger gene expression in E. coli, we analyzed the sequences of DNA fragments carrying the plant embryo- and/or pollen-specific promoters using the bacterial sigma70 promoter recognition program BPROM (http://linux1.softberry.com/berry.phtml ...


J. Basic Microbiol.
doi: 10.1002/jobm.201300037

Multiple pqqA genes respond differently to environment and one contributes dominantly to pyrroloquinoline quinone synthesis.

Ge et al.,
1Laboratory of Microorganism Engineering, Beijing Institute of Biotechnology, Beijing, China 2School of Life Science and Biochemical Pharmaceutical, Shenyang Pharmaceutical University, Shenyang, China

... S2c), indicating that the transcriptional regulation events of these five genes were likely to be different. A high-score of putative prokaryotic promoter and regulation elements were predicted upstream of the coding sequence of ppqA2 by BProm software (www.softberry.com). ...


World Journal of Microbiology and Biotechnology
Volume 29, Issue 11 , pp 2067-2076 DOI:10.1007/s11274-013-1370-9

Characterization of a serine hydroxymethyltransferase for l-serine enzymatic production from Pseudomonas plecoglossicida

Wei Jiang, Bingzhao Xia, Junjie Huang, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... 1 Phylogenetic tree of PplglyA. The immediate upstream sequence from the ORF was analyzed; the promoter of the glyA gene was predicated by the tool of the Prediction of bacterial promoters (BPROM, http://linux1.softberry.com); and the putative ?10 box (GGTTAGAAT, from ...


Plasmid
Volume 70, Issue 1, July 2013, Pages 52–60 DOI:10.1016/j.plasmid.2013.01.006

Role of plasmid- and chromosomally encoded Hha proteins in modulation of gene expression in E. coli O157:H7

Sonia Paytubi a, Manuela Dietric b, Mario H. Queiroz b, Antonio Juarez a, b
a Departament de Microbiologia, Facultat de Biologia, Universitat de Barcelona, Avda. Diagonal 643, 08028 Barcelona, Spain b Institut de Bioenginyeria de Catalunya (IBEC), Baldiri i Reixac 10-12, 08028 Barcelona, Spain

... Promoter region was analysed via the BPROM program developed by Softberry, which predicted two promoters for the hha pO157 gene (TTTTCA-15bp-TCGTAT and TGGAGA-17bp-TGGCAA) with the respective Pribnow boxes located at positions -243 and -36 relative to the ...


Molecular Plant Pathology
14: 119–130. February 2013 doi: 10.1111/j.1364-3703.2012.00835.x

The ESX/type VII secretion system modulates development, but not virulence, of the plant pathogen Streptomyces scabies

Fyans, J. K., Bignell, D., Loria, R., Toth, I. and Palmer, T.
1Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee, UK 2James Hutton Institute, Invergowrie, Dundee, UK

... carrying esxA and esxB, together with 225 base pairs upstream of esxA, which should cover the natural promoter region (predicted to lie approximately 100 base pairs upstream of the esxA start codon according to the bprom prediction program; http://linux1.softberry.com/berry ...


PloS one
October 25, 2013DOI: 10.1371/journal.pone.0076341

Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent

Crost et al.,
The Gut Health and Food Safety Institute Strategic Programme, Institute of Food Research, Norwich, United Kingdom Laboratoire de Chimie Bacterienne, Institut de Microbiologie de la Mediterranee, CNRS and Aix-Marseille University, Marseille, France

... Prediction of the promoters was performed using the BPROM program (http://linux1.softberry. com/berry.phtml??topic=bprom&group=programs&subgroup=gfin?db). Results. Comparative analysis of R. gnavus E1 and R. gnavus ATCC 29149 glycobiome. ...


RNA
2013. 19: 1341-1348 DOI:10.1261/rna.038794.113

S6:S18 ribosomal protein complex interacts with a structural motif present in its own mRNA

Matelska et al.,
1Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Warsaw, 02-109, Poland 2Bioinformatics Laboratory, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznan, 61-614, Poland

... was analyzed. Full sequence alignment is available as Supplemental File 1. ? 70 promoters associated with the representative motifs (Fig. 2) were predicted with BPROM (http://linux1.softberry.com/berry.phtml). To estimate ...


ACS Synth. Biol.
2013, 2 (2), pp 111–120 DOI: 10.1021/sb300114d

Promoter Element Arising from the Fusion of Standard BioBrick Parts

Yao et al.,
†Department of Biomedical Engineering, ‡UC Davis Genome Center, and §Department of Computer Science, University of California Davis, One Shields Avenue, Davis, California 95616, United States Cellular and Molecular Biology Program, University of Michigan, 1011 North University Avenue, Ann Arbor, Michigan 48109, United States

... in silico methods for detecting pKAT or pKAT-like promoters, we examined the DNA sequence composed of 200 base pairs flanking either side of the barcode (for a 425 bp total sequence) in BBa_K327001 with the following algorithms: BPROM (http://www.softberry.com/berry ...


J. Bacteriol.
November 2013 vol. 195 no. 22 5025-5040 DOI:10.1128/JB.00669-13

Phosphate Concentration and the Putative Sensor Kinase Protein CckA Modulate Cell Lysis and Release of the Rhodobacter capsulatus Gene Transfer Agent

Westbye et al.,
Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada

... 2A). Analysis of the region upstream of ORF g1 using the bioinformatic tool BPROM (Softberry) indicated putative ?10 and ?35 sequences (light green in Fig. 2A). However, the location of these sequences did not correspond to either of the two RNA 5? ends mapped. ...


Molecular Microbiology
(2013), 88: 936–950. doi: 10.1111/mmi.12234

Integrated stress response of Escherichia coli to methylglyoxal: transcriptional readthrough from the nemRA operon enhances protection through increased expression of glyoxalase I

Ozyamak, E., de Almeida, C., de Moura, A. P. S., Miller, S. and Booth, I. R.
1School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Aberdeen, UK 2Institute of Complex Systems & Mathematical Biology, School of Natural & Computer Sciences, University of Aberdeen, Aberdeen, UK

... Averages from two independent experiments are shown. Black arrows indicate locations of known promoters. Gray arrows indicate promoters predicted by BPROM (http://linux1.softberry.com). Data smoothing and labels are as described in Fig. 3. Download figure to PowerPoint. ...


The Journal of Pathology
DOI:10.1002/path.4313

Versatile and enhanced tumour modeling in mice via somatic cell transduction

Rodriguez et al.,
1CRUK Cambridge Institute, Department of Molecular Imaging, University of Cambridge, Li Ka Shing Centre, Cambridge, UK 2Histopathology Department, Addenbrookes Hospital, Cambridge, UK

... Nat Protoc 2009; 4: 495-505. 14. BPROM: Available from: http://linux1.softberry.com/berry.phtml? topic=bprom&group=programs&subgroup=gfind b 15. BDGP Neural Network Promoter Prediction: Available from: http://www.fruitfly.org/seq_tools/promoter.html 16. ...


PLoS One.
2013; 8(9): e74495. doi: 10.1371/journal.pone.0074495

Determination of sRNA Expressions by RNA-seq in Yersinia pestis Grown In Vitro and during Infection

Yan et al.,
1State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, China 2Microbiology Laboratory, Sichuan Agricultural University, Yaan, Sichuan province, China

... were further removed. Bacterial promoter regions were predicted by BPROM (http://linux1.softberry.com/) and Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter.html). Rho-independent transcription ...


J. Bacteriol.
April 2013 vol. 195 no. 8 1834-1844 DOI:10.1128/JB.01946-12

Sigma Factor RpoS Controls Alkylresorcinol Synthesis through ArpR, a LysR-Type Regulatory Protein, during Encystment of Azotobacter vinelandii

Yanet Romero, Soledad Moreno, Josefina Guzman, Guadalupe Espin and Daniel Segura
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico

... By using the bacterial promoter recognition program BPROM (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb), ?35 and ?10 promoter elements showing similarity to RpoD-dependent promoters were identified in the arsA upstream region ...


Biotechnol. Bioeng.
(2013), 110: 2959–2969. doi: 10.1002/bit.24954

Isolation of fully synthetic promoters for high-level gene expression in Corynebacterium glutamicum.

Yim, S. S., An, S. J., Kang, M., Lee, J. and Jeong, K. J.
1Department of Chemical and Biomolecular Engineering, KAIST, Daejeon, Republic of Korea 2Department of Food Science & Biotechnology, Kyungsung University, Busan, Korea 3Institute for the BioCentury, KAIST, Daejeon, Republic of Korea

... All clones were 74 bp long, except for clone I29 that contained one more base in the promoter region, which might have been inserted during synthesis with the random primer (Synpro-F). BPROM software (http://www.softberry.com/berry.phtml) successfully predicted the ...


BMC Biotechnology
2013, 13:22 http://www.biomedcentral.com/1472-6750/13/22

Cloning and characterization of a novel cold-active glycoside hydrolase family 1 enzyme with b-glucosidase, b-fucosidase and b-galactosidase activities

Anna Wierzbicka-Wos 1†, Paulina Bartasun2†, Hubert Cieslinski2* and Jozef Kur2
1 Department of Microbiology, Faculty of Biology, University of Szczecin, Felczaka 3c, Szczecin 71-412, Poland. 2 Department of Microbiology, Gdansk University of Technology, Narutowicza 11/12, Gdansk 80-233, Poland.

... As described on the BProm website, the program has an E. coli promoter recognition accuracy of approximately 80%, and the most recent version is accessible at http://linux1.softberry.com/ berry.phtml?topic=bprom&group=programs &subgroup=gfindb. ...


Phil. Trans. R. Soc. B
19 April 2013 vol. 368 no. 1616 20120317 DOI:10.1098/rstb.2012.0317

Regulation of reductive dehalogenase gene transcription in Dehalococcoides mccartyi

Wagner et al.,
1Institute of Biology/Microbiology, Martin-Luther-University Halle-Wittenberg, Halle 06099, Germany 2Helmholtz Centre for Environmental Research, UfZ Leipzig, Leipzig 04318, Germany 3Laboratory of Microbiology, Wageningen University, Wageningen 6703 HB, The Netherlands

... start sites; the short arrows above the inverted repeat sequences represent the putative recognition sequences of the regulator; bold and italic letters depict the consensus sequences of the ?10 and ?35 region predicted by the BPROM software (http://linux1.softberry.com/berry ...


International journal of molecular sciences
2013, 14(8), 16901-16916. DOI:

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

Banderas A., Guiliani N.
Laboratory of Bacterial Communication, Department of Biology, Faculty of Sciences, University of Chile, Santiago 780-0024, Chile

... Manipulation Suite [50] and FaBox [51]. Consensus sigma 70 bacterial promoter -10 and -35 elements were inferred using the Bprom predictor (www.softberry.com) Type I and Type II PBS sequences with additional 100 bp flanking each side ware used as input for Bprom. ...


Genetics and Molecular Biology
(2013). 36(2), 243-251. DOI:

Characterization of the omlA gene from different serotypes of Actinobacillus pleuropneumoniae: a new insight into an old approach

Rossi, C. C., Araujo, E. F. D., Queiroz, M. V. D., & Bazzolli, D. M. S.
Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Universidade Federal de Vicosa, Vicosa, MG, Brazil

... pseudogenes. Nucleic Acids Res 31:5338-5348. Internet Resources Bacterial Promoter Prediction Program BPROM, http://www.softberry.com (March 16, 2013). Associate Editor: Celia Maria de Almeida Soares License information ...


PloS one
(2013). 8(4), e61808. DOI:

Characterization of the Biocontrol Activity of Pseudomonas fluorescens Strain X Reveals Novel Genes Regulated by Glucose

Kremmydas, G. F., Tampakaki, A. P., & Georgakopoulos, D. G.
Department of Agricultural Biotechnology, Agricultural University of Athens, Athens, Greece

... The putative promoter site prediction was performed with two bioinformatic applications, BPROM software (Softberry Inc., Mount Kisco, NY, USA) and NNPP 2.2 software (Berkeley Drosophila Genome Project-BDGP, Berkeley, CA, USA). ...


Scientific reports
(2013). 3.e DOI:10.1038/srep02240

Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles

ThLongkumer et al.,
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India Dept. of Plant Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India Bioinformatics Centre, Pondicherry University, Puducherry - 605 014, India

...and for promoter prediction, BPROM software (www.softberry.com/berry.phtml?topic=bprom) was used. ...


World Journal of Microbiology and Biotechnology
Volume 28, Issue 5 , pp 2221-2228, DOI: 10.1007/s11274-012-1029-y

Identification of a copper-responsive promoter and development of a copper biosensor in the soil bacterium Achromobacter sp. AO22

Shee Ping Ng (1) (2), Enzo A. Palombo (1), Mrinal Bhave (1)
1. Environment and Biotechnology Centre, Faculty of Life and Social Sciences, Swinburne University of Technology, PO Box 218, Melbourne, VIC, 3122, Australia 2. School of Science and Technology, Nilai University College, Persiaran Kolej Bbn, 71800, Putra Nilai, Negeri Sembilan, Malaysia

... AO22 (Ng et al. 2012; Genbank num- ber GU929214) contains a 255 bp region between the proposed start codons of copR and copA (Fig. 1). Analysis by BPROM (http://linux1.softberry.com/ berry.phtml?topic= bprom&group=programs&subgroup=gfindb) (Ng et al. ...


Antonie van Leeuwenhoek
March 2012, Volume 101, Issue 3, pp 583-593 DOI 10.1007/s10482-011-9673-z

Gene expression modulation by heat stress in Acidithiobacillus ferrooxidans LR

Daniela A. Ribeiro, Lucio F. C. Ferraz, Renato Vicentini, Laura M. M. Ottoboni
1. Center for Molecular Biology and Genetic Engineering (CBMEG), State University of Campinas—UNICAMP, C.P. 6010, Campinas, SP, 13083-875, Brazil

... 0.05). Bioinformatic analysis BPROM (Softberry, Inc.) was used to predict the transcription start site of the genes. BPROM is a bacterial r70 promoter recognition software program, which has about 80% accuracy and specificity. ...


Molecular Biology
July 2012, Volume 46, Issue 4, pp 542-547 DOI 10.1134/S0026893312030120

Structure of replication initiation region in Pseudomonas IncP-7 streptomycin resistance plasmid Rms148

O. V. Volkova, I. A. Kosheleva, A. M. Boronin
1. Pushchino State University, Pushchino, 142290, Russia 2. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, 142290, Russia

... Russia). Nucleotide and amino acid sequences were analyzed using DnaStar, BLAST, Jred3, PredictProtein, and BPROM software (Softberry). CLUSTAL and TREECON programs were used to determine the phylogenetic tree [10]. ...


J Microbiol Biotechnol.
2012 Jun;22(6):742-53.

The heavy metal tolerant soil bacterium Achromobacter sp. AO22 contains a unique copper homeostasis locus and two mer operons

NS Ping, Palombo EA, Bhave M
Environment and Biotechnology Centre, Faculty of Life and Social Sciences, Swinburne University of Technology, PO Box 218, Melbourne, Victoria 3122, Australia.

... DNA regions of interest were submitted in both directions to the BPROM server (http://linux1. softberry.com/ berry.phtml?topic=bprom&group=programs&subgroup=gfindb) for predicting potential promoter regions including the -10 and -35 hexamers and likely transcription ...


The Journal of General and Applied Microbiology
Vol. 58 (2012) No. 5 p. 387-395 DOI: 10.2323/jgam.58.387

An examination of an Antarctic soil metagenomic-derivate putative methylthioadenosine phosphorylase gene as a novel reporter gene for promoter trapping

Paulina Bartasun 1), Hubert Cieslinski 1), Jozef Kur 1)
1) Department of Microbiology, Chemical Faculty, Gdansk University of Technology

... BProm has about 80% accuracy in E. coli pro- moter recognition as was described at its website. The recent version of BProm is accessible from the website (http://linux1.softberry. com/berry.phtml?topic=bprom& group=programs&subgroup=gfindb). ...


Journal of Industrial Microbiology & Biotechnology
May 2012, Volume 39, Issue 5, pp 731-741 DOI: 10.1007/s10295-011-1074-9

Cloning and characterization of two new thermostable and alkalitolerant a-amylases from the Anoxybacillus species that produce high levels of maltose

Yen Yen Chai et al.,
1. Faculty of Biosciences and Bioengineering, Universiti Teknologi Malaysia, 81310, Skudai, Johor, Malaysia 2. Enzyme and Microbial Technology Research, Faculty of Biotechnology and Biomolecular Science, Universiti Putra Malaysia (UPM), 43400, Serdang, Selangor, Malaysia

... html). The putative ribosome binding site was identified by a sequence comparison with the corresponding regions of other a-amylase genes. The promoter regions were pre- dicted using the BPROM program (http://linux1.softberry. ...


Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 464-471 DOI: 10.1128/AAC.00602-11

Identification of Hopanoid Biosynthesis Genes Involved in Polymyxin Resistance in Burkholderia multivorans

Rebecca J. Malott, Barbara R. Steen-Kinnaird, Tracy D. Lee and David P. Speert
Centre for Understanding and Preventing Infection in Children, Department of Pediatrics, University of British Columbia, Vancouver, British Columbia, Canada

.. Lynnon Biosoft, Vaudreuil, Quebec, Canada). Additional in silico promoter and terminator predictions were performed with BPROM and FindTerm (Softberry, Inc., Mount Kisco, NY). Sequence similarity searches were performed ...


Current Microbiology
December 2012, Volume 65, Issue 6, pp 770-775 DOI: 10.1007/s00284-012-0228-y

Evidence for Two Promoters Internal to the Alginate Biosynthesis Operon in Pseudomonas aeruginosa

Janice L. Paletta, Dennis E. Ohman
1. Department of Microbiology and Immunology, Virginia Commonwealth University Medical Center, P.O. Box 980678, Richmond, VA, 23298-0678, USA 2. McGuire Veterans Affairs Medical Center, Richmond, VA, 23249, USA

... The intergenic spaces upstream of algG, algX, algL, algI, algJ, algF, and algA were analyzed using BPROM software (Softberry, Inc., Mount Kisco, NY) to identify a sigma-70 bacterial promoter consensus sequence, but none was found. ...


Appl. Environ. Microbiol.
February 2012 vol. 78 no. 3 828-838 DOI: doi: 10.1128/AEM.07480-11

Role of IncP-1b Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses

Krol et al.,
aDepartment of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, Moscow, Idaho, USA bDepartment of Microbiology, University of California, Davis, Davis, California, USA

... Van der Auwera, unpublished data), with identity scoring by ClustalW. The pdca promoter region was analyzed using BPROM (Softberry Inc., Mount Kisco, NY). To infer the phylogenetic relationships of various IncP-1 plasmids ...


Microbiology
November 2012 mic.0.061614-0 DOI: 10.1099/mic.0.061614-0

A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants

Betina Agaras, Patricio Sobrero and Claudio Valverde 1
Universidad Nacional de Quilmes

... by a typical AG-rich Shine-Dalgarno motif and by a putative ?70-dependent promoter 207 identified by the Bprom algorithm (http://linux1.softberry.com/berry.phtml), which may 208 drive rsmASm expression (Fig. 1). A second divergent ?70-dependent promoter was 209 ...


Research in Microbiology
Volume 163, Issues 6–7, July–August 2012, Pages 413–418 DOI: 10.1016/j.resmic.2012.05.006

Two sRNA RyhB homologs from Yersinia pestis biovar microtus expressed in vivo have differential Hfq-dependent stability

Zhongliang Deng et al.,
a Southern Medical University, Guangdong 510450, China b State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China

... than E. coli ryhB RNA (Masse and Gottesman, 2002). The corresponding promoter regions including the -10 and -35 boxes were predicted using BPROM (http://linux1.softberry.com). RyhB1 and RyhB2 in Y. pestis contain the ...


Microbiological Research
Volume 168, Issue 2, 22 February 2013, Pages 113–118 DOI: 10.1016/j.micres.2012.07.003

Regulation of Staphylococcus aureus immunodominant antigen B (IsaB)

Nicole M. Mackey-Lawrence , Kimberly K. Jefferson
Department of Microbiology and Immunology, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23928, USA

... analysis. As Fig. 2 indicates, the TSS matched the TSS predicted by BPROM (Softberry software). The TSS was 39 bp upstream from the start codon, indicating that the isaB transcript contains a 39 nt 5?-untranslated region. ...


RNA
2012. 18: 795-806 DOI: 10.1261/rna.029868.111

Regulation of expression and catalytic activity of Escherichia coli RsmG methyltransferase

Alfonso Benitez-Paez 1,2, Magda Villarroya 1 and M.-Eugenia Armengod 1,3
1Laboratorio de Genetica Molecular, Centro de Investigacion Principe Felipe, 46012 Valencia, Spain 2Bioinformatic Analysis Group–GABi, Centro de Investigacion y Desarrollo en Biotecnologia, Bogota D.C. 111221, Colombia

... The top of the figure shows a schematic of the chromosomal region including the mnmG-rsmG operon and the predictions of the promoter regions by the Neural Network Promoter Prediction (black) (Reese 2001) and BPROM (gray) (http://www.softberry.com/berry.phtml) servers. ...


Clinical Microbiology and Infection
Volume 18, Issue 11, pages E446–E451, November 2012 DOI: 10.1111/j.1469-0691.2012.03979.x

ISAba825 controls the expression of the chromosomal blaOXA-51-like and the plasmid borne blaOXA-58 gene in clinical isolates of Acinetobacter baumannii isolated from the USA

B. S. Lopes, L. Al-Hassan, S. G. B. Amyes
Medical Microbiology, The University of Edinburgh, Edinburgh, UK.

... four isolates. A putative promoter was found with ?35 (TTGTCA) and ?10 (TATGAA) located 17 bp apart from each other (BPROM, Softberry, Inc., Mount Kisco, NY) located 97 and 74 bp upstream of the bla OXA-65 gene. A target ...


J. Bacteriol.
July 2012 vol. 194 no. 13 3486-3494 DOI: 10.1128/?JB.00194-12

SMU.152 Acts as an Immunity Protein for Mutacin IV

Mohammad Shahnoor Hossain and Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, Kansas, USA

... Sequence analysis, confirmed using BPROM online software (prediction of bacterial promoters [Softberry]), indicates the presence of putative ?35 (TTAGAA) and ?10 (TATACT) box motifs 78 and 55 bp, respectively, upstream of the putative start codon with a putative ribosomal ...


J. Virol
2012, 86(23):12625. DOI: 10.1128/JVI.01783-12

Characterization of the genome, proteome and structure of yersiniophage ?R1-37

Skurnik et al.,
1Department of Bacteriology and Immunology, Infection Biology Research Programme, Haartman Institute, University of Helsinki, Helsinki, Finland 2Helsinki University Central Hospital Laboratory Diagnostics, Helsinki, Finland

... The PHIRE program was used to identify 159 repeat sequences in the phage genome (27). Bacterial promoter sequence identification was 160 carried out online at (http://linux1.softberry.com/berry.phtml) using the BPROM program. ...


MicrobiologyOpen
DOI: 10.1002/mbo3.53 Early View (Online Version of Record published before inclusion in an issue)

Unique secreted–surface protein complex of Lactobacillus rhamnosus, identified by phage display

Gagic, D., Wen, W., Collett, M. A. and Rakonjac, J.
1 Institute of Molecular BioSciences, Massey University, Palmerston North 4442, New Zealand 2 Fonterra Research and Development Centre, Palmerston North 4442, New Zealand

... Upstream of the transcriptional site a - 10 box (ACATAAAAT) and -35 box (TTGATT) was iden- tified in the putative promoter region using BPROM pro- moter prediction program from the Softberry server (http://www.softberry.com/berry.phtml). ...


Antimicrob Agents Chemother.
2012 Nov;56(11):5520-7. doi: 10.1128/AAC.01206-12. Epub 2012 Aug 13.

The putative lactococcal extracytoplasmic function anti-sigma factor llmg2447 determines resistance to the cell wall-active bacteriocin lcn972.

Roces et al.,
1 DairySafe Group, Department of Technology and Biotechnology of Dairy Products, IPLA-CSIC, Villaviciosa, Asturias, Spain. 2 Department of Molecular Genetics. Groningen Biomolecular Sciences and Biotechnology Institute. University of Groningen, Nijenborgh 7, 9747 AG Groningen, The Netherlands

... 8 and Pfam (http://pfam.sanger.ac.uk/). ?70 promoter sequences were identified using Bprom 163 (http://www.softberry.com). Protein topology was predicted with TMHMM Server v2.0 164 (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and SOSUI (http://bp.nuap.nagoya- 165 ...


PLoS ONE
7(10): e46587. doi:10.1371/journal.pone.0046587

QsdH, a Novel AHL Lactonase in the RND-Type Inner Membrane of Marine Pseudoalteromonas byunsanensis Strain 1A01261.

Wei Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China National Key Laboratory of Crop Genetic Improvement, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China

...The positive DNA fragment was analyzed with DNASTAR software (DNASTAR, Inc.) and by BLAST (http://www.ncbi.nlm.nih.gov/), BPROM (http://linux1.softberry.com/berry.phtml)...


Journal of Industrial Microbiology & Biotechnology
Volume 39, Issue 8 , pp 1245-1251 DOI: 10.1007/s10295-012-1128-7

Isolation and characterization of a novel GH67 a-glucuronidase from a mixed culture

Lee et al.,
1. USDA-ARS-WRRC, 800 Buchanan Street, Albany, CA, 94710, USA 2. Engineering Research Center of Eco-environment in Three Gorges Reservoir Region, Ministry of Education, China Three Gorges University, Yichang, 443002, China

... Page 4. J Ind Microbiol Biotechnol 123 When the upstream 5! region of the gene was analyzed by a bacterial promoter search program (BPROM, Softberry, Inc., Mount Kisco, NY, USA), ?35 and ?10 promoter ele- ments were identified (Fig. ...


Applied Microbiology and Biotechnology
Volume 94, Issue 1 , pp 261-272 DOI:10.1007/s00253-011-3621-8

Identification of the flavin monooxygenase responsible for ipso substitution of alkyl and alkoxyphenols in Sphingomonas sp. TTNP3 and Sphingobium xenophagum Bayram

Porter et al.,
1. Department of Microbiology, Cornell University, Ithaca, New York, NY, USA 2. Department of Environmental Science, Rutgers, the State University of New Jersey, New Brunswick, NJ, 08901, USA

... 1997), was used as a template for the model. Sequences outside the opdA coding sequence were compiled as described above. Putative promoter regions were identified with the BPROM program (Softberry, Inc., Mount Kisco, NY). Nucleotide sequence ...


Infect. Immun.
September 2012 vol. 80 no. 9 3247-3255 DOI: 10.1128/IAI.00178-12

Role of RelA and SpoT in Burkholderia pseudomallei Virulence and Immunity

Muller et al.,
a College of Life and Environmental Sciences, Biosciences, University of Exeter, Exeter, Devon, United Kingdom b London School of Hygiene and Tropical Medicine, London, United Kingdom

... In silico analyses.Homologies between amino acid sequences were determined using NCBI's BLASTP algorithm. Conserved domains were analyzed using NCBI's conserved domain database (CDD). Promoter predictions were performed using the Bprom software (Softberry). ...


AEM
Published ahead of print 7 September 2012, doi: 10.1128/AEM.01693-12

Whole genome microarray and gene deletion studies reveal regulation of the polyhydroxyalkanoate production cycle by the stringent response in Ralstonia eutropha H16

Christopher J. Brigham 1, Daan R. Speth 1,2, ChoKyun Rha 3 and Anthony J. Sinskey 1,4,5
1Department of Biology 2Department of Microbiology, IWWR, Radboud University Nijmegen, Heyendaalseweg 135, 6525 AJ, Nijmegen, The Netherlands

... and further analyzed using MEGA 5 (61). Potential ?54 promoters were manually identified 211 based on the consensus sequence published previously (3). Potential ?70 promoters were 212 identified using BPROM (Softberry). 213 Microarray data accession number. ...


J. Bacteriol.
April 2012 vol. 194 no. 8 1968-1978 DOI: 10.1128/?JB.00037-12

Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans

Jeong Nam Kim, Sang-Joon Ahn, Kinda Seaton, Steven Garrett and Robert A. Burne
Department of Oral Biology, University of Florida, College of Dentistry, Gainesville, Florida, USA

... Transcriptional organization of the relQ operon.Two potential promoters were identified 56 bp and 35 bp upstream of the relQ and pta start sites, respectively, using BPROM bacterial promoter identification software (Softberry, Inc., NY) (Fig. ...


Biological and Pharmaceutical Bulletin
Vol. 35 (2012) No. 4 P 573-581 DOI: 10.1248/bpb.35.573

Metabolism of Ginsenoside Rb1 by Human Intestinal Microflora and Cloning of Its Metabolizing b-D-Glucosidase from Bifidobacterium longum H-1

Il-Hoon Jung 1), Jeong Hoon Lee 1), Yang-Jin Hyun 1), Dong-Hyun Kim 1
1) Department of Life and Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University

... The putative sigma 70 type promoter sequences of both TTTACA (resembling ?35 se- quence) and GGTTATTAT (resembling ?10 sequence) were identified to be located at positions ?75 and ?55, respectively by using BPROM (http://linux1.softberry.com/berry.phtml?to pic ...


Infect. Immun.
2012, 80(9):3247. DOI: 10.1128/IAI.00178-12

Role of RelA and SpoT in Burkholderia pseudomallei Virulence and Immunity

Muller et al.,
College of Life and Environmental Sciences, Biosciences, University of Exeter, Exeter, Devon, United Kingdom, a and London School of Hygiene and Tropical Medicine, London, United Kingdomb

... BLASTP algorithm. Conserved domains were analyzed using NCBI's conserved domain database (CDD). Promoter predictions were performed using the Bprom software (Softberry). Statistical analyses. Differences between ...


Molecular Plant Pathology
Volume 14, Issue 2, pages 119–130, February 2013 DOI: 10.1111/j.1364-3703.2012.00835.x

The ESX/type VII secretion system modulates development, but not virulence, of the plant pathogen Streptomyces scabies

Joanna K. Fyans 1,2, Dawn Bignell 3, Rosemary Loria 4, Ian Toth 2, Tracy Palmer 1
1Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee, UK 2James Hutton Institute, Invergowrie, Dundee, UK

... carrying esxA and esxB, together with 225 base pairs upstream of esxA, which should cover the natural promoter region (predicted to lie approximately 100 base pairs upstream of the esxA start codon according to the bprom prediction program; http://linux1.softberry.com/berry ...


J. Bacteriol.
April 2012 vol. 194 no. 7 1789-1799 doi: 10.1128/JB.06827-11

Autoregulation of the Synthesis of the MobM Relaxase Encoded by the Promiscuous Plasmid pMV158

Fabian Lorenzo-Diaz a,*, Virtu Solano-Collado a, Rudi Lurz b, Alicia Bravo a and Manuel Espinosa a
aCentro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, Madrid, Spain bMax Planck Institut fur Molekulare Genetik, Berlin, Germany

... Sequence analysis of the region located just upstream of coordinate 3643 using the BPROM (Softberry, Mount Kisco, NY) prediction program supported the latter hypothesis. It revealed the existence of an additional promoter sequence, here termed Pmob2 (Fig. ...


BMC Microbiology
2012, 12:268 doi:10.1186/1471-2180-12-268

Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB

Ricardo N Moreira 1†, Susana Domingues 1†, Sandra C Viegas 1, Monica Amblar 2 and Cecilia M Arraiano 1*
1 Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, Oeiras, 2780-157, Portugal 2 Unidad de Patologia Molecular del Neumococo, Centro Nacional de Microbiologia, and CIBER Enfermedades Respiratorias, Instituto de Salud Carlos III. Majadahonda, Madrid, 28220, Spain

...In silico predictions of putative promoters were performed using the BPROM SoftBerry software (http:/ / linux1.softberry.com/ berry.phtml?topic=bprom&group=progr ams&subgroup=gfindb webcite)...


PLoS ONE
7(8): e43444. doi:10.1371/journal.pone.0043444

Rhamnose-Inducible Gene Expression in Listeria monocytogenes

Lars Fieseler, Sibylle Schmitter , Justinas Teiserskas, Martin J. Loessner
Institute of Food, Nutrition, and Health, ETH Zurich, Zurich, Switzerland Department of Biochemistry and Biophysics, Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania.

.. Putative -10 and -35 regions were identified by a promoter-finding algorithm (BPROM, http://linux1.softberry.com/berry.phtml). Cloning Procedures. Plasmid pPL2 was used for cloning and single copy insertion into a tRNA Arg gene via bacteriophage PSA site-specific integrase. ...


PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709

The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae

Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain

...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...


MicrobiologyOpen
Early View (Online Version of Record published before inclusion in an issue) DOI: 10.1002/mbo3.50

First insights into the syntrophic acetate-oxidizing bacteria – a genetic study

Bettina Muller *, Li Sun, Anna Schnurer
Department of Microbiology, Uppsala BioCenter, Swedish University of Agricultural Sciences, Uppsala, Sweden

...BPROM, available online at http://www.softberry.com, was used as the promoter-prediction program....


AEM
Published ahead of print 14 September 2012, doi: 10.1128/AEM.01442-12

Phylogenetically novel LuxI/LuxR-type Quorum Sensing Systems Isolated Using a Metagenomic Approach

Nasuno et al.,
1Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8566, Japan 2Graduate school of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki, 305-8572, Japan

... ausI from fosmid pN52. The G+C content in pN16 (56%) was lower than in pN52 (65%). 296 Promoter prediction software BPROM (Softberry, Mt. Kisco, NY, USA) identified 297 possible ?70 promoters in the upstream regions of both AHL-synthesizing enzyme genes, 298 ...


Plasmid
Volume 68, Issue 1, July 2012, Pages 1–12 DOI: 10.1016/j.plasmid.2012.01.009

Requirements for Borrelia burgdorferi plasmid maintenance

Kit Tilly, 1, , Claire Checroun1, 2, Patricia A. Rosa
Laboratory of Zoonotic Pathogens, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rocky Mountain Laboratories, Hamilton, MT 59840, United States

... 1C). The ability of this region to confer stable maintenance on a B. burgdorferi shuttle vector ( [Byram et al., 2004] and [Jewett et al., 2007a]) argues in favor of this hypothesis. Searching for a bacterial promoter using BPROM (Softberry, Inc., Mt. ...


J. Bacteriol.
May 2012 vol. 194 no. 9 2307-2320 DOI: .1128/JB.00142-12

Long-Range Transcriptional Control of an Operon Necessary for Virulence-Critical ESX-1 Secretion in Mycobacterium tuberculosis

Hunt et al.,
aDivision of Mycobacterial Research, MRC National Institute for Medical Research, Mill Hill, London, United Kingdom bDepartment of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, United Kingdom

... A search for a possible promoter using Softberry BPROM (Mount Kisco, NY; a bacterial ? 70 prediction program) predicted a transcription start site at ?66 bp upstream of the translation start site in close agreement with the results described above. ...


J. Bacteriol.
October 2012 vol. 194 no. 19 5315-5324 DOI: 10.1128/JB.00984-12

Epoxide-Mediated CifR Repression of cif Gene Expression Utilizes Two Binding Sites in Pseudomonas aeruginosa

Ballok et al.,
aDepartment of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, New Hampshire, USA bDepartment of Biochemistry, Geisel School of Medicine at Dartmouth, Hanover, New Hampshire, USA

... Therefore, we utilized 5?RACE to map the start sites for the cifR gene and morB operon transcripts, as indicated in Fig. 4C. We next used the promoter prediction software, BPROM (SoftBerry), to identify the ?10 and ?35 sites for each sequence. As can be seen in Fig. ...


J. Bacteriol.
March 2012 vol. 194 no. 6 1523-1532 doi: 10.1128/JB.06104-11

Characterization of Escherichia colidinJ-yafQ Toxin-Antitoxin System Using Insights from Mutagenesis Data

Julija Armalyte, Milda Jurenaite, Gina Beinoraviciute, Justinas Teiserskas and Edita Suziedeliene
Department of Biochemistry and Biophysics, Faculty of Natural Sciences of Vilnius University, Vilnius, Lithuania

... The open arrowhead indicates free DNA; full arrowheads indicate DNA bound in complex with DinJ-YafQ(His) 6 . We have identified several palindromic sequences in the promoter region of dinJ-yafQ by sequence analysis (BPROM; Softberry, Inc., Mount Kisco, NY) (Fig. ...


Infect. Immun.
March 2012 vol. 80 no. 3 1037-1049 doi: 10.1128/IAI.05563-11

Pneumococcal Gene Complex Involved in Resistance to Extracellular Oxidative Stress

Andisi et al.,
aLaboratory of Molecular Bacteriology, Department of Medical Microbiology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands bMolecular Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, Rijksuniversiteit Groningen, Groningen, The Netherlands

...Therefore, we analyzed all intergenic regions by hand and with the BPROM software (Softberry, Mt. Kisco, NY); both methods...


BMC Genomics
2012, 13:550 doi:10.1186/1471-2164-13-550

Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays

Patenge et al.,
1 Institute of Medical Microbiology and Hospital Hygiene, University of Rostock, Schillingallee 70, 18057, Rostock, Germany 2 Institute of Medical Microbiology, Genome Research, Justus-Liebig-University, Frankfurter Strasse 107, 35392, Giessen, Germany

... Terminators and promoters were predicted by TransTermHP [52] ( http://transterm.cbcb.umd. edu/tt/Streptococcus_pyogenes_NZ131.tt webcite) and BDGP Neural Network Promoter Prediction [53], and BProm ( http://www.SoftBerry.com webcite), respectively. ...


MPMI
Vol. 25, No. 1, 2012, pp. 119–128. DOI: 10.1094/ MPMI -07-11-0188

A Role for Bradyrhizobium japonicum ECF16 Sigma Factor EcfS in the Formation of a Functional Symbiosis with Soybean

S. B. Stockwell, 1 L. Reutimann, 2 and M. L. Guerinot 1
1 Biological Sciences Department, Dartmouth College, Hanover, NH 03755, U.S.A.; 2 ETH, Institute of Microbiology, Zurich, Switzerland

...Further promoter analysis was performed using motif searches (MEME Suite) (Bailey et al. 2009) and the virtual footprint algorithm (Softberry BPROM analysis tool) (Munch et al. 2005); ...


BMC Microbiology
2012, 12:173 doi:10.1186/1471-2180-12-173

Pyrosequencing-based analysis reveals a novel capsular gene cluster in a KPC-producing Klebsiella pneumoniae clinical isolate identified in Brazil

Ramos et al.,
1 Laboratorio Nacional de Computacao Cientifica (LNCC), Petropolis, Rio de Janeiro, Brazil 2 Instituto de Microbiologia Paulo de Goes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

... webcite. Prediction of promoters was performed using the in-house SABIA platform as well as the BPROM program (http://linux1.softberry.com webcite), which searches for promoters under the control of the sigma factor 70. ...


BMC Genomics
2012, 13:37 doi:10.1186/1471-2164-13-37

Expression profiling reveals Spot 42 small RNA as a key regulator in the central metabolism of Aliivibrio salmonicida

Hansen et al.,
1 Department of chemistry, Faculty of science and technology, University of Tromso, N-9037, Tromso, Norway 2 The Norwegian Structural Biology Centre, University of Tromso, N-9037, Tromso, Norway

... However, there is weak conservation among the predicted CRP sites in vibrios. The BPROM program (from http://www.softberry.com webcite) was used to predict -10 and -35 promoter sequences. Computational prediction of Spot42-pirin mRNA base-pairing. ...


PLoS ONE
7(3): e32977. doi:10.1371/journal.pone.0032977

Identification of the First Functional Toxin-Antitoxin System in Streptomyces

Laura Sevillano, Margarita Diaz, Yoshihiro Yamaguchi, Masayori Inouye, Ramon I. Santamaria
Instituto de Biologia Funcional y Genomica/Departamento de Microbiologia y Genetica, Consejo Superior de Investigaciones Cientificas, Universidad de Salamanca, Campus Miguel de Unamuno, Salamanca, Spain Department of Biochemistry, Center for Advanced Biotechnology and Medicine, Robert Wood Johnson Medical School, Piscataway, New Jersey, United States of America

...BPROM software (http://linux1.softberry.com/berry.phtml) was used to search for conserved sequences in the putative promoter of the TA system....


Appl. Environ. Microbiol.
September 2012 vol. 78 no. 18 6568-6575 July 2012, doi: 10.1128/?AEM.01060-12

Mercury Resistance and Mercuric Reductase Activities and Expression among Chemotrophic Thermophilic Aquificae

Zachary Freedman a,b,*, Chengsheng Zhu a and Tamar Barkay a,b
aDepartment of Biochemistry and Microbiology bGraduate Program in Ecology and Evolution, Rutgers University, New Brunswick, New Jersey, USA

... (50). Of the 284 gene homologs available, 99 were selected for reconstruction; the selected homologs represented all major clusters in the MerA phylogeny. Putative promoter regions were determined using the BPROM tool (Softberry Inc., Mt. Kisco, NY). ...


Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 565-568 doi: 10.1128/?AAC.00081-11

Description of a 2,683-Base-Pair Plasmid Containing qnrD in Two Providencia rettgeri Isolates

Thomas Guillard et al.,
aCHU Reims, Hopital Robert Debre, Laboratoire de Bacteriologie-Virologie-Hygiene, Reims, France bUFR Medecine, Universite Reims Champagne-Ardenne, Reims, France cUniversite Paris Diderot-Paris 7, Paris, France

... 2) (9): (i) an AT-rich region, (ii) iterons, (iii) three DnaA boxes, and (iv) two pairs of inverted repeats were identified using REPFIND (2). In addition, a putative promoter and transcription start site have been identified for Orf4 using BPROM (Softberry) and the promoter prediction ...


Extremophiles
Volume 16, Issue 3 , pp 363-376 DOI 10.1007/s00792-012-0435-2

Plasmid pP62BP1 isolated from an Arctic Psychrobacter sp. strain carries two highly homologous type II restriction-modification systems and a putative organic sulfate metabolism operon

Robert Lasek (1) Lukasz Dziewit (1) Dariusz Bartosik bartosik@biol.uw.edu.pl (1)
1. Department of Bacterial Genetics, Faculty of Biology, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-096, Warsaw, Poland

... 2010). Sequence alignments were per- formed using MUSCLE (Edgar 2004). Putative promoter sequences were predicted using BPROM (http://www. softberry.com/berry.html). Protein secondary structures were determined with the application of PredictProtein (Rost et al. ... Ïîõîæèå ñòàòüè Âñå âåðñèè ñòàòüè (5)


Enzyme and Microbial Technology
Volume 50, Issues 6–7, 10 May 2012, Pages 280–286 http://dx.doi.org/10.1016/j.enzmictec.2012.02.001

The direct repeat sequence upstream of Bacillus chitinase genes is cis-acting elements that negatively regulate heterologous expression in E. coli

Liang Xiao a, b, 1, Chuan Liu a, b, 1, Chi-chu Xie a, b, Jun Cai a, b, c, Yue-hua Chen a, b, c,
a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, PR China b Department of Microbiology, College of Life Sciences, Nankai University, Weijin Road 94, Tianjin 300071, PR China

... The chitinase genes were sequenced and the upstream regions were analyzed using online softwares REPFIND (http://zlab.bu.edu/repfind/form.html) and BPROM (http://linux1.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1298-1301 doi: 10.1128/?AEM.07278-11

Requirement for RNA Helicase CsdA for Growth of Yersinia pseudotuberculosis IP32953 at Low Temperatures

Eveliina Palonen et al.,
Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland

... An important role of CsdA at low temperatures was further confirmed by successful complementation of the csdA mutation. csdA and its putative native promoter, as predicted by BPROM (softberry, Inc., Mount Kisco, NY). were ...


Applied Microbiology and Biotechnology
Volume 93, Issue 4 , pp 1585-1599 DOI 10.1007/s00253-011-3684-6

Isolation of a strong promoter fragment from endophytic Enterobacter cloacae and verification of its promoter activity when its host strain colonizes banana plants

Yu Guang Wang et al.,
1. Key Laboratory of Tropical Crop Biotechnology, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou, 571101, People’s Republic of China 2. Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, 571737, People’s Republic of China

... Promoters were predicted with Neural Network Promoter Prediction (NNPP) v2.2 (http://www.fruitfly.org/ index.html) and BPROM of SoftBerry (http://linux1.softberry. com/berry.phtml). Identification of primary promoter functional fragments of complex cloned ...


Antimicrob. Agents Chemother.
doi: 10.1128/?AAC.00846-12 October 2012 vol. 56 no. 10 5171-5179

Reduced Expression of the rplU-rpmA Ribosomal Protein Operon in mexXY-Expressing Pan-Aminoglycoside-Resistant Mutants of Pseudomonas aeruginosa

Calvin Ho-Fung Lau a, Sebastien Fraud a, Marcus Jones b, Scott N. Peterson b and Keith Poole a
aDepartment of Biomedical and Molecular Sciences, Queen's University, Kingston, Ontario, Canada bThe J. Craig Venter Institute, Rockville, Maryland, USA

... Intriguingly, the mutation upstream of this operon occurred within the putative ?10 Pribnow box of the only predicted promoter for rplU-rpmA (SoftBerry BPROM promoter prediction software; SoftBerry, Inc., Mount Kisco, NY), 135 bp upstream of the rplU start codon (TTGCCT ...


BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain 2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain

... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...


BMC Microbiology
2012, 12:226 doi:10.1186/1471-2180-12-226

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

Valeria C Caballero et al.,
1 Program of Microbiology and Mycology, Institute of Biomedical Science (ICBM), Faculty of Medicine, University of Chile, Santiago, Chile 2 Area of Biochemistry, Faculty of Dentistry, University of Chile, Santiago, Chile

... By mean of bioinformatics tools, including BPROM from the Softberry software package (http://linux1.softberry.com/berry.phtml), we identified those promoters in S. flexneri and included all three promoters in the constructs indicated in Figure 3A. ...


Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002

IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany 2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile

... to GenBank sequences. Additional searches for genes, operons, promoters, and terminators were done using FGENESB, BPROM, and FindTerm at www.softberry. com (Softberry, Mount Kisco, NY, USA). The sequence data ...


Microbiology.
2012 Jun;158(Pt 6):1581-92. doi: 10.1099/mic.0.055863-0. Epub 2012 Mar 1.

Vru (Sub0144) controls expression of proven and putative virulence determinants and alters the ability of Streptococcus uberis to cause disease in dairy cattle.

Egan SA, Ward PN, Watson M, Field TR, Leigh JA.
The School of Veterinary Medicine and Science, The University of Nottingham, Sutton Bonington, Leicestershire, UK.

... Sequence analysis of the intergenic and promoter regions of the genes sub0144 (vru) and sub0145 (lbp) was performed using Artemis (Rutherford et al., 2000) and bprom from Softberry sequence analysis tools (http://linux1.softberry.com/berry.phtml?topic=bprom&group ...


AMB Express
2:41 DOI 10.1186/2191-0855-2-41

Revelation of the ability of sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer

Nyok-Sean Lau (1) Kumar Sudesh (1)
1. Ecobiomaterial Research Laboratory, School of Biological Sciences, Universiti Sains Malaysia, Penang, 11800, Malaysia

... Center for Biotechnology Information) and ClustalW Multiple Sequence Alignment program (Thompson et al., 1994). The potential promoter regions recognized by Sigma factor D (?D) were predicted using prediction of bacterial promoters (BPROM) provided by Softberry Inc. ...


Antimicrob. Agents Chemother.
April 2012 vol. 56 no. 4 1698-1702 doi: 10.1128/AAC.06199-11

Novel Plasmid and Its Variant Harboring both a blaNDM-1 Gene and Type IV Secretion System in Clinical Isolates of Acinetobacter lwoffii

Hongyan Hu et al.,
aDepartment of Laboratory Medicine, The General Hospital of Chinese People's Armed Police Forces, Beijing, China bCAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

... constructing the phylogenetic tree. A multiple-sequence alignment was constructed using ClustalX version 1.8 (27). Promoter searches were performed by using Softberry's BPROM (Softberry Inc., Mt. Kisco, NY), PPP-Prokaryotic ...


Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1228-1236

Identification of an Enzyme System for Daidzein-to-Equol Conversion in Slackia sp. Strain NATTS

Hirokazu Tsujia, Kaoru Moriyamaa, Koji Nomotoa and Hideyuki Akazab
aYakult Central Institute for Microbiological Research, Kunitachi, Tokyo, Japan bSystems Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo, Japan

... For analysis of nucleotide sequences and amino acid sequences, DDBJ-BLAST (http://www.ddbj.nig.ac.jp/), BPROM (SoftBerry), GeneMark version 2.5 (http://opal.biology.gatech. edu/GeneMark/), FindTerm (SoftBerry), and PSORT (http://psort.ims.u-tokyo.ac.jp/) were used. ...


Applied Biochemistry and Biotechnology
September 2012 Online ISSN 1559-0291 DOI 10.1007/s12010-012-9889-z

Characterization of a Glycoside Hydrolase Family 1 b-Galactosidase from Hot Spring Metagenome with Transglycosylation Activity

Richa Gupta, Tanvi Govil, Neena Capalash, Prince Sharma
1. Department of Biotechnology, Panjab University, Chandigarh, 160014, India 2. Department of Microbiology, Panjab University, Chandigarh, 160014, India

... Motifs in the considered sequences were scanned using PROSITE [19]. N-terminal signal peptide analysis was done using Signal IP version 3.0 program [20], and the promoter was located using SoftBerry BPROM tool (http://www.soft berry.com/berry.html). ...


Antimicrob. Agents Chemother.
June 2012 vol. 56 no. 6 3392-3394

Functional Characterization of a Cassette-Specific Promoter in the Class 1 Integron-Associated qnrVC1 Gene

Erica Lourenco da Fonseca and Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, Brazil

... presence of internal cassette-specific promoters of aadA2 and qnrVC1 using four promoter prediction programs: Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html), BPROM (SoftBerry, http://linux1 ...


Journal of Biomedical Science and Engineering
Year: 2011 Volume: 04 Issue: 01 Pages: 70-75 DOI: 10.4236/jbise.2011.41009

Analysis of the arginine biosynthetic gene cluster argCJBDFR of Corynebacterium crenatum

Haitao Jiao, Yong Yuan, Yonghua Xiong, Xuelan Chen

... The sequence data were compiled, aligned and ana- lyzed using Lasergene software (DNASTAR), Soft- berry's BPROM (www.softberry.com) and RNAshapes WebServices (BiBiServ) et al. 3. RESULTS AND DISCUSSION 3.1. ...


Biologia
2011, vol. 66, no4, pp. 565-573

The role of TerW protein in the tellurite resistance of uropathogenic Escherichia coli

Valkovicova et al.,
(1) Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, SK-84215, Bratislava, Slovakia

... and cloning of a potential promoter se- quence The potential promoter rich region (PPRR) of the ter operon was determined with the help of the Neural Network Promoter Prediction software (http://www.fruitfly.org/ seq tools/promoter.html) and Softberry-BPROM software (http ...


Antonie van Leeuwenhoek
Volume 99, Issue 2 , pp 409-416 DOI: 10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz, Ireneusz Babiak, Waleria Hryniewicz
1. Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland 2. Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...


FEMS Microbiology Letters
314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x

ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis.

Marshall, S. H., Henriquez, V., Gomez, F. A. and Cardenas, C.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Facultad de Ciencias, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile 2 NBC, Nucleo de Biotecnologia Curauma, Curauma, Valparaiso, Chile

... sequencing by Macrogen Inc. (Korea). Sequence analysis. The DNA sequence data were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml) using the FgenesB and Bprom algorithms. FgenesB is a suite ...


J. Antimicrob. Chemother.
(2011) 66 (4): 797-801. doi: 10.1093/jac/dkr011

Pc promoter from class 2 integrons and the cassette transcription pattern it evokes

Erica Lourenco da Fonseca*, Fernanda dos Santos Freitas and Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Fundacao Oswaldo Cruz, Rio de Janeiro, RJ, Brazil

... The attI2 site sequence and the intI2* gene were submitted to four promoter predictor programs: Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html); BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml ...


J. Antimicrob. Chemother.
(2011) 66 (5): 1005-1012. DOI: 10.1093/jac/dkr041

Variation in the genetic environments of blaCTX-M-15 in Escherichia coli from the faeces of travellers returning to the United Kingdom

Dhanji et al.,
1Antibiotic Resistance Monitoring and Reference Laboratory, Health Protection Agency Microbiology Services – Colindale, 61 Colindale Avenue, London NW9 5EQ, UK 2North West London NHS Trust, Northwick Park Hospital, London HA1 3UJ, UK

... DNA sequences that did not contain published bla CTX-M promoters were analysed with 'SoftBerry BPROM' software. 23. A potential alternative promoter region (promoter X) was investigated by cloning and northern blotting. ...


BMC Genomics
2011, 12:282 doi:10.1186/1471-2164-12-282

Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

Oakley et al.,
1 Poultry Microbiological Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA 30605, USA 2 Department of Infectious Diseases & Center for Tropical and Emerging Global Diseases University of Georgia, Athens, GA 30306, USA

... The transcriptional regulation of these genes in our phages remains unknown, but searches for transcriptional promoters and terminators using BPROM (Softberry, Inc., Mount Kisco, NY, USA; http://linux1.softberry.com/berry.phtml webcite) and TransTerm (http://nbc3.biologie.uni ...


Biochem. J.
(2011) 433 (107–117) (Printed in Great Britain) doi:10.1042/BJ20101186

Escherichia coli glycogen genes are organized in a single glgBXCAP transcriptional unit possessing an alternative suboperonic promoter within glgC that directs glgAP expression

Montero et al.,
Agrobioteknologiako Instituta, Nafarroako Unibertsitate Publikoa and Consejo Superior de Investigaciones Cientificas, Mutiloako etorbidea zenbaki gabe, 31192 Mutiloabeti, Nafarroa, Spain

... Protein content was measured by the Bradford method using a Bio-Rad prepared reagent. Computer analyses. Promoters were predicted using the BPROM program (SoftBerry, http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Molecular Microbiology
(2011) 79: 1602–1614. doi: 10.1111/j.1365-2958.2011.07543.x

tRNA accumulation and suppression of the bldA phenotype during development in Streptomyces coelicolor.

Pettersson, B. M. F. and Kirsebom, L. A.
Department of Cell and Molecular Biology, Box 596, Biomedical Centre, SE-751 24 Uppsala, Sweden.

...The Softberry BPROM promoter prediction software (http://linux1.softberry.com/berry.phtml) was used to predict the tRNAHisGUG and the known tRNALeuUAA transcription start sites, while the tRNALeuCAA transcription start site was manually predicted on the basis of similarity to Escherichia coli?70 promoters....


Antimicrob. Agents Chemother.
December 2011 vol. 55 no. 12 5850-5860 doi: 10.1128/AAC.00498-11

Fluoroquinolone Efflux in Streptococcus suis Is Mediated by SatAB and Not by SmrA

Escudero et al.,
1Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spain 2Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spain

... Promoter sequence analysis was performed with Bprom (Softberry, Inc., Mount Kisco, NY). Protein modeling was done using Phyre server (23) and illustrated using the PyMOL molecular graphics system (version 1.3; Schrodinger, LLC). ...


Metallomics,
2011,3, 1009-1018 DOI: 10.1039/C1MT00127B

A novel nickel responsive MerR-like regulator, NimR, from Haemophilus influenzae

Kidd et al.,
School of Molecular and Biomedical Science, The University of Adelaide, North Terrace Campus, Adelaide, South Australia 5005, Australia.

... Our in silico analysis identified the promoter regions for each of these using BPROM (Softberry: www.softberry.com) and the likely MerR-like binding site .19 HI1623 is annotated as CadR, indicating that it is a cadmium responsive protein . ...


Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 361-363 doi: 10.1128/AAC.01672-09

A Novel Insertion Sequence, ISAba10, Inserted into ISAba1 Adjacent to the blaOXA-23 Gene and Disrupting the Outer Membrane Protein Gene carO in Acinetobacter baumannii

Lee et al.,
1Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752, South Korea 2Korean Institute of Tuberculosis, 14 Woomyun-dong, Seocho-gu, Seoul 137-900, South Korea

... additional promoter sequences to the bla OXA-23 gene. Analyses using the online tool BPROM (Softberry, Inc., Mount Kisco, NY) suggested the presence of a putative promoter within the ISAba10 element (Fig. 1). View this table ...


Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142

Complete genome sequence of the lytic Pseudomonas fluorescens phage fjIBB-PF7A

Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga, Portugal

... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/ tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly. org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ... ...Terminators were predicted using FindTerm http://linux1.softberry. com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...


Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1460-1469 doi: 10.1128/AAC.01094-10

Role of VltAB, an ABC Transporter Complex, in Viologen Tolerance in Streptococcus mutans

Saswati Biswas and Indranil Biswas
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Centre, Kansas City, Kansas 66160

... In silico analysis by BPROM software (Softberry, Inc.) indicates that this region contains a weak promoter-like sequence (?10 box [TATATT] at position 362), indicating that vltAB may be transcribed separately from SMU.902. ...


Antimicrob. Agents Chemother
December 2011 vol. 55 no. 12 5942-5945 doi: 10.1128/AAC.05142-11

Quinolone Induction of qnrVS1 in Vibrio splendidus and Plasmid-Carried qnrS1 in Escherichia coli, a Mechanism Independent of the SOS System

Okumura et al.,
1Division of Infectious Diseases, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 2 Biological Research Laboratories, Daiichi Sankyo Co., Ltd., Tokyo, Japan

... host (Table 3), we amplified by PCR (primer pairs in Table 4) and cloned a 1,011-bp BamHI-EcoRI fragment containing qnrVS1, 258 bp of upstream sequence, including the potential native promoter sequence (bacterial promoter prediction program from Softberry), and 85 bp of ...


Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050

The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay

Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening of serotype-specific gene. Cross-hybridization experiments ...


FEMS Microbiology Letters
(2011), 323: 97–104. doi: 10.1111/j.1574-6968.2011.02365.x

The copper responding surfaceome of Methylococccus capsulatus Bath

Karlsen, O. A., Larsen, O., Jensen, H. B.
1Department of Molecular Biology, University of Bergen, Norway 2UNI Research, Bergen, Norway

... b Predicted upstream promoter using bprom (http://linux1.softberry.com/all.htm) or promscan (http://molbiol-tools.ca/promscan/) promotor prediction software. c (Y, yes) or (N, no) indicates if the encoding gene is part of an operon structure. ...


Infect. Immun.
January 2011 vol. 79 no. 1 342-352 doi: 10.1128/IAI.00736-10

Characterization of a Staphylococcus aureus Surface Virulence Factor That Promotes Resistance to Oxidative Killing and Infectious Endocarditis

Malachowa et al.,
1Department of Microbiology, Molecular Biology, and Biochemistry, University of Idaho, Moscow, Idaho 83844 2Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland

... The BPROM program (Softberry, Inc., Mount Kisco, NY) was used to predict bacterial promoter. DNA isolation.Genomic DNA was isolated by using Genomic DNA Prep Plus kits (A&A Biotechnology, Gdynia, Poland) facilitated by a method to promote S. aureus lysis (41). ...


Applied Microbiology and Biotechnology
Volume 90, Issue 1 , pp 159-172 DOI: 10.1007/s00253-010-3028-y

Discovery and characterization of d-phenylserine deaminase from Arthrobacter sp. TKS1

Muramatsu et al.,
1. Multidisciplinary Science Cluster, Research and Education Faculty, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan 2. Graduate School of Integrated Arts and Sciences, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan

... Institute (Finn et al. 2008). The prediction of the bacterial promoter was performed with the BPROM software at SoftBerry (http:// linux1.softberry.com/berry.phtml). Nucleotide sequence accession number The nucleotide sequence ...


World Journal of Microbiology and Biotechnology
Volume 27, Issue 2 , pp 431-441 DOI: 10.1007/s11274-010-0475-7

Gene cloning, expression and characterization of a cold-adapted lipase from a psychrophilic deep-sea bacterium Psychrobacter sp. C18

Ruipeng Chen, Lizhong Guo, Hongyue Dang
1. College of Life Sciences, Qingdao Agricultural University, 266109, Qingdao, China 2. State Key Laboratory of Heavy Oil Processing and Centre for Bioengineering and Biotechnology, China University of Petroleum (East China), 266555, Qingdao, China

... version 2.0; Larkin et al. 2007). The upstream regulatory sequence signatures of the putative lipase genes were analyzed using the online BPROM program (http://linux1. softberry. com/berry.phtml?topic=index&group=programs&subgroup ...


International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019

Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus

Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... Presence of putative promoters, terminators and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter. html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...


Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 118-123 doi: 10.1128/AAC.01062-10

Metallo-b-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait

Thaller et al.,
1Dipartimento di Biologia, Universita di Roma “Tor Vergata,” I-00133 Rome, Italy 2Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy

... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version 3.0). Putative promoter sequences were detected using Bprom software (Softberry, Inc., Mount Kisco, NY). Nucleotide sequence accession ...


BioData Mining
2011, 4:22 http://www.biodatamining.org/content/4/1/22

Detection of putative new mutacins by bioinformatic analysis using available web tools

Guillaume G Nicolas
Departement de Biochimie Microbiologie et Bioinformatique, Faculte des Sciences et Genie, Universite Laval, Quebec (Quebec), G1K7P4, Canada

... Upstream genomic coding sequence was analyse to detect putative promoter regions and transcription factor binding sites using the bacterial promoter recognition program BPROM (Softberry inc.) (Figure 2). Many putative mutacin-encoding genes have been previously ...


Appl. Environ. Microbiol.
January 2011 vol. 77 no. 1 281-290 doi: 10.1128/AEM.01403-10

Ethanolamine Utilization Contributes to Proliferation of Salmonella enterica Serovar Typhimurium in Food and in Nematodes

Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

... The home pages for NCBI and Microbes Online were used to determinate the distribution of the pdu and eut clusters in different serotypes of S. enterica. Promoter sequences located upstream of the genes identified were predicted with BPROM (Softberry). ...


J. Bacteriol.
October 2011 vol. 193 no. 19 5300-5313 doi: 10.1128/JB.05287-11

Genomes and Characterization of Phages Bcep22 and BcepIL02, Founders of a Novel Phage Type in Burkholderia cenocepacia

Jason J. Gill et al.,
1Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843-2128 2Center for Phage Technology, Texas A&M University, College Station, Texas 77843-2128

... Protein sequences were compared to the NCBI protein database by using BLASTp (9); tRNA genes were detected with tRNAscan (68); rho-independent terminators were detected with TransTerm HP (37); promoters were detected using BPROM (Softberry). ...


Infection, Genetics and Evolution
Volume 11, Issue 6, August 2011, Pages 1352–1360 DOI: 10.1016/j.meegid.2011.04.029,

Pseudomonas entomophila and Pseudomonas mendocina: Potential models for studying the bacterial type VI secretion system

Panagiotis F. Sarris a, b, Effie V. Scoulica b
a Department of Biology, University of Crete, P.O. Box 2208, 71409 Heraklion, Greece b Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, School of Medicine, University of Crete, 71409 Heraklion, Greece

.. Thereby, in order to identify T6SS gene clusters potentially controlled by sigma factors we performed a survey using the BPROM algorithm (www.softberry.com). ... The sequences were used for analysis by the BPROM algorithm (www.softberry.com) (Table S1). ...


Appl. Environ. Microbiol.
March 2011 vol. 77 no. 5 1608-1618 doi: 10.1128/AEM.01862-10

Identification and Characterization of Novel and Potent Transcription Promoters of Francisella tularensis

Zaide et al.,
Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, P.O. Box 19, Ness Ziona 74100, Israel

... Computational analysis of promoter elements.The sequences of all the unique promoter clone DNA inserts were subjected to regulatory element analysis using the BPROM bacterial promoter prediction program (Softberry). ...


Antimicrob. Agents Chemother.
February 2011 vol. 55 no. 2 917-920 doi: 10.1128/AAC.00491-10

SAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii

Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina

... The ?35 and ?10 motifs inferred for each of the different promoters are boxed, and the transcription initiation site (G in bold) resulting from the hybrid promoter (as determined by 5? RACE-PCR) is indicated by +1. Promoter prediction was done using BPROM (SoftBerry). ...


BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198

Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny

Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden

... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70- promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...


J Proteomics Bioinform
4: 179-183. doi:10.4172/jpb.1000187

Bacillus clausii and Bacillus halodurans lack GlnR but Possess Two Paralogs of glnA

Farazmand A, Yakhchali B, Shariati P, Ofoghi H
1Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), 15815-3538, Tehran, Iran 2Department of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), 14965-161 Tehran, Iran

...the bacterial promoter prediction program, BPROM (www.softberry.com/berry.html) was used. ...


PLoS ONE
(2011) 6(3): e18197. doi:10.1371/journal.pone.0018197

Identification of a Cryptic Prokaryotic Promoter within the cDNA Encoding the 5? End of Dengue Virus RNA Genome.

Li D, Aaskov J, Lott WB
Infectious Diseases Program, Institute of Health and Biomedical Innovation (IHBI), Queensland University of Technology, Brisbane, Australia

... The BPROM promoter prediction program (SoftBerry, Mount Krisco, NY) identified potential ?35 and ?10 bacterial promoter elements at DENV2 cDNA nt positions 53 (TCAACG) and 72 (TTTTTAAT), respectively, which share sequence homology with the wild type E. coli ...


J. Bacteriol.
December 2011 vol. 193 no. 24 6824-6833 doi: 10.1128/JB.05492-11

Mycobacterium smegmatis RoxY Is a Repressor of oxyS and Contributes to Resistance to Oxidative Stress and Bactericidal Ubiquitin-Derived Peptides

Aaron Daugherty, Katelyn M. Powers, Melissa S. Standley, Cathy S. Kim and Georgiana E. Purdy
Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, Oregon 97239

... (D) A diagram of the roxY promoter as well as the homologous synthetic oligonucleotides. The bent arrow denotes the putative transcription start site and the black boxes the putative ?10 and ?35 regions, respectively, as predicted by Bprom (Softberry, Inc.). ...


BMC Microbiology
2011, 11:259 doi:10.1186/1471-2180-11-259

The small heat shock proteins from Acidithiobacillus ferrooxidans: gene expression, phylogenetic analysis, and structural modeling

Ribeiro et al.,
1 Center for Molecular Biology and Genetic Engineering (CBMEG), State University of Campinas - UNICAMP, Candido Rondon Avenue 400, 13083-875 - Campinas, SP, Brazil 2 National Biosciences Laboratory (LNBio), National Laboratory of Energy and Materials Research (CNPEM), Giuseppe Maximo Scolfaro Street 10000, 13083-970 - Campinas, SP, Brazil

... The alignment was edited with the GeneDoc program [15]. Prediction of the transcription start site was performed with BPROM software (Softberry, Inc.). A widely accepted theoretical informational approach was adopted to identify potential ? 32 sites [16,17]. ...


Applied Microbiology and Biotechnology
Volume 90, Issue 6 , pp 1963-1971 DOI: 10.1007/s00253-011-3203-9

Characterization of a gene cluster and its putative promoter region for violacein biosynthesis in Pseudoalteromonas sp. 520P1

Xi Zhang, Keiichi Enomoto
1. Department of Environmental Systems Engineering, Kochi University of Technology, 185 Miyanokuchi, Tosayamada, Kami, Kochi, 782-8502, Japan

... 2008), was obtained by PCR using primers 520P1-before-vioA-Fw2 and 520P1-vioA- Rv1. Promoter prediction was performed with BPROM software (SoftBerry, Mount Kisco, NY, USA). Cloning and expression of the violacein gene cluster ...


Appl. Environ. Microbiol.
July 2011 vol. 77 no. 14 4802-4810 doi: 10.1128/AEM.05149-11

Cholesterol Degradation by Gordonia cholesterolivorans

O. Drzyzga 1, L. Fernandez de las Heras 1, V. Morales 2, J. M. Navarro Llorens 1 and J. Perera 1
1Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain 2Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), 28040 Madrid, Spain

... Putative promoters were analyzed by using the Neural Network Promoter Prediction (NNPP), Promscan, and BPROM programs (http://www.fruitfly.org/seq_tools/promoter.html, http://molbiol-tools.ca/promscan/, and http://linux1.softberry.com/berry.phtml, respectively), in ...


Iranian Journal of Microbiology
2011;3(1) : 13-20

The influence of riboflavin and nicotinic acid on Shigella sonnei colony conversion

Dr. Bagher Yakhchali
National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e-Pajoohesh, km 15, Tehran-Karaj Highway, Tehran, Iran.

... CP000038) and analyzed by “Virtual Footprint Online Software” for the presence of OxyR binding site (19) and by online software “BPROM - Prediction of bacterial promoters of Softberry” for promoter prediction. All primers were analyzed by in silico simulation of PCR (20). ...


J. Bacteriol.
February 2011 vol. 193 no. 3 611-619 doi: 10.1128/JB.01185-10

The Three Vibrio cholerae Chromosome II-Encoded ParE Toxins Degrade Chromosome I following Loss of Chromosome II

Jie Yuan ,2,3, Yoshiharu Yamaichi 1, and Matthew K. Waldor 1,2
1Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School 2HHMI

... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM (Softberry, Inc., Mount Kisco, NY) suggested that, in addition to the expected ParD promoters, P parD1 and P parD2 , the parE genes might have their own promoters, P parE1 and P parE2 . ...


Proc. R. Soc.
January 2011 vol. 278 no. 1702 115-121 DOI: 10.1098/rspb.2010.1304

Sources of variation in dietary requirements in an obligate nutritional symbiosis

Kevin J. Vogel* and Nancy A. Moran
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA

... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a coding region, although none was found in a ?10/?35 promoter region as identified by BPROM (http://www.softberry.com), suggesting that these mutations have no effect on gene ...


Front Microbiol.
2011; 2: 147. DOI: 10.3389/fmicb.2011.00147

Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria

Techtmann et al.,
1Institute of Marine and Environmental Technology, University of Maryland, Baltimore, MD, USA 2Department of the Geophysical Sciences, University of Chicago, Chicago, IL, USA

... These sequences were run through the bprom program (http://softberry.com) to predict the putative -10 and -35 sites. From this prediction, primers were designed to create a product that started at the putative -150 site and stretched to start codon. ...


J. Bacteriol.
May 2011 vol. 193 no. 9 2158-2167 DOI: 10.1128/JB.00029-11

Regulation of Type VI Secretion Gene Clusters by ?54 and Cognate Enhancer Binding Proteins

Christophe S. Bernard, Yannick R. Brunet, Marthe Gavioli, Roland Lloubes and Eric Cascales
Laboratoire d'Ingenierie des Systemes Macromoleculaires Institut de Microbiologie de la Mediterranee Aix-Marseille Universite CNRS—UPR9027, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France

... RESULTS. Identification of ? 54 binding boxes.To identify T6SS gene clusters potentially controlled by ? 54 , we performed a survey using the BProm algorithm (SoftBerry). The putative ? 54 -dependent T6SS promoter list includes ...


AEM
Published ahead of print 18 November 2011, doi: 10.1128/AEM.07480-11

Genomic and functional analysis of the IncP-1b plasmids pWDL7::rfp and pNB8c explains their role in chloroaniline catabolism

Krol et al.,
1Department of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, PO Box 443051, Moscow, ID 83844-3051,U.S.A. 2Department of Microbiology, University of California, Davis, One Shields Avenue, Davis, CA 95616, U.S.A.

... with identity scoring by ClustalW. The pdca promoter region was analyzed using BPROM 154 (Softberry Inc., Mount Kisco, NY). 155 To infer the phylogenetic relationships of various IncP-1 plasmids, the deduced amino 156 ...


Archives of Microbiology
Volume 193, Issue 9 , pp 641-650 DOI: 10.1007/s00203-011-0705-x

Genomic analysis of the phenylacetyl-CoA pathway in Burkholderia xenovorans LB400

Patrauchan et al.,
1. Department of Microbiology and Immunology, University of British Columbia, Vancouver, BC, V6T 1Z3, Canada 2. Department of Microbiology and Molecular Genetics, Oklahoma State University, 307 LSE, Stillwater, OK, 74075, USA

... 2001) was used to search for conserved domains and motifs and to validate predicted gene function. Potential promoter regions were calculated using BPROM software (www.softberry.com) for paa genes using the gene sequence with a 100-bp upstream fragment. ...


Microbiological Research
Volume 166, Issue 5, 20 July 2011, Pages 403–418 DOI: 10.1016/j.micres.2010.05.003

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014

Fernandez de Las Heras L, Mascaraque V, Garcia Fernandez E, Navarro-Llorens JM, Perera J, Drzyzga O.
a Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain b Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, 28040 Madrid, Spain

... Putative prokaryotic promoters were analysed by the Neural Network Promoter Prediction (NNPP) server (http://www.fruitfly.org/seq_tools/promoter.html) (Reese et al., 1996), Promscan server (http://molbiol-tools.ca/promscan/) and Bprom server (http://linux1.softberry.com/berry ...


J. Bacteriol.
May 2011 vol. 193 no. 9 2312-2321 DOI: 10.1128/JB.01355-10

Partial Functional Replacement of CymA by SirCD in Shewanella oneidensis MR-1

Carmen D. Cordova 2, Marcus F. R. Schicklberger 2,#, Yang Yu 2 and Alfred M. Spormann 1,2
1 Departments of Chemical Engineering 2 Civil & Environmental Engineering, Stanford University, Stanford, California

... coli based) (http://www.prodoric.de/vfp/) (29). The BPROM bacterial promoter predictor was used to identify entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco, NY). E. coli-based predictions were deemed suitable ...


Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166

Antisense RNA associated with biological regulation of a restriction–modification system

Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences

... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator prediction were performed using the BPROM and FindTerm software, respectively (http://www.softberry.com/all.htm). RNA secondary structure ...


Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921

The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1

YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture

... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the & independent terminators were predicted using the BPROM and the FindTerm program respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...


PLoS Genet
(2011), 7(11): e1002349. doi:10.1371/journal.pgen.1002349

Attenuation of the Sensing Capabilities of PhoQ in Transition to Obligate Insect–Bacterial Association.

Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C
Department of Biology, University of Utah, Salt Lake City, Utah, United States of America Department of Biological Sciences, Institute of Tropical Medicine, Antwerp, Belgium

... PhoP boxes (inverted text) and putative ribosomal binding site (bold) were identified by visual inspection of the promoter regions. Putative -35 and -10 regions (underlined) were identified using the online BPROM tool (SoftBerry, Inc.). doi:10.1371/journal.pgen.1002349.g004. ...


Archives of Microbiology
Volume 193, Issue 4 , pp 263-274 DOI: 10.1007/s00203-010-0669-2

Two promoters and two translation start sites control the expression of the Shigella flexneri outer membrane protease IcsP

Hensley et al.,
1. School of Life Sciences, University of Nevada, 4505 Maryland Parkway, Las Vegas, NV, 89154-4004, USA 2. Department of Molecular Biology, University of Wyoming, Laramie, WY, 82071, USA

... To identify putative promoter sequences, the intergenic region upstream of icsP was entered into the BPROM program for prediction of promoters regulated by the r70 subunit of RNA polymerase (http://www.linux1. softberry.com). ...


Molecular Microbiology
(2011), 80: 1260–1275. doi: 10.1111/j.1365-2958.2011.07641.x

Antagonistic regulation of dgkA and plsB genes of phospholipid synthesis by multiple stress responses in Escherichia coli.

Wahl, A., My, L., Dumoulin, R., Sturgis, J. N. and Bouveret, E.
LISM, CNRS, Aix-Marseille University, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France.

... ?E-dependent promoter. We ran a search on the dgkA-plsB intergenic sequence for a putative promoter using a set of bioinformatic servers and got a low hit using BPROM (http://www.softberry.com/berry.phtml). A +1 transcription ...


Journal of Bioscience and Bioengineering
Volume 112, Issue 5, November 2011, Pages 422–431 DOI: 10.1016/j.jbiosc.2011.07.020

Molecular cloning and characterization of two inducible NAD+-adh genes encoding NAD+-dependent alcohol dehydrogenases from Acetobacter pasteurianus SKU1108

Uraiwan Masud 1, Kazunobu Matsushita 2, Gunjana Theeragool 1, 3
1 Interdisciplinary Graduate Program in Genetic Engineering, The Graduate School, Kasetsart University, Bangkok 10900, Thailand, 2 Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi University, Yamaguchi 753–8515, Japan,

... Based on the E. coli sigma 70 promoter recognition program (BPROM tool of Softberry), the predicted ? 35 and ? 10 sequences of sigma 70, TTTATT and TGTTTGTAAAAT, were located from the 961st to 966th and 976th to 987th nucleotide (nt) of the adhI gene, respectively. ...


J. Bacteriol.
May 2011 vol. 193 no. 10 2575-2586 doi: 10.1128/JB.00217-11

Transcription Antitermination by a Phosphorylated Response Regulator and Cobalamin-Dependent Termination at a B12 Riboswitch Contribute to Ethanolamine Utilization in Enterococcus faecalis

Kris Ann Baker and Marta Perego
The Scripps Research Institute, Department of Molecular and Experimental Medicine, La Jolla, California 92037

... In order to determine whether the promoter activity in the eutT-eutG intergenic region was upstream or downstream from the riboswitch, the sequence of the eutT-eutG intergenic region was analyzed with the Softberry BPROM program. ...


J. Bacteriol.
May 2011 vol. 193 no. 10 2536-2548 doi: 10.1128/JB.00815-10

Identification of ArgP and Lrp as Transcriptional Regulators of lysP, the Gene Encoding the Specific Lysine Permease of Escherichia coli

Jimena Ruiz ‡, Ina Haneburger and Kirsten Jung
Ludwig-Maximilians-Universitat Munchen, Munich Center for integrated Protein Science (CiPSM) at the Department of Biology I, Microbiology, Grosshaderner Strasse 2-4, 82152 Martinsried, Germany

... Predicted ?35 and ?10 promoter motifs (BProm; http://linux1.softberry.com/berry.phtml? topic=bprom&group=help&subgroup=gfindb) and the start of transcription (position +1) previously identified by primer extension analysis (32) are indicated. ...


Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1638-1649 doi: 10.1128/AAC.01366-10

Mutational Analysis of the Thienamycin Biosynthetic Gene Cluster from Streptomyces cattleya

Rodriguez et al.,
Departamento de Biologia Funcional e Instituto Universitario de Oncologia del Principado de Asturias, Universidad de Oviedo, 33006 Oviedo, Spain

... operon thnKJI. Other putative promoter sequences have also been identified for the ThnI-independent genes (Fig. 1C) by the use of the BPROM bacterial promoter prediction server (Softberry Inc., Mount Kisco, NY). Upstream of ...


J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11

A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550

Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland 2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy

... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique terminator region downstream of TTHA1327 were identified using BPROM and FindTerm (Softberry), respectively. Those findings showed that ...


BMC Genomics
2011, 12:479 doi:10.1186/1471-2164-12-479

Single-nucleotide resolution analysis of the transcriptome structure of Clostridium beijerinckii NCIMB 8052 using RNA-Seq

Yi Wang 1,2, Xiangzhen Li 3, Yuejian Mao 3 and Hans P Blaschek 2,4,5
1 Department of Agricultural and Biological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA 2 Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA

... A prediction of the promoters for primary sigma factors for all the putative HKGs was carried out using BPROM (http://linux1.softberry.com/berry.phtml webcite). ...


FEMS Microbiology Letters
(2011), 325: 56–63. doi: 10.1111/j.1574-6968.2011.02416.x

Genetic analysis of the pnp–deaD genetic region reveals membrane lipoprotein NlpI as an independent participant in cold acclimatization of Salmonella enterica serovar Typhimurium

Rouf, S. F., Anwar, N., Clements, M. O. and Rhen, M.
BGI

.. Although S. Typhimurium pnp and nlpI are separated by 109 base pairs, the promoter prediction software bprom (www.Softberry.com) failed to define any tentative nlpI promoter within this intergenic region (data not shown). ...


Applied Microbiology and Biotechnology
Volume 90, Issue 2 , pp 625-634 DOI: 10.1007/s00253-011-3121-x

Co-transcription of the celC gene cluster in Clostridium thermocellum

Michael Newcomb, Jonathan Millen, Chun-Yu Chen, J. H. David Wu
1. Department of Chemical Engineering, University of Rochester, Room 206 Gavett Hall, Rochester, NY, 14627-0166, USA 2. Novozymes North America Inc., 77 Perry Chapel Church Road, Franklinton, NC, 27525, USA

... The palindromic GlyR3 binding site (Newcomb et al. 2007) is bolded. The ?10 and ?35 sigma factor binding sites predicted by BProm (http:// linux1.softberry.com/berry. phtml, accessed 3 January 2011) are noted by a solid and a dashed box, respectively 630 ...


BMC Microbiology
2011, 11:90 doi:10.1186/1471-2180-11-90

Integration Host Factor (IHF) binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

Arvizu-Gomez et al.,
1 Departamento de Ingenieria Genetica, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional Unidad Irapuato, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico 2 Laboratorio Nacional de Genomica para la Biodiversidad, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico

...we evaluated the presence of putative cis-acting elements within the phtD promoter region using a transcription factor search program (BPROM, http://www.softberry.com webcite) [26]....


The Journal of Biological Chemistry
November 11, 2011 , 286, 38854-38864, doi: 10.1074/jbc.M111.260992

Identification of a Novel Streptococcal Adhesin P (SadP) Protein Recognizing Galactosyl-a1–4-galactose-containing Glycoconjugates

Kouki et al.,
‡Department of Medical Biochemistry and Genetics, University of Turku, Kiinamyllynkatu 10, Turku FI-20520, Finland, the ?Department of Biosciences, Division of Biochemistry and Biotechnology, University of Helsinki, P.O.B. 56, Helsinki FI-00014, Finland,

... terminators. SadP was not located in an operon, and promoter sequences typical for Gram-positive bacteria upstream of the gene and a Rho-independent terminator were predicted using the program Bprom on the Softberry server. ...


BMC Microbiology
2011, 11:72 doi:10.1186/1471-2180-11-72

Contribution of SecDF to Staphylococcus aureus resistance and expression of virulence factors

Quiblier et al.,
1 Institute of Medical Microbiology, University of Zurich, Gloriastr. 32, 8006 Zurich, Switzerland 2 Division of Infectious Diseases and Hospital Epidemiology, University Hospital Zurich, University of Zurich, Raemistr. 100, 8091 Zurich, Switzerland

...Promoter predictions were performed by BPROM http://linux1.softberry.com/berry.phtml...


J. Bacteriol.
July 2011 vol. 193 no. 13 3207-3219 doi: 10.1128/JB.00044-11

The Anaerobe-Specific Orange Protein Complex of Desulfovibrio vulgaris Hildenborough Is Encoded by Two Divergent Operons Coregulated by ?54 and a Cognate Transcriptional Regulator

Fievet et al.,
1Laboratoire Interactions et Modulateurs de Reponses, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France 2Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France

. lactate/sulfate conditions. To characterize the cis elements required for transcription of the orp1 and orp2 operons, in silico analyses were carried out using the Softberry (BProm) and PromScan algorithms. These analyses predicted ...


Appl. Environ. Microbiol.
May 2011 vol. 77 no. 9 2823-2830 doi: 10.1128/AEM.02633-10

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502

Selby et al.,
1Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland 2Center for Biomolecular Sciences, University of Nottingham, Nottingham, United Kingdom

... However, using the bacterial sigma70 promoter recognition software BPROM freeware (Softberry, Mount Kisco, NY), only one promoter with a ? A binding site was predicted upstream of the groE operon of C. botulinum strain ATCC 3502. ...


Eukaryotic Cell
December 2011 vol. 10 no. 12 1670-1678 doi: 10.1128/EC.05043-11

Novel Shuttle Markers for Nuclear Transformation of the Green Alga Chlamydomonas reinhardtii

Laurence Meslet-Cladiere† and Olivier Vallon
Centre National de la Recherche Scientifique, Unite Mixte de Recherche 7141/Universite Pierre et Marie Curie, Institut de Biologie Physico-Chimique, Paris 75005, France

... As analyzed using the program BPROM (SoftBerry), the sequence upstream of the CDS, which by and large corresponds to the first intron of RBCS2, appears to contain a reasonably strong bacterial promoter (score of 2.93 versus 2.85 for the bla promoter and 5.91 for the ...


PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108

Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence

Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611

...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the BProm and TermFind/RNAFold programs (Softberry)....


BMC Plant Biology
2011, 11:64 doi:10.1186/1471-2229-11-64

Evolution of the rpoB-psbZ region in fern plastid genomes: notable structural rearrangements and highly variable intergenic spacers

Lei Gao 1, Yuan Zhou 1, Zhi-Wei Wang 1, Ying-Juan Su 2* and Ting Wang 1
1 CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China 2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, China

...The putative promoters were identified by running BPROM [43]....


mBio
doi: 10.1128/mBio.00045-11 3 May 2011 vol. 2 no. 3 e00045-11

Hypervirulent Chlamydia trachomatis Clinical Strain Is a Recombinant between Lymphogranuloma Venereum (L2) and D Lineages

Somboonna et al.,
Center for Immunobiology and Vaccine Development, Children’s Hospital Oakland, Research Institute, Oakland, California, USAa; Health Sciences Research Institute and School of Natural Sciences, University of California, Merced, Merced, California, USAb;

...The L2c consensus chromosome and plasmid sequences were annotated automatically using the Integrative Services for Genomics Analysis pipeline (16). Promoter 2.0 prediction (http://www.cbs.dtu.dk/services/Promoter/), Bacterial PROMoter prediction (http://www.softberry.ru/berry.phtml), and ...


(2011), Molecular Microbiology
81: 1271–1285. doi: 10.1111/j.1365-2958.2011.07760.x

Multimodal dynamic response of the Buchnera aphidicola pLeu plasmid to variations in leucine demand of its host, the pea aphid Acyrthosiphon pisum.

Vinuelas et al.,
UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Bat. Louis Pasteur, 20 av. Albert Einstein, F-69621 Villeurbanne, France

...putative promoters via the BPROM promoter prediction tool (http://linux1.softberry.com/berry.phtml?topic=gfindb);...


Front Microbiol.
2011; 2: 51. DOI: 10.3389/fmicb.2011.00051

Regulation of Dissimilatory Sulfur Oxidation in the Purple Sulfur Bacterium Allochromatium Vinosum

Frauke Grimm, 1 Bettina Franz, 1,† and Christiane Dahl
Institut fur Mikrobiologie und Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Bonn, Germany

...Promoter prediction for prokaryotic sequence was achieved with Neural Network Promoter Prediction1 and BPROM 2. ...


The Journal of Infectious Diseases
2010;201:414–419

Protein E of Haemophilus influenzae Is a Ubiquitous Highly Conserved Adhesin

Birendra Singh,1 Marta Brant,1 Mogens Kilian,3 Bjorn Hallstrom,2 and Kristian Riesbeck1
1Medical Microbiology, Department of Laboratory Medicine, University Hospital Malmo, Lund University, Malmo, and 2Department of Cell and Organism Biology, Division of Evolutionary Molecular Systematics, Lund University, Lund, Sweden

... DNA and pe promoter sequences were analyzed by ClustalW2 alignment and BPROM (Softberry), respectively. The interactive similarity matrix was prepared by EMBOSS Pairwise Alignment Algorithms (European Bioinformatics Institute). ...


Journal of Economic Entomology
Volume 103, Number 3, June 2010 , pp. 887-897(11)

Limited Endosymbiont Variation in Diuraphis noxia (Hemiptera: Aphididae) Biotypes From the United States and South Africa

Swanevelder, Z. H.; Surridge, A.K.J.; Venter, E.; Botha, A.-M.

... Structural Analysis. Bacterial promoters on the leucine plasmid were predicted with BPROM (http://softberry.com). ... The plasmids were screened for Rho-independent terminators using FindTerm (http://softberry.com). Plasmid Copy Numbers. ... 


Antimicrob. Agents Chemother.
doi:10.1128/AAC.01062-10

Metallo-{b}-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait

Thaller et al.,
Dipartimento di Biologia, Universita di Roma "Tor Vergata", I-00133 Rome, Italy; Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy

... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version 108 3.0). Putative promoter sequences were detected using the Bprom software at the 109 Softberry site (http://linux1.softberry.com/berry.phtml). 110 Nucleotide sequence accession number. ...


PLoS ONE
2010, 5(11): e15528. doi:10.1371/journal.pone.0015528

Activation of the SMU.1882 Transcription by CovR in Streptococcus mutans

Chong P, Chattoraj P, Biswas I
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, Kansas, United States of America

... 1A. Sequence analysis, confirmed using BPROM online software (Prediction of bacterial promoters, Softberry, http://linux1.softberry.com), indicates the presence of putative -35 (GTGAGT) and -10 (TATAAT) box motifs 151- and 127-bp, respectively, upstream of the putative start ... 


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

... Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ... 


Journal of Microbiology
doi:10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)  Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland (2)  Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ... 


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...


Journal of Microbiology
doi:10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)  Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland (2)  Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ... 


J Microbiol.
2010 Jun;48(3):318-24. Epub 2010 Jun 23.

Cel8H, a novel endoglucanase from the halophilic bacterium Halomonas sp. S66-4: molecular cloning, heterogonous expression, and biochemical characterization

Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, PR China.

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were predicted using FGENSB and BPROM (http://linux1.softberry.com/berry.phtml). ... Genes in the 3.3 kb DNA fragment were predicted using FGENSB in the softberry website. ... 


Nucl. Acids Res.
2010 Volume 38, Issue 22 Pp. 8196-8207 doi: 10.1093/nar/gkq709

Diversity and strength of internal outward-oriented promoters in group IIC-attC introns

Leon G, Quiroga C, Centron D, Roy PH
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec, Quebec, Canada.

... intron to the nucleotide opposite the start codon of the ORF encoding the IEP on the bottom strand, using the Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html) and BPROM (SoftBerry, http://linux1 ...


Journal of Bacteriology
April 2010, p. 2013-2019, Vol. 192, No. 7, doi:10.1128/JB.01085-09

Precise Excision of IS5 from the Intergenic Region between the fucPIK and the fucAO Operons and Mutational Control of fucPIK Operon Expression in Escherichia coli

Zhongge Zhang, Ming Ren Yen, and Milton H. Saier Jr.
Division of Biological Sciences, University of California at San Diego, La Jolla, California 92093-0116

... Using the SoftBerry BPROM program (http://linux1.softberry.com/berry.phtml?topic= bprom&group=programs&subgroup=gfindb), the same promoters were identified in the 13-bp deletion and the 7-bp insertion strains but not in the 1-bp insertion strain. ... 


Biochimie
Volume 92, Issue 8, August 2010, Pages 1003-1009, doi:10.1016/j.biochi.2010.04.018

The role of a 2-on-2 haemoglobin in oxidative and nitrosative stress resistance of Antarctic Pseudoalteromonas haloplanktis TAC125

Parrilli et al.,
a Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo, via Cinthia 4, 80126 Naples, Italy b Facolta di Scienze Biotecnologiche Universita di Napoli Federico II, Naples, Italy

... This plasmid contains the PSHAa0030 gene and its upstream region (237 bp long), in which the presence of a putative promoter sequence was predicted by SoftBerry BPROM – Prediction of bacterial promoters software (http://softberry.com/berry). As shown in Table 3 and Fig. ... 


Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10

Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9

Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2

... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc., 234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator 236 sequences using BPROM and FindTerm programs (Softberry Inc.). ... 


Infection and Immunity
January 2010, p. 413-422, Vol. 78, No. 1 doi:10.1128/IAI.00664-09

Human Platelets Recognize a Novel Surface Protein, PadA, on Streptococcus gordonii through a Unique Interaction Involving Fibrinogen Receptor GPIIbIIIa

Petersen et al.,
Department of Oral and Dental Science, University of Bristol, Lower Maudlin Street, Bristol BS1 2LY, United Kingdom,1 Molecular and Cellular Therapeutics, School of Pharmacy, Royal College of Surgeons in Ireland, Dublin 2, Ireland

... Putative promoters with –35 and –10 regions were identified with BPROM software available from Softberry (Mount Kisco, NY), and putative transcriptional terminator regions were identified with mfold (37). DNA manipulations. ... 


Microbiology
156 (2010), 211-219; DOI 10.1099/mic.0.032342-0

PssA is required for {alpha}-amylase secretion in Antarctic Pseudoalteromonas haloplanktis

Parrilli et al.,
1 Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy 2 Facolta di Scienze Biotecnologiche Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy

... This plasmid contains both the amy Ct gene and the DNA sequence encoding pssA and its upstream region (150 bp long), in which the presence of a putative promoter sequence was predicted (SoftBerry BPROM software: http://linux1.softberry.com/berry.phtml). ... 


Infect. Immun.
doi:10.1128/IAI.00736-10

Characterization of a Staphylococcus aureus surface virulence factor promoting resistance to oxidative killing and infectious endocarditis

Malachowa et al.,
Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland; Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institute of Health, Hamilton, MT, 59840, USA;

... server, hydrophobicity (ProtScale), and transmembrane topology (MEMSAT, The PSIPRED 99 Protein Structure Prediction Server). BPROM program (Softberry, Inc. Mount Kisco, NY, USA) 100 was used to predict bacterial promoter. 101 DNA isolation. ...


Microbiology
156 (2010), 128-138; DOI 10.1099/mic.0.032250-0

myo-Inositol transport by Salmonella enterica serovar Typhimurium

Carsten Kroger 1, Jurgen Stolz 2 and Thilo M. Fuchs 1
1 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85350 Freising, Germany 2 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Biochemie, Technische Universitat Munchen, Gregor-Mendel-Str. 2, D-85350 Freising, Germany

... negative species. Promoter sequences located upstream of the identified genes were predicted with BPROM (http://www.softberry.com/), and transmembrane domains with TOPCONS (http://topcons.cbr.su.se/). The cladogram ... 


FEBS Letters
Volume 584, Issue 21, Pages 4419-4425

A novel secreted metzincin metalloproteinase from Bacillus intermedius

Sabirova et al.,

... nlm.nih.gov) [23]. Promoter regions were identified using the BPROM program (http://www.softberry.com). Signal peptide was identified using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP). The coding region ...


Antimicrobial Agents and Chemotherapy
August 2010, p. 3107-3112, Vol. 54, No. 8 doi:10.1128/AAC.00128-10

Contribution of a Plasmid-Borne blaOXA-58 Gene with Its Hybrid Promoter Provided by IS1006 and an ISAba3-Like Element to b-Lactam Resistance in Acinetobacter Genomic Species 13TU

Chen et al.,
Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei,1 Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei,2, Taiwan

... and sequenced. The transcription start site was determined, and conserved motifs of promoter sequences were identified using the BPROM program (Softberry, Mount Kisco, NY). Transformation of recombinant plasmids. The ...


Applied and Environmental Microbiology
April 2010, p. 2500-2508, Vol. 76, No. 8 doi:10.1128/AEM.00666-09

Identification of the Biosynthetic Gene Cluster for 3-Methylarginine, a Toxin Produced by Pseudomonas syringae pv. syringae 22d/93

Braun et al.,
Institute of Microbiology, Microbial Phytopathology, University of Jena, Neugasse 25, 07743 Jena, Germany,1 Jacobs University Bremen, School of Engineering and Science, Campus Ring 1, 28759 Bremen, Germany,2

... ClustalX2 (28), and TreeViewX (20). Promoter site prediction was performed with BPROM software (Softberry Inc., Mount Kisco, NY). Cloning of the SAM-dependent methyltransferase MrsA. The SAM-dependent methyltransferase ... 


Appl. Environ. Microbiol.
doi:10.1128/AEM.01403-10

Ethanolamine utilization contributes to proliferation of Salmonella enterica serovar Typhimurium in food and in nematodes

Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

.. determinate the distribution of the pdu and eut clusters in different serotypes of S. enterica. 133 Promoter sequences located upstream of the identified genes were predicted with BPROM 134 (http://www.softberry.com/). 135 Construction of deletion mutants. ...


Environmental Microbiology
2010. 12: 105–117. doi: 10.1111/j.1462-2920.2009.02049.x

dentification and characterization of new LuxR/LuxI-type quorum sensing systems from metagenomic libraries

Hao, Y., Winans, S. C., Glick, B. R. and Charles, T. C.
1. Department of Biology, University of Waterloo, Waterloo, ON, Canada. 2. Department of Microbiology, Cornell University, Ithaca, NY, USA.

... examined. Using promoter prediction software BPROM (Softberry, Mt. Kisco, NY, USA) or SAK (Gordon et al., 2003), a possible ? 70 promoter was identified upstream of both the luxI QS6-1 and luxI QS10-1 regions. Possible ... 


INTERNATIONAL MICROBIOLOGY
2010 13:113-121 DOI: 10.2436/20.1501.01.116

Induction, structural characterization, and genome sequence of Lv1, a prophage from a human vaginal Lactobacillus jensenii strain

Rebeca Martin, 1 Susana Escobedo, 1 Juan E. Suarez1, 2
1Microbiology Unit, University Institute of Biotechnology, University of Oviedo, Oviedo, Spain. 2Institute of Dairy Products of Asturias-CSIC, Villaviciosa, Spain

... services/TMHMM-2.0/]. Sequences of the s70 pro- moter were identified using Bprom [http://www.softberry.com]. Putative ter- minator sequences were detected with the Terminator function of GCG (ver- sion 10.2). Putative tRNA ... 


Journal of Bacteriology
September 2010, p. 4337-4347, Vol. 192, No. 17 doi:10.1128/JB.00359-10

Complete Nucleotide Sequence of TOL Plasmid pDK1 Provides Evidence for Evolutionary History of IncP-7 Catabolic Plasmids

Yano et al.,
Department of Environmental Life Sciences, Graduate School of Life Sciences, Tohoku University, 2-1-1 Katahira, Sendai 980-8577,1 Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa 277-8561, Japan2

... helix, respectively. The putative transcriptional promoter and Rho-independent terminator were predicted using BPROM and FindTerm, respectively (Softberry). Nucleotide sequence accession number. Nucleotide sequence ... 


Journal of Microbiological Methods
Volume 83, Issue 2, November 2010, Pages 156-163 doi:10.1016/j.mimet.2010.08.004

Novel plasmid-based genetic tools for the study of promoters and terminators in Streptococcus pneumoniae and Enterococcus faecalis

Sofia Ruiz-Cruz a, Virtu Solano-Collado a, Manuel Espinosa a and Alicia Bravo , a,
a Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, Ramiro de Maeztu, 9. E-28040 Madrid, Spain

... A further analysis of the TpolA fragment using the BPROM prediction program (Softberry, Inc.) revealed a near-consensus 10 hexamer (TAgAAT) located 5 nucleotides downstream of the TpolA palindrome, as well as a near-consensus extended 10 element (TGTa) (see Fig. ... 


Infection and Immunity
March 2010, p. 1176-1184, Vol. 78, No. 3 doi:10.1128/IAI.01014-09

Haemophilus ducreyi SapA Contributes to Cathelicidin Resistance and Virulence in Humans

Mount et al.,
Departments of Microbiology and Immunology,1 Medicine,2 Pathology and Laboratory Medicine,3 Center for Immunobiology, Indiana University School of Medicine, 635 Barnhill Drive, Room MS 420, Indianapolis, Indiana 46202-5124 4

... the 5' end of the sapA clone. Using BPROM software (SoftBerry, Inc., Mount Kisco, NY), a putative promoter was identified starting 177 bp upstream of tyrR in an untranslated region. To place the putative promoter upstream of ... 


Microbiology
156 (2010), 764-773; DOI 10.1099/mic.0.034645-0

Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum

Frauke Grimm, Nadine Dobler and Christiane Dahl
Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany

... upstream of dsrA. Promoter prediction for prokaryotic sequence was achieved with Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) and BPROM (http://www.softberry.com/berry.phtml). RESULTS. ... 


Antimicrob. Agents Chemother.
2010 doi:10.1128/AAC.00491-10

ISAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii

Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale, and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina

... boxed, and the transcription initiation site (G in bold) resulting from the hybrid 8 promoter (as determined by 5? RACE-PCR) is indicated by +1. Promoter prediction was 9 done using BPROM, (http://linux1.softberry.com). The different ATG codons for 10 ...


J. Bacteriol.
2009 doi:10.1128/JB.01185-10

The three Vibrio cholerae chromosome II-encoded ParE toxins degrade chromosome I following loss of chromosome II

Jie Yuan, Yoshiharu Yamaichi, and Matthew K. Waldor
Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School, and HHMI and Immunology Program, Tufts University School of Medicine

... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM 15 (http://www.softberry. com/berry.phtml) suggested that in addition to the expected ParD 16 promoters, PparD1, and PparD2, the parE genes might have their own promoters, PparE1, and PparE2. 17 ...


Proc Biol Sci.
2011 Jan 7;278(1702):115-21. Epub 2010 Jul 28. doi: 10.1098/rspb.2010.1304

Sources of variation in dietary requirements in an obligate nutritional symbiosis

Vogel KJ, Moran NA.
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA

... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a coding region, although none was found in a ?10/?35 promoter region as identified by BPROM (http://www.softberry.com), suggesting that these mutations have no effect on gene ... 


BMC Microbiology
2010, 10:229 doi:10.1186/1471-2180-10-229

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

Esparza M, Cardenas JP, Bowien B, Jedlicki E, Holmes DS.
1 Center for Bioinformatics and Genome Biology, MIFAB, Fundacion Ciencia para la Vida and Depto. de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile 2 ICBM, Faculty of Medicine, University of Chile, Santiago, Chile

... Promoters of the ? 70 -type and rho- independent transcriptional stops were predicted for operons cbb1-4 using the programs BPROM (http://www.softberry.com) and Transterm [31], respectively. The organization of gene clusters in facultative and obligate autotrophs involved in ... 


BMC Microbiol.
2010 Jul 28;10:202.

Genetic and phenotypic diversity in Burkholderia: contributions by prophage and phage-like elements

Ronning et al.,
J Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA

... replication, and host lysis); (ii) promoter and terminator prediction analysis with BPROM (www. Softberry.com), PPP ( bioinformatics.biol.rug.nl/websoftware), PROMSCAN [35] or Promoter Prediction by Neural Network [36]; (iii) prediction of terminators with ... 


Antimicrobial Agents and Chemotherapy
October 2010, p. 4389-4393, Vol. 54, No. 10 doi:10.1128/AAC.00155-10

Overexpression of Resistance-Nodulation-Cell Division Pump AdeFGH Confers Multidrug Resistance in Acinetobacter baumannii

Sebastien Coyne, 1 Nicolas Rosenfeld, 1 Thierry Lambert, 1,2 Patrice Courvalin, 1* and Bruno Perichon 1
Institut Pasteur, Unite des Agents Antibacteriens, 75724 Paris Cedex 15,1 Centre d'Etudes Pharmaceutiques, Chatenay-Malabry, France2

... The HelixTurnHelix program (http://mobyle.pasteur.fr/) predicted the presence of a helix-turn-helix (HTH) DNA-binding motif between residues 11 and 32, typical of the LTTR family. Sequence analysis of the adeL-adeF intergenic region using BProm software (Softberry, Inc., ... 


J. Bacteriol.
2010 doi:10.1128/JB.00752-10

Radiation Desiccation Response Motif (RDRM) like sequences are involved in transcriptional activation of deinococcal ssb gene by ionizing radiation, but not by desiccation

Aman Kumar Ujaoney, Akhilesh A. Potnis, Pratiksha Kane, Rita Mukhopadhyaya, and Shree Kumar Apte

... 3a). In 179 silico analysis of 351 bp region upstream of ssb ORF using BPROM software 180 (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfin 181 db) predicted the putative -10 and -35 promoter like sequences, while manual sequence 182 ... 


Journal of Bacteriology
April 2010, p. 1965-1974, Vol. 192, No. 7 doi:10.1128/JB.01616-09

Analysis of the dbpBA Upstream Regulatory Region Controlled by RpoS in Borrelia burgdorferi

Zhiming Ouyang, Shayma Haq, and Michael V. Norgard
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas 75390

... When analyzing the 5' sequence upstream of the dbpBA operon using BPROM (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), a bacterial 70 promoter recognition program, a typical bacterial 70 promoter harboring canonical –10/–35 ... 


Bioscience, Biotechnology, and Biochemistry
Vol. 74 (2010) , No. 8 pp.1564-1571 doi:10.1271/bbb.100135

Effects of Depletion of RNA-Binding Protein Tex on the Expression of Toxin Genes in Clostridium perfringens

Kimihiro ABE 1), Nozomu OBANA 1) and Kouji NAKAMURA 1)
1) Graduate School of Life and Environmental Sciences, University of Tsukuba

... Putative A10 (AATTACTAT) and A35 (TTTAAA) sequences were detected by BPROM software (http://linux1.softberry.com) 46 and 68nt up- stream of the translational start codon respectively. These data also suggest that tex is monocistronically transcribed. ... 


Appl Microbiol Biotechnol.
2010 Mar;86(2):567-76. Epub 2009 Oct 21

Analysis of extracellular alginate lyase and its gene from a marine bacterial strain, Pseudoalteromonas atlantica AR06

Matsushima et al.,
National Research Institute of Fisheries Science, Fisheries Research Agency, 2-12-4 Fukuura, Yokohama, 236-8648, Japan.

... www. generunner.net/). The promoter motifs and N-terminal signal peptide sequences were predicted by the BPROM (http:// linux1.softberry.com/berry.phtml) and PSORT (http://psort. hgc.jp/) programs, respectively. Homology ... 


Journal of Bacteriology
July 2010, p. 3780-3787, Vol. 192, No. 14 doi:10.1128/JB.00161-10

Regulation of High-Affinity Iron Acquisition Homologues in the Tsetse Fly Symbiont Sodalis glossinidius

Runyen-Janecky LJ, Brown AN, Ott B, Tujuba HG, Rio RV
Department of Biology, University of Richmond, Richmond, Virginia 23173,1 Department of Biology, West Virginia University, Morgantown, West Virginia 265062

... are shown. The putative –10/–35 sequences and the transcriptional initiation sites, identified using BPROM (www.softberry.com), are shown as straight lines and asterisks above the DNA sequences, respectively. The putative ... 


ournal of Experimental Microbiology and Immunology (JEMI)
2010 Vol. 14: 74-78

Confirmation of Caspase-3-Like-Protease, Clp, in Pseudomonas aeruginosa as an Individually Regulated Gene and its Involvement in Healthy Colony Formation

wenn Farrell, Alexis Handley, Carol Lewis and Alexander Sio
Department of Microbiology and Immunology, UBC

... high homology. The putative operon PA4577-fklB gene sequence found in the Pseudomonas Genome Database V2 was searched using BPROM on www.softberry.com for promoter and manually searched for stop codons. The ... 


Infection and Immunity
June 2010, p. 2607-2619, Vol. 78, No. 6 Epub 2010 Apr 12. doi:10.1128/IAI.00134-10

Francisella tularensis dpyrF Mutants Show that Replication in Nonmacrophages Is Sufficient for Pathogenesis In Vivo

Horzempa J, O'Dee DM, Shanks RM, Nau GJ
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, USA

... 2. Promoter characterization of F. tularensis pyrF. (A) Genomic arrangement of pyrF where the three predicted –10 and –35 promoter regions are shaded (BPROM; www.softberry. ru). The start codon of pyrF is boxed and in boldface type. ...


Genetics
Vol. 185, 823-830, July 2010, doi:10.1534/genetics.110.114462

IscR Regulates RNase LS Activity by Repressing rnlA Transcription

Otsuka et al.,
* Department of Biological Sciences, Graduate School of Science, Osaka University, Osaka 560-0043, Japan and {dagger} Division of Life Science, Graduate School of Science and Engineering, Saitama University, Saitama 338-8570, Japan

... Although a promoter corresponding to these sites was not predicted by GENETYX, another program, BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb), identified a promoter matching these sites as transcription start ...


Journal of Molecular Biology
Volume 399, Issue 5, 25 June 2010, Pages 759-772 doi:10.1016/j.jmb.2010.04.040

A Bacterial GAP-Like Protein, YihI, Regulating the GTPase of Der, an Essential GTP-Binding Protein in Escherichia coli

Jihwan Hwang and Masayori Inouye
Department of Biochemistry, Center for Advanced Biotechnology and Medicine, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, 679 Hoes Lane, Piscataway, NJ 08854, USA

... The - 35, - 10, and Shine–Dalgarno regions are underlined. The putative promoter sequence was also predicted by using BPROM (available at http://www.softberry.com.). "+ 1" is the transcriptional start site, and "M" is the initiation methionine codon. ...


PLoS ONE
2010 5(1): e8601. doi:10.1371/journal.pone.0008601

Sequence Analysis of pKF3-70 in Klebsiella pneumoniae: Probable Origin from R100-Like Plasmid of Escherichia coli

Yi et al.,
1 Institute of Biomedical Informatics/Zhejiang Provincial Key Laboratory of Medical Genetics, Wenzhou Medical College, Wenzhou, China, 2 T-Life Research Center, Fudan University, Shanghai, China

... CD-search was used to identify the conserved domains in some uncharacterized proteins [47]. Promoters were predicted using BPROM (http://linux1.softberry.com/berry.phtml) and insertion sequences were predicted using IS-finder (http://www-is.biotoul.fr/is.html). ...


New Biotechnology
Volume 27, Issue 1, 28 February 2010, Pages 1-9 doi:10.1016/j.nbt.2009.12.003

Isolation of novel Pseudomonas syringae promoters and functional characterization in polyhydroxyalkanoate-producing pseudomonads

Daniel K.Y. Solaiman and Bryan M. Swingle
1 Eastern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 600 E. Mermaid Lane, Wyndmoor, PA 19038, USA 2 R.W. Holley Center for Agriculture and Health, Agricultural Research Service, U.S. Department of Agriculture, Tower Rd., Ithaca, NY 14853-2901, USA

... 4a). We next subjected the sequence in pBS29-P2-gfp that includes the P2 promoter and the coding region of the gfp gene to a promoter and transcription factor (TF) analysis using a BPROM program (www.softberry.com, Mount Kisco, NY, USA). ...


PLoS ONE
2010 5(5): e10877. doi:10.1371/journal.pone.0010877

The GimA Locus of Extraintestinal Pathogenic E. coli: Does Reductive Evolution Correlate with Habitat and Pathotype?

Homeier T, Semmler T, Wieler LH, Ewers C
1 Institute for Microbiology and Epizootics, Veterinary Faculty, Free University Berlin, Berlin, Germany, 2 Institute of Animal Hygiene and Veterinary Public Health, Faculty of Veterinary Medicine, University of Leipzig, Leipzig, Germany

... in the remnant. Additionally, using the BPROM promoter prediction tool (provided on http://linux1.softberry.com) we could identify a transcriptional factor binding site upstream of the start codon (data not shown). However, it is ...


Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010

Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1 predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...


Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035

Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...


Molecular Microbiology
Volume 77, Issue 4, pages 1009–1020, August 2010 DOI: 10.1111/j.1365-2958.2010.07269.x

Functional amyloid in Pseudomonas

Dueholm et al.,
1 Centre for Insoluble Protein Structures, Interdisciplinary Nanoscience Center (iNANO), Department of Molecular Biology, University of Aarhus (iNANO), 8000 Aarhus C, Denmark 2 Department of Biotechnology, Chemistry, and Environmental Engineering, Aalborg University, 9000 Aalborg, Denmark

... Sequence coverage was calculated by reference genome assembly of reads to the aligned sequence using the CLC Genomics Workbench 3.0.1. Promotor regions were predicted using BPROM (http://linux1.softberry.com/berry.phtml). Cloning of pMMB190-UK4fapA–F. ...


BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153

Transcriptome analysis of the mobile genome ICEclc in
Pseudomonas knackmussii B13

Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland

... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map of ICEclc was designed from SeqBuilder of the Lasergene software package ...


Journal of Bacteriology
January 2009, p. 333-346, Vol. 191, No. 1

Characterization of YmgF, a 72-Residue Inner Membrane Protein That Associates with the Escherichia coli Cell Division Machinery

Gouzel Karimova, Carine Robichon, and Daniel Ladant
Institut Pasteur, CNRS URA 2185, Unite de Biochimie des Interactions Macromoleculaires, Departement de Biologie Structurale et Chimie, 25 rue du Dr Roux, Paris Cedex 15, France

... Bacterial promoter recognition programs (E. coli promoter map from nostradamus.cs.rhul. ac.uk/vigen (30); BPROM from SoftBerry, Inc.) predicted a putative promoter within a 60-bp DNA fragment immediately upstream from the ymgF ORF start codon. ...


Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080

Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing

Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA

... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table 2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...


Journal of Bacteriology
July 2009, p. 4427-4440, Vol. 191, No. 13

A Metabolic Operon in Extraintestinal Pathogenic Escherichia coli Promotes Fitness under Stressful Conditions and Invasion of Eukaryotic Cells

Rouquet et al.,
INRA, UR1282, Unite d'Infectiologie Animale et de Sante Publique, Laboratoire de Pathogenie Bacterienne, Centre de Recherche de Tours, F-37380 Nouzilly, France

... program. Putative 70 transcriptional promoters (bent arrows) and transcriptional terminators ( ) were predicted with the BPROM (SoftBerry, Inc.) and the mfold (www.bioinfo.rpi.edu/ ~ zukerm/rna/) programs, respectively. Direct ...


Archives of Microbiology
Volume 191, Number 5 / May, 2009, pp. 441-450

Localization and characterization of VVA0331, a 489-kDa RTX-like protein, in Vibrio vulnificus YJ016

Li-Fang Chou 1 , Hwei-Ling Peng2, Yu-Chung Yang 2, Min-Chieh Kuo 1 and Hwan-You Chang 1
(1) Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan, ROC (2) Department of Biological Science and Technology, National Chiao Tung University, 300 Hsin Chu, Taiwan, ROC

... 2005) and the program BPROM (SoftBerry, Mount Kisco, NY). Our results demonstrate that VVA0331 protein was secreted from V. vulniWcus YJ016 in exponential growth phase. Nevertheless, the functional roles of VVA0331 Fig. ...


PLoS Genet.
2009 March; 5(3): e1000439.

A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element

Rachel A. F. Wozniak 1,2,3 and Matthew K. Waldor 1,2,3*
1Channing Laboratory, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America 2Howard Hughes Medical Institute, Chevy Chase, Maryland, United States of America

... 5? RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for ...


Journal of Bacteriology
April 2009, p. 2530-2540, Vol. 191, No. 8

Interplay between Two RND Systems Mediating Antimicrobial Resistance in Brucella suis

Martin et al.,
Fundacion Instituto Leloir, IIBBA CONICET and FCEyN, Universidad de Buenos Aires, Patricias Argentinas 435, (C1405BWE) Buenos Aires, Argentina,1 Instituto de Biotecnologia, CICVyA, INTA-Castelar, Las Cabanas y Los Reseros s/n (B1712WAA) Castelar, Buenos Aires, Argentina,2

... bepDE. Our analysis using the promoter prediction software BPROM (SoftBerry Inc.) indicated the presence of two overlapping and divergent putative promoters within the 172-bp intergenic region between bepR and bepD (Fig. ...


BMC Microbiology
2009, 9:247 doi:10.1186/1471-2180-9-247

Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

Adam C Jones 1, Lena Gerwick 1, David Gonzalez 2,3, Pieter C Dorrestein 2,3,4,5 and William H Gerwick *1,5
1Center for Marine Biotechnology and Biomedicine, Scripps Institution of Oceanography, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093 USA, 2Department of Chemistry, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093 USA

... [22]. A software prediction program (BPROM, www.softberry.com) was used to predict ... for conserved binding regions (in comparison to the?70 E. coliconsensus promoter) using the BPROM predictor (www.softberry.com; Table 1). The upstream (up-) regions of genes ...


Gene
Volume 442, Issues 1-2, 1 August 2009, Pages 1-7

Characterization of the Haloarcula hispanica amyH gene promoter, an archaeal promoter that confers promoter activity in Escherichia coli

Zeng et al.,
aState Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China bSchool of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan 430023, PR China

... In addition, computer analysis of the 5?-flanking region using the BPROM program (http://www.softberry.com) revealed a typical E. coli ? 70 promoter structure located ? 86 to ? 59 bp upstream of the amyH start codon, where the putative ? 10 box (TAGAAT) matches the ...


Journal of Bacteriology
March 2009, p. 1933-1940, Vol. 191, No. 6

Analysis by Mutagenesis of a Chromosomal Integron Integrase from Shewanella amazonensis SB2BT

Andre Larouche 1,2 and Paul H. Roy 1,2
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec,1 Departement de Biochimie et de Microbiologie, Faculte des Sciences et de Genie, Universite Laval, Quebec, Canada2

... There is no ORF between attC2 and attC3. The promoter recognition program BPROM sigma70 (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) indicates that a mobile promoter region could be within this cassette. ...


Antimicrobial Agents and Chemotherapy
May 2009, p. 1998-2004, Vol. 53, No. 5

Genetic Organization of Transposase Regions Surrounding blaKPC Carbapenemase Genes on Plasmids from Klebsiella Strains Isolated in a New York City Hospital

Gootz et al.,
Department of Infectious Diseases,1 Molecular Biology, Pfizer Global Research and Development, Groton, Connecticut 06340

... primers: CETnF1 (5'-CATGGCGTAGGTTGTTGTCGC) and CETnR1 (5'- GCGGCAGAAGCCAAAATCG). Promoter analysis for all 15 bla KPC genes was determined using the BProm software (http://www.softberry.com). RESULTS. ...


Journal of Bacteriology
January 2009, p. 403-410, Vol. 191, No. 1

The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor

Arnadottir et al.,
Institute for Experimental Pathology, University of Iceland, Keldur v/Vesturlandsveg, IS-112 Reykjavik, Iceland,1 Institute for Veterinary Bacteriology, University of Bern, Langastrasse 122, Postfach, CH-3001, Bern, Switzerland2

... html). Prediction of promoter sequences was performed with the software Prediction of Bacterial Promoters (BPROM) (Softberry) and Prokaryotic Promoter Prediction (PPP) (http://bioinformatics.biol.rug.nl/websoftware/ppp). The ...


Applied and Environmental Microbiology
October 2009, p. 6581-6590, Vol. 75, No. 20

ACC (1-Aminocyclopropane-1-Carboxylate) Deaminase Activity, a Widespread Trait in Burkholderia Species, and Its Growth-Promoting Effect on Tomato Plants

Janette Onofre-Lemus,1 Ismael Hernandez-Lucas,2 Lourdes Girard,1 and Jesus Caballero-Mellado1
Centro de Ciencias Genomicas, Universidad Nacional Autonoma de Mexico, Ap. Postal No. 565-A, Cuernavaca, Morelos, Mexico,1 Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico2

... In silico analysis of the resulting sequence was performed with the programs FGENESB, BPROM (http://linux1.softberry.com/berry.phtml), and virtual footprint promoter analysis version 3.0 (http://www.prodoric.de/vfp/vfp_promoter.php). ...


Applied and Environmental Microbiology
July 2009, p. 4506-4515, Vol. 75, No. 13

bdhA-patD Operon as a Virulence Determinant, Revealed by a Novel Large-Scale Approach for Identification of Legionella pneumophila Mutants Defective for Amoeba Infection

P. Aurass, B. Pless, K. Rydzewski, G. Holland, N. Bannert, and A. Flieger
Robert Koch Institute, Berlin, Germany

... _legion). Nucleotide sequences were also analyzed for promoters using the Web-based program BPROM (www.softberry.com) and for secretion signals using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP). ...


BMC Microbiol.
2009 Jul 27;9:151.

A new cold-adapted beta-D-galactosidase from the Antarctic Arthrobacter sp. 32c - gene cloning, overexpression, purification and properties

Hildebrandt P, Wanarska M, Kur J.
Department of Microbiology, Chemical Faculty, Gdansk University of Technology, Narutowicza 11/12, 80-952 Gdansk, Poland.

... 32c b-D-galactosidase gene with the promoter prediction tool (BPROM software, http://www.softberry.com) revealed a potential promoter sequence with CTTACA and TACAAT as -35 and -10 sequences, respectively. A putative ribosomal binding site was ...


Current Genetics
Volume 55, Number 5 / October, 2009, pp. 583-591

Identification of transcribed and persistent variants of the psbA gene carried by plastid minicircles in a dinoflagellate

Satoko Iida 1, Atsushi Kobiyama 2, Takehiko Ogata 2 and Akio Murakami 1
1) Kobe University Research Center for Inland Seas, 2746 Iwaya, Awaji 656-2401, Japan (2) School of Marine Biosciences, Kitasato University, 160-4 Okiraiazautou, Sanriku, Ofunato 022-0101, Japan

... nlm.nih.gov/projects/gorf/). A start codon was assigned based on sequence alignment, upstream in-frame TAG and no ATG around the psbA 5 end. Predictions of prokary- otic-type promoters were performed using BPROM pro- grams (http://www.softberry.com). ...


FEMS Microbiol Lett.
2009 Jun;295(1):96-102.

Transcriptome analysis of Escherichia coli O157:H7 EDL933 during heat shock

Carruthers MD, Minion C.
Department of Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames, IA, USA.

... Z5121). Motifs were deemed significant if identified by BIOOPTIMIZER using both MEME and BIOPROSPECTOR output as input. BPROM (http:// www.softberry.com) was used for promoter prediction. Validation of microarray data ...


Nucleic Acids Research
2009 37(16):5465-5476; doi:10.1093/nar/gkp501

Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence

Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence
Department of Microbiology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA

... determined (15,28). In addition, promoter predictions were generated using the Softberry BPROM network server and the Neural Network Promoter Prediction by the BDGP using prokaryotic settings. The sequences analyzed ...


BMC Microbiology
2009, 9:7doi:10.1186/1471-2180-9-7

Characterization of the meningococcal DNA glycosylase Fpg involved in base excision repair

Tibballs et al.,
1 Centre for Molecular Biology and Neuroscience and Institute of Microbiology, University of Oslo, Rikshospitalet, NO-0027 Oslo, Norway 2 Institute of Microbiology, Rikshospitalet, NO-0027 Oslo, Norway

... Putative promoters were identified with the transcription promoter predictor available at the Berkeley Drosophila Genome Project http://www.fruitfly.org/seq_tools/promoter.html webcite and the BPROM predictor of bacterial promoters http://www.softberry.com/berry.phtml webcite ...


In Silico Biology
Volume 9, Number 1-2 / 2009, pp. S1-S16

Analysis of n-Gram based Promoter Recognition Methods and Application to Whole Genome Promoter Prediction

T. Sobha Rani 1, Raju S. Bapi 1
1Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India

... TATA box and Inr (Neural Network Promoter Predictor, indicated as a tool for promoter prediction of both prokaryotes and eukaryotes) (http://www.fruitfly.org/seq tools/promoter.html), BPROM uses functional motifs and oligonucleotide information (http://www.softberry.com/berry ...


Journal of Microbiological Methods
Volume 79, Issue 1, October 2009, Pages 23-31

Characterization of pNC1, a small and mobilizable plasmid for use in genetic manipulation of Desulfovibrio africanus

I. Nydia Castaneda-Carrion, Marvin Whiteley and Lee R. Krumholz
aDepartment of Botany and Microbiology, University of Oklahoma, Norman, OK 73019, United States bSection of Molecular Genetics and Microbiology, University of Texas at Austin, Austin, TX 78712, United States

... et al., 2002). ORFs greater than 300 nucleotides long were compared to the GenBank protein database using the blastp algorithm (Altschul et al., 1997). Promoters were detected by BPROM from Softberry. Direct repeats and ...


Appl. Environ. Microbiol.
doi:10.1128/AEM.01864-09 2009

Functional genomic analysis of two Staphylococcus aureus phages isolated from the dairy environment

Garcia et al.,
Instituto de Productos Lacteos de Asturias (IPLA-CSIC). Apdo. 85. 33300- Villaviciosa, Asturias, Spain; Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven, Belgium;

... YASPIN (http://www.ibi.vu.nl/programs/yaspinwww/). s70 promoter sequences were identified using Bprom (http://www.softberry.com) and PPP (Prokaryotic Promoter Prediction, http://bioinformatics.biol.rug.nl/websoftware/ppp/ppp_start.php). Putative ...


The Journal of Infectious Diseases
2009;199:513–521

Penicillin-Binding Protein 7/8 Contributes to the Survival of Acinetobacter baumannii In Vitro and In Vivo

Russo et al.,
Veterans Administration Western New York Healthcare System and 2The Witebsky Center for Microbial Pathogenesis

... Finally, a promoter prediction analysis was performed on the 5' DNA sequence to the predicted transcriptional start site of pbpG (BPROM [SoftBerry]; available at: http://www.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Journal of Bacteriology
May 2009, p. 3142-3148, Vol. 191, No. 9 doi:10.1128/JB.01575-08

Isolation and Characterization of Azotobacter vinelandii Mutants Impaired in Alkylresorcinol Synthesis: Alkylresorcinols Are Not Essential for Cyst Desiccation Resistance

Segura et al.,
Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Morelos, Me'xico,1 Centro de Investigaciones en Ciencias Microbiolo'gicas, Beneme'rita Universidad Auto'noma de Puebla, Puebla, Me'xico2

... nucleotides in each case. In addition, no promoter consensus sequences were identified in the 83-nucleotide intergenic arsA-arsB sequence (SoftBerry BPROM program; http://linux1.softberry.com/berry.phtml). Because a mutation ...


Plasmid
Volume 62, Issue 1, July 2009, Pages 44-49

Characterization of a cryptic plasmid pSFKW33 from Shewanella sp. 33B

Katarzyna Werbowy a, Hubert Cies'lin'ski a, and Jo'zef Kur
aDepartment of Microbiology, Chemical Faculty, Gdan'sk University of Technology, Narutowicza 11/12, 80-952 Gdan'sk, Poland

... The prediction of bacterial promoters was carried out with BPROM software (www.softberry.com). ... Furthermore, the analysis of DNA sequence upstream ORF3 with the promoter prediction tool (BPROM software, http://www.softberry.com) revealed a potential promoter sequence. ...


Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia

... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to detect ORFs (open reading frames), which were then manually confirmed. ... Identification of promoters utilized the program BPROM (http://www.softberry.com). ...


Journal of Bacteriology
October 2009, p. 5953-5963, Vol. 191, No. 19 doi:10.1128/JB.00647-09

The pgaABCD Locus of Acinetobacter baumannii Encodes the Production of Poly-?-1-6-N-Acetylglucosamine, Which Is Critical for Biofilm Formation

Alexis H. K. Choi, Leyla Slamti, Fikri Y. Avci, Gerald B. Pier, and Tomas Maira-Litran
Channing Laboratory, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts

... of molecular biology applications (http://www.emboss.org/). Promoter prediction was done with BPROM (http://www.softberry.com/all.htm) (Softberry, Inc., Mt. Kisco, NY). PNAG purification. PNAG was prepared from a 6-liter culture ...


Microbiology
155 (2009), 2490-2497; DOI 10.1099/mic.0.027433-0

SoxS regulates the expression of the Salmonella enterica serovar Typhimurium ompW gene

Hernandez-Lucas et al.,
1 Laboratorio de Microbiologi'a Molecular, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile 2 Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Mexico 3 Laboratorio de Bioqui'mica, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile

... To support these results, a bioinformatic search was performed using the Softberry BPROM program (www.softberry.com/berry.phtml? Topic=bprom). Thus, a 400 bp region upstream of the start codon was analysed for putative -35 and -10 promoter regions. ...


Appl. Environ. Microbiol.
2009 doi:10.1128/AEM.01366-09

Long term survival of Campylobacter jejuni at low temperature is dependent on polynucleotide phosphorylase activity

Nabila Haddad et al.,
Division

... 210 Transcriptional start site was predicted using Softberry BPROM program 211 (http://linux1.softberry.com/cgi-bin/programs/gfindb/bprom.pl). ... Therefore, a putative transcriptional start site was identified 100 bp from the start codon by 242 Softberry-BPROM programme (Fig. ...


Applied and Environmental Microbiology
March 2009, p. 1471-1477, Vol. 75, No. 6

Role of proP and proU in Betaine Uptake by Yersinia enterocolitica under Cold and Osmotic Stress Conditions

Thirunavukkarasu Annamalai 1 and Kumar Venkitanarayanan 2
Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, New York 10595,1 Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 062692

... extracted plasmid DNA. The sequences generated were analyzed by using Sequencher 4.1.4 (Gene Codes Corporation, Ann Arbor, MI), BPROM (http://www. softberry.com), ClustalW (EMBnet), and Blastn (NCBI). View this table ...


Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia

... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to detect ORFs (open reading frames), which were then manually confirmed. ... Identification of promoters utilized the program BPROM (http://www.softberry.com). ...


J Bacteriol.
2009 Vol. 191, No. 1, p. 210-219

Interaction between bacteriophage DMS3 and host CRISPR region inhibits group behaviors of Pseudomonas aeruginosa

Zegans et al.
Dept. of Microbiology & Immunology, Rm 505 Vail Building, Dartmouth Medical School, Hanover, NH 03755; Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756

... the forward 161 and reverse strands, and with BPROM bacterial promoter predictor (Softberry, Mt. Kisco, NY; 162 http://www.softberry ...


Journal of Bacteriology
January 2009, p. 545-554, Vol. 191, No. 2

Characterization of the myo-inositol utilization island of 2 Salmonella enterica serovar Typhimurium

Kroger C, Fuchs TM
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

.. species. Promoter sequences located upstream of the identified genes were predicted with 114 BPROM (http://www.softberry.com/). 115 ...


Appl. Environ. Microbiol.
2008. doi:10.1128/AEM.01644-08

Characterizing the role of proP and proU in betaine uptake by Yersinia enterocolitica during cold and osmotic stress

Thirunavukkarasu Annamalai and Kumar Venkitanarayanan
Department of Biochemistry and Molecular Biology, New York Medical College Valhalla, NY 10595; Department of Animal Science, Unit-4040, University of Connecticut, Storrs 06269

... The sequences generated were analyzed by Sequencher 2 4.1.4 (Gene Codes Corporation, Ann Arbor, MI), BPROM (http://www.softberry.com), 3 ...


In Silico Biology
8, 0042 (2008)

Analysis of n-gram based promoter recognition methods and application to whole genome promoter prediction

T. Sobha Rani and Raju S. Bapi
Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India

... and eukaryotes) (http://www.fruitfly.org/seq_tools/promoter.html), BPROM uses functional motifs and oligonucleotide information (http://www.softberry.com/berry ...


Genes & Dev.
2008. 22: 3497-3508 doi: 10.1101/gad.1729508

YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity

Kwang-sun Kim, Robert Manasherob, and Stanley N. Cohen
Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA

... 2007), as well as ymdB, were identified using BPROM (Softberry, Inc.)-which detects consensus sequences for RNA polymerase ? 70 recognition sites (Campbell ...


BMC Microbiol.
2008; 8: 214. doi: 10.1186/1471-2180-8-214.

Insecticidal genes of Yersinia spp.: taxonomical distribution, contribution to toxicity towards Manduca sexta and Galleria mellonella, and evolution

Fuchs et al.,
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Germany

... TREECON [28]. Promoter sequences located upstream of the identified genes were deduced with BPROM http://www.softberry.com/. The ...


BMC Genomics
2008, 9:229 doi:10.1186/1471-2164-9-229

Photorhabdus luminescens genes induced upon insect infection

Anna Munch, Lavinia Sting, Kirsten Jung and Ralf Heermann
1Ludwig-Maximilians-Universitat Munchen, Department Biologie I, Bereich Mikrobiologie, Maria-Ward-Str. 1a, D-80638 Munchen, Germany, 2Munich Center for Integrated Protein Science (CIPSM), Ludwig-Maximilians-Universitat Munchen, Munchen, Germany,

.. analysis using the software BProm. ... BProm within the sequence of clone 1. In summary, 29 promoters of different genes or operons ...


Antimicrob Agents Chemother.
2008 Jul;52(7):2573-80. Epub 2008 Apr 28

Acquisition of a plasmid-borne blaOXA-58 gene with an upstream IS1008 insertion conferring a high level of carbapenem resistance to Acinetobacter baumannii

Chen TL, Wu RC, Shaio MF, Fung CP, Cho WL
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Taipei, Taiwan

... RACE fragments and conserved motifs. Promoter sequences were identified using the BPROM program. RT-PCR. Bacterial RNA was isolated ...


J Bacteriol.
2008 Oct 24. [Epub ahead of print]

The AsaP1 peptidase of Aeromonas salmonicida subsp. achromogenes is a highly conserved deuterolysin metalloprotease (family M35) and a major virulence factor

Arnadottir et al.

.. Prediction of Bacterial Promoters (BPROM), http://www.softbery.com, and Prokaryotic 145 ACCEPTED at Google Indexer on November 18, 2008 jb.asm.org ...


Mol Genet Genomics.
2008 Jul;280(1):59-72. Epub 2008 Apr 30

Global consequences of phosphatidylcholine reduction in Bradyrhizobium japonicum.

Hacker S, Godeke J, Lindemann A, Mesa S, Pessi G, Narberhaus F.
Lehrstuhl fur Biologie der Mikroorganismen, Ruhr-Universitat Bochum, NDEF 06/783, 44780 Bochum, Germany.

The BPROM program (http://www.softberry.com/berry.phtml) predicts a s70-type-10 promotor region (TACAAT) located about 85 bp upstream from the ATG start codon.


Appl Environ Microbiol.
2008 Jan;74(1):336-41. Epub 2007 Nov 16

Genomic markers for differentiation of Francisella tularensis subsp. tularensis A.I and A.II strains.

Molins-Schneekloth CR, Belisle JT, Petersen JM
Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases, Bacterial Diseases Branch, 3150 Rampart Road, Fort Collins, CO 80521, USA

.. RDs within intergenic regions were analyzed for putative promoter sequences (BPROM). See Table S2 in the supplemental material for a summary of this analysis. ...


Appl Environ Microbiol.
2008 Dec;74(24):7552-60. Epub 2008 Oct 24

Isolation of new stenotrophomonas bacteriophages and genomic characterization of temperate phage s1

Garcia et al.
Area de Microbiologi'a, Facultad de Medicina, Universidad de Oviedo, Asturias, Spain.

... (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Likely ? 70 target promoter 19 sequences were identified using Bprom (http://www.softberry.com). Putative 20 ...


FEMS Microbiol Lett.
2008 Jun;283(1):36-41

Effect of growth conditions on poly-N-acetylglucosamine expression and biofilm formation in Escherichia coli

Cerca N, Jefferson KK
Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, VA, USA

... We investigated the possible role of other regulators in pga expression, and analysis of the pga promoter region using the BPROM online promoter analysis tool ...


Biochem. J.
(2008) Immediate Publication, doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

Khurana et al.
Division of Entomology, CSIRO, Canberra, ACT 2601, Australia.

.. Search Tools (BLAST; [23]). Identification of promoters utilised the program BPROM (http://www.softberry.com). BioEdit version 7.0 ...


Antimicrob Agents Chemother.
2008 Jul;52(7):2473-9. Epub 2008 Apr 28

Functional diversity among metallo-beta-lactamases: characterization of the CAR-1 enzyme of Erwinia carotovora

Stoczko M, Frere JM, Rossolini GM, Docquier JD
Dipartimento di Biologia Molecolare, Laboratorio di Fisiologia e Biotecnologia dei Microrganismi, Universita` di Siena, I-53100, Siena, Italy

... predicted using SignalP (version 3.0) (5). Putative promoter sequences and binding sites for regulatory proteins were performed using bprom software (Softberry ...


Appl Environ Microbiol.
2008 Apr;74(7):2161-70. Epub 2008 Feb 1.

Characterization and application of a glucose-repressible promoter in Francisella tularensis

Horzempa J, Tarwacki DM, Carlson PE Jr, Robinson CM, Nau GJ.
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, E1256 BSTWR, 200 Lothrop St., Pittsburgh, PA 15261, USA.

... An analysis of the FGRp sequence near and upstream of the truncation of pTC3Dt3 with the BPROM program (Softberry) revealed the presence of putative -10 and ...


Antimicrob Agents Chemother.
2008 Apr;52(4):1472-80. Epub 2008 Feb 11

Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids

Revilla et al.
Departamento de Biologi'a Molecular e Instituto de Biomedicina y Biotecnologi'a de Cantabria, Universidad de Cantabria-CSIC-IDICAN, C. Herrera Oria s/n, 39011 Santander, Spain.

... promoter is located upstream of aadA13 in the 'osa region (detected using the bacterial promoter prediction BPROM program at http://www.softberry.com) (see Fig ...


Microbiology.
2008 May;154(Pt 5):1372-83.

Instability of the Salmonella RcsCDB signalling system in the absence of the attenuator IgaA

Mariscotti JF, Garci'a-Del Portillo F.
Departamento de Biotecnologi'a Microbiana, Centro Nacional de Biotecnologi'a-Consejo Superior de Investigaciones Cienti'ficas (CSIC), Darwin 3, 28049 Madrid, Spain

... The BPROM program, which predicts 70 promoter sites (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb), was used to analyse in ...


J Bacteriol.
2008 Mar;190(6):2096-105. Epub 2008 Jan 11

Regulation of type IV secretion apparatus genes during Ehrlichia chaffeensis intracellular development by a previously unidentified protein

Cheng Z, Wang X, Rikihisa Y.
Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, 1925 Coffey Road, Columbus, OH 43210-1093, USA

... sites and 70 -like promoter elements of virB8-2, virB9-2, and virB4-2 upstream of these three genes were predicted by the BPROM program (Softberry, Inc., Mount ...


J Bacteriol.
2008 Jul;190(13):4559-67. Epub 2008 May 9.

Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1,2-propanediol by disproportionation

Sriramulu et al.
Department of Microbiology, University College Cork, Cork, Ireland

... 26). Promoter prediction was performed with BPROM (software available from SoftBerry (Mount Kisco, NY). Primer extension analysis. ...


Research in Microbiology
2008 May;159(4):270-8. Epub 2008 Mar 29

The omp50 gene is transcriptionally controlled by a temperature-dependent mechanism conserved among thermophilic Campylobacter species

Dedieu L, Pages JM, Bolla JM.
UMR-MD-1, IFR 48, Faculte de Medecine, Universite' de la Mediterranee, 27 Boulevard Jean Moulin, Marseille Cedex 5, France

... codon of the C. jejuni NCTC 11168 strain was computer-analyzed using a bacterial promoter prediction tool (BPROM at the URL: http://www.softberry.com/berry ...


Microbiology.
2008 Jun;154(Pt 6):1719-28.

flhDC, but not fleQ, regulates flagella biogenesis in Azotobacter vinelandii, and is under AlgU and CydR negative control

Leon R, Espin G
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo Postal 510-3, Cuernavaca, Morelos 62250, Mexico.

... For putative RpoD (sigma 70)-recognized promoters, we used BPROM (http://www.softberry. com/berry.phtml), which is a program for the prediction of bacterial ...


Infect Immun.
2008 Jul 21

A tripartite efflux pump involved in gastrointestinal colonization by Klebsiella pneumoniae confers a tolerance response to inorganic acid

Sophie Coudeyras, Laurence Nakusi, Nicolas Charbonnel, Christiane Forestier
Univ Clermont 1, UFR Pharmacie, Laboratoire de Bacte'riologie, Clermont-Ferrand, France.

... A promoter consensus sequence was detected upstream of the eefX start codon (-35 : CTTTCC; -10 : TCGTATAAT, softberry bprom). Analysis ...


Antimicrob Agents Chemother.
2008 May;52(5):1703-12. Epub 2008 Feb 25

Transcriptional and translational control of the mlr operon, which confers resistance to seven classes of protein synthesis inhibitors

Smith LK, Mankin AS.
Center for Pharmaceutical Biotechnology, m/c 870, University of Illinois, 900 S. Ashland Ave., Chicago, IL 60607, USA

... Analysis of the nucleotide sequence of the erm(B)-cfr intergenic spacer with the BPROM algorithm of the Softberry genome analysis suite (http://softberry.com ...


Infect Immun.
2008 Sep;76(9):4000-8. Epub 2008 Jun 23

Genome of Mycoplasma arthritidis

Dybvig et al.
Department of Genetics, University of Alabama Birmingham, Birmingham, Alabama 35294-0024, USA.

... Potential promoters in genes containing upstream poly(T) or poly(A) tracts were identified using BPROM at http://www.softberry.com/berry.phtml. ...


Infect Immun.
2008 Nov;76(11):5392-401. Epub 2008 Sep 2

Analysis of the isoprenoid biosynthesis pathways in Listeria monocytogenes reveals a role for the alternative 2-C-methyl-D-erythritol 4-phosphate pathway in murine infection.

Begley et al.
Alimentary Pharmabiotic Centre, Department of Microbiology, University College Cork, Cork, Ireland

... Predicted promoter regions were analyzed using BPROM (http://www.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Expert Opinion on Drug Discovery
August 2008, Vol. 3, No. 8, Pages 903-929 (doi:10.1517/17460441.3.8.903)

Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery

Nishikant V Wase & Phillip C Wright
The University of Sheffield, Biological and Environmental Systems Group, Department of Chemical and Process Engineering, Mappin St., Sheffield, S1 3JD, UK +44 0 114 2227577; +44 0 114 2227501

... of software packages found on Softberry [63], including fgenesB [64] (Pattern/Markov chain-based bacterial operon and gene prediction), BPROM [65] (Prediction ...


Infection and Immunity
August 2008, p. 3587-3594, Vol. 76, No. 8 doi:10.1128/IAI.01568-07

D-Alanylation of Lipoteichoic Acid Contributes to the Virulence of Streptococcus suis

Nahuel Fittipaldi et al.,
Groupe de Recherche sur les Maladies Infectieuses du Porc and Centre de Recherche en Infectiologie Porcine, Faculte' de me'decine ve'te'rinaire, Universite' de Montre'al, St-Hyacinthe, Quebec J2S 7C6, Canada,1 Research Team for Bacterial/Parasitic Diseases, National Institute of Animal Health, National Agriculture and Food Research Organization, Tsukuba, Ibaraki 305-0856, Japan,2

... A putative strong promoter (indicated by P) was predicted 228 bp upstream of the start codon for dltA using the software package Softberry BProm (http://www ...


Extremophiles
Volume 12, Number 3 / May 2008 pp. 415-429

Complete nucleotide sequence of pGS18, a 62.8-kb plasmid from Geobacillus stearothermophilus strain 18

Milda Stuknyte et al.,
(1) Department of Plant Physiology and Microbiology, Faculty of Natural Sciences, Vilnius University, Ciurlionio 21/27, 03101 Vilnius, Lithuania (2) Department of Food Science and Microbiology, Industrial Microbiology Section, Faculty of Agriculture, University of Milan, Via Celoria 2, 20133 Milan, Italy

... Promoter -10 and -35 position determination was accomplished using BPROM provided by SoftBerry (http://www.softberry.com/berry.phtml). ...


Applied and Environmental Microbiology
November 2008, p. 6739-6745, Vol. 74, No. 21 doi:10.1128/AEM.01021-08

Dynamic Localization of MreB in Vibrio parahaemolyticus and in the Ectopic Host Bacterium Escherichia coli

Shen-Wen Chiu, Shau-Yan Chen, and Hin-chung Wong
Department of Microbiology, Soochow University, Taipei, Taiwan 111, Republic of China

... The DNA sequences 500 bp upstream of mreB were analyzed using BPROM (http://www. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) to ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


Canadian Journal of Microbiology
Volume 54, Number 5, 1 May 2008 , pp. 341-351(11)

Characterization of putative membrane protein genes of the 'Candidatus Phytoplasma asteris', chrysanthemum yellows isolate

Galetto, Luciana et al.,
... Bacterial promoters and terminators were searched with BPROM and FindTerm softwares available on the SoftBerry server (www.softberry.com/berry.phtml). ...


Microbiological Research
Volume 163, Issue 1, 15 January 2008, Pages 39-50

The expression of the serine proteinase gene of Bacillus intermedius in Bacillus subtilis

Margarita Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia

... proteinase was inspected for the occurrence of the characteristic -35 and -10 boxes of SigA-type promoters (Helmann, 1995) by Softberry BPROM (Prediction ...


FEMS Microbiology Letters
Volume 281 Issue 2 Page 160-166, April 2008

The prpZ gene cluster encoding eukaryotic-type Ser/Thr protein kinases and phosphatases is repressed by oxidative stress and involved in Salmonella enterica serovar Typhi survival in human macrophages

Sebastien P. Faucher, Charles Viau, Pierre-Paul Gros, France Daigle, Herve Le Moual
1Department of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada; and 2Department of Microbiology and Immunology, University of Montreal, Montreal, QC, Canada

... No such internal promoter sequences were identified using BPROM on the Softberry website (http://www.softberry.com/berry.phtml). ...


Journal of Bacteriology
June 2008, p. 3877-3885, Vol. 190, No. 11

Transcriptional Analysis and Functional Characterization of a Gene Pair Encoding Iron-Regulated Xenocin and Immunity Proteins of Xenorhabdus nematophila

Jitendra Singh and Nirupama Banerjee
School of Biotechnology, Jawaharlal Nehru University, New Delhi 110067, India,1 International Centre for Genetic Engineering and Biotechnology, New Delhi 110067, India2

... Identities of promoter sequences associated with the ORFs were determined by using the software BPROM (www.softberry.com) and www.fruitfly.org. ...


Biotechnology Letters
Volume 30, Number 3 / March, 2008 Pages 521-527

Identification of new internal promoters of the Xanthomonas oryzae pathovar oryzae gum gene cluster

Choong-Koo Lee, Byoung-Moo Lee and Jae-Yong Cho
(1) Division of Animal Science and Biotechnology, Sangji University, 660 Woosan-dong, Wonju-si, Gangwon-do, 220-702, Korea (2) Microbial Genetics Division, National Institute of Agricultural Biotechnology, 225 Seodun-dong, Suwon, 441-707, Korea

... and BPROM software (Softberry, Inc.). Transcrip- tional terminators were predicted with the TransTerm software (http://www.cbcb.umd.edu/software/Trans Term). ...


Journal of Molecular Catalysis B: Enzymatic
Volumes 52-53, June 2008, Pages 2-12

Genes responsible for hydantoin degradation of a halophilic Ochrobactrum sp. G21 and Delftia sp. I24 — New insight into relation of d-hydantoinases and dihydropyrimidinases

Durr et al.,
Department of Chemical Engineering, Chair of Technical Biology, University of Karlsruhe (TH), Germany

... BlastN and BlastP [21], ORF finder (at the National Centre for Biotechnology Information website), ClustalW [22], BPROM (available at www.softberry.com) and ...


Appl. Environ. Microbiol.
June 2008, p. 3644-3651, Vol. 74, No. 12 doi:10.1128/AEM.00429-08

Increased Fitness of Pseudomonas fluorescens Pf0-1 Leucine Auxotrophs in Soil

Wook Kim and Stuart B. Levy
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111, USA

... downsteam from the 3'end of the opposite leuA2 gene by 5'RACE (Fig 1B). BPROM (http://www.softberry.com) and NNPP (http://www ...


Antimicrob. Agents Chemother.
doi:10.1128/AAC.00393-08

Acquisition of a Plasmid Borne blaOXA-58 Gene with an Upstream IS1008 Insertion Conferring a High Level of Carbapenem Resistance to Acinetobacter baumannii

Te-Li Chen, Roy Chen-Chih Wu, Men-Fang Shaio, Chang-Phone Fung, and Wen-Long Cho
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Institute of Tropical Medicine, School of Medicine, National Yang-Ming University, Taipei, Division of Clinical Research, Department of Medical Research, Kuang Tien General Hospital, Institute of Clinical Nutrition, Hung Kuang University, Taichung, Taiwan

... motifs. Promoter sequences were identified using BPROM program 12 (www.softberry.com). 13 14 Reverse transcription-PCR (RT-PCR) 15 ...


FEMS Microbiology Ecology
2008 Aug;65(2):202-19. Epub 2008 Apr 9.

Physical organization and phylogenetic analysis of acdR as leucine-responsive regulator of the 1-aminocyclopropane-1-carboxylate deaminase gene acdS in phytobeneficial Azospirillum lipoferum 4B and other Proteobacteria

Claire Prigent-Combaret et al.,
1Universite' de Lyon, Lyon, F-69003, France; Universite' Lyon 1, Lyon, F-69003, France; CNRS, UMR 5557, Ecologie Microbienne, Villeurbanne, F-69622, France; IFR 41, Villeurbanne, F-69622, France

... of acdS in A. lipoferum 4B and other acdS + Proteobacteria was screened for putative promoters (using the program BPROM; at http://www.softberry.com/berry.phtml ...


Environmental Microbiology
Volume 10 Issue 5 Page 1101-1107, May 2008

Ecology of type II secretion in marine gammaproteobacteria

Flavia F. Evans, Suhelen Egan and Staffan Kjelleberg
School of Biotechnology and Biomolecular Sciences and Centre for Marine Bio-Innovation, University of New South Wales, Sydney, Australia

... 2). Just downstream of this gene and separated by an apparent promoter-less 66 base-pair nucleotide region (BPROM, Softberry Package), a unique copy of the ...


Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0

Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes

Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry. com), were used for operon and gene predictions. RESULTS. ...


Infection and Immunity,
September 2007, p. 4506-4513, Vol. 75, No. 9

Glutathione-Dependent Alcohol Dehydrogenase AdhC Is Required for Defense against Nitrosative Stress in Haemophilus influenzae

Stephen P. Kidd, Donald Jiang, Michael P. Jennings, and Alastair G. McEwan
Australian Bacterial Pathogenesis Program and Centre for Metals in Biology, School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Queensland 4072, Australia

... adhC-nmlR intergenic spacer regions of the NmlR subfamily from a number of bacteria were identified using BPROM software available from Softberry (Mount Kisco ...


Genetica
Volume 131, Number 3 / November 2007 p. 255-265

Isolation, gene structure, and comparative analysis of the S-layer gene sslA of Sporosarcina ureae ATCC 13881

Pavel M. Ryzhkov, Kai Ostermann and Gerhard Rodel
Institut fur Genetik, Technische Universitat Dresden, Helmholtzstr. 10, 01062 Dresden, Germany

... sequences and promoter regions were identified by means of BestPal and Bprom programs from ''SoftBerry'' software package (http://www.softberry.com). ...


Current Microbiology
Volume 55, Number 3 / September 2007 p. 185-192

A Novel Phytase appA from Citrobacter amalonaticus CGMCC 1696: Gene Cloning and Overexpression in Pichia pastoris

Huiying Luo et al.,
Microbial Engineering Department, Feed Research Institute, Chinese Academy of Agricultural Sciences, 100081 Beijing, China

... The promoter was predicted using the prediction of bacterial promoter program, BPROM (available at: http://www.softberry.com/berry.html). ...


Journal of Bacteriology,
May 2007, p. 3335-3347, Vol. 189, No. 9

Transcriptional Regulation of the CO2-Concentrating Mechanism in a Euryhaline, Coastal Marine Cyanobacterium, Synechococcus sp. Strain PCC 7002: Role of NdhR/CcmR

Fiona J. Woodger, Donald A. Bryant, and G. Dean Price
Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, P.O. Box 475, Canberra ACT 0200, Australia

... Putative LysR binding sites are underlined, and putative -35 and -10 elements (as predicted by BPROM at www.softberry.com) are shown in boldface. ...


Journal of Bacteriology,
April 2007, p. 3051-3062, Vol. 189, No. 8

YcfR (BhsA) Influences Escherichia coli Biofilm Formation through Stress Response and Surface Hydrophobicity

Xue-Song Zhang, Rodolfo Garcia-Contreras, and Thomas K. Wood
Artie McFerrin Department of Chemical Engineering, Department of Biology, Zachry Department of Civil Engineering, Texas A & M University, College Station, Texas 77843-3122

... Further analysis of the ycfR promoter with BPROM, a bacterial promoter prediction program (SoftBerry, Mount Kisco, NY), showed the presence of a putative SoxS ...


Journal of Bacteriology,
May 2007, p. 3776-3783, Vol. 189, No. 10

XphA/XqhA, a Novel GspCD Subunit for Type II Secretion in Pseudomonas aeruginosa

Gerard P. F. Michel, Eric Durand, and Alain Filloux
Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Biologie Structurale et Microbiologie, Centre National de la Recherche Scientifique, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 20, France

... Moreover, a search for promoters using the BPROM software (www.softberry.com) indicated -10 and -35 boxes, respectively, 392 bp and 416 bp upstream of the ...


Microbiology
153 (2007), 3608-3622

Promoter-trap identification of wheat seed extract-induced genes in the plant-growth-promoting rhizobacterium Azospirillum brasilense Sp245

Joel F. Pothier et al.,
Universite de Lyon, Lyon, F-69003, France

... pl) (Ishikawa & Hotta, 1999 Down). BPROM was used for prediction of promoters (http://www.softberry.com). SignalP 3.0 was used to ...


Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2

Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae

Priya Prakash Budde, Brigid M. Davis, Jie Yuan, and Matthew K. Waldor
Department of Molecular Biology and Microbiology, Program in Immunology, Tufts University School of Medicine, Howard Hughes Medical Institute, Boston, Massachusetts 02111

... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...


Research in Microbiology
Volume 158, Issue 6, July-August 2007, Pages 529-536

The ompW (porin) gene mediates methyl viologen (paraquat) efflux in Salmonella enterica serovar Typhimurium

Fernando Gil et al.,
Laboratorio de Microbiologi'a Molecular, Facultad de Ciencias de la Salud, Universidad Andre's Bello, Santiago, Chile

... MV induces ompW expression. BPROM software (http://www.softberry.com/berry.phtml? topic=bprom) was used to analyze a 400 bp region upstream from the ompW gene. ...


Journal of Bacteriology,
April 2007, p. 3006-3016, Vol. 189, No. 8

Expression of the bviIR and cepIR Quorum-Sensing Systems of Burkholderia vietnamiensis

Rebecca J. Malott and Pamela A. Sokol
Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada T2N 4N1

... G4cepRGSV). Construction of luxCDABE transcriptional fusions. Promoter regions were predicted in silico using SoftBerry BPROM. Promoter ...


Journal of Bacteriology,
August 2007, p. 5916-5928, Vol. 189, No. 16

Ler and H-NS, Regulators Controlling Expression of the Long Polar Fimbriae of Escherichia coli O157:H7

Alfredo G. Torres et al.,
Department of Microbiology and Immunology, Department of Pathology and Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555-1070

... The bacterial promoter recognition program BPROM (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) was used to predict the ...


Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54

Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520

Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China

... Promoter and terminator predictions were performed using BPROM and FindTerm, respectively (http://www.softberry.com/berry.phtml). ...


Microbiology
Volume 76, Number 5 / October 2007 p. 569-574

Heterologous expression of Bacillus intermedius gene of glutamyl endopeptidase in Bacillus subtilis strains defective in regulatory proteins

E. I. Shagimardanova et al.,
Kazan State University, ul. Kremlevskaya 18, Kazan, 420008, Russia

... potential -10 and -35 regions for the recognition by the sigma A factor of transcriptional RNA polymerase were identified using the Softberry BPROM server ...


Journal of Bacteriology,
July 2007, p. 5119-5129, Vol. 189, No. 14

Only One of Four Oligopeptide Transport Systems Mediates Nitrogen Nutrition in Staphylococcus aureus

Aurelia Hiron, Elise Borezee-Durant, Jean-Christophe Piard, and Vincent Juillard
Unite Bacteries Lactiques et pathogenes Opportunistes, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78352 Jouy en Josas cedex, France

... Putative promoter sequences were identified using the BPROM prediction of bacterial promoter program (http://www.softberry.com). ...


Infection and Immunity,
September 2007, p. 4482-4489, Vol. 75, No. 9

Genetic Basis for the New Pneumococcal Serotype, 6C

In Ho Park, Saeyoung Park, Susan K. Hollingshead, and Moon H. Nahm
Departments of Pathology,1 Microbiology, University of Alabama at Birmingham, 845 19th Street South, BBRB 614, Birmingham, Alabama 35294

... and genes, promoters, and transcription terminators in the capsule gene locus were identified using fgenesB, BPROM, and FindTerm (Softberry Inc.), which are ...


Microbiology
153 (2007), 3478-3498; DOI 10.1099/mic.0.2007/008250-0

Molecular analysis of the distribution and phylogeny of dissimilatory adenosine-5'-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and gene arrangement in operons was performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Microbiology
153 (2007), 2026-2044; DOI 10.1099/mic.0.2006/003152-0

Phylogeny of the alpha and beta subunits of the dissimilatory adenosine-5'-phosphosulfate (APS) reductase from sulfate-reducing prokaryotes – origin and evolution of the dissimilatory sulfate-reduction pathway

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and operons in genome data were performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Research in Microbiology
Volume 158, Issue 2, March 2007, Pages 175-186

Isolation and characterization of a gene cluster involved in PAH degradation in Mycobacterium sp. strain SNP11: Expression in Mycobacterium smegmatis mc2155

Christophe Pagnout et al.,
Laboratoire d'Ecotoxicite, Sante Environnementale, CNRS UMR 7146, Universite Paul Verlaine, rue du General Delestraint, F-57070 Metz, France

... Prediction and BPROM software available at the Berkeley Drosophila Genome Project (http://www.fruitfly.org/seq_tools/promoter.html) and SoftBerry (http://www ...


Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2

Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae

Priya Prakash Budde ,1,2,, Brigid M. Davis,2,* Jie Yuan,3 and Matthew K. Waldor1,2,3
Department of Molecular Biology and Microbiology,2 Program in Immunology, Tufts University School of Medicine,3 Howard Hughes Medical Institute, Boston, Massachusetts 021111

... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...


Environmental Microbiology
2007, 9 (3), 765 - 776. doi:10.1111/j.1462-2920.2006.01198.x

Molecular diversity of nitrite reductase genes (nirK) in nitrifying bacteria

J. Jason L. Cantera, Lisa Y. Stein
Department of Environmental Sciences, Geology 2207, University of California, Riverside, CA 92521, USA.

... gene sequences located upstream of translational start sites for nirK genes were analysed for sigma70 binding sites using BPROM (SoftBerry, Mount Kisco, NY). ...


Journal of Bacteriology,
June 2007, p. 4265-4274, Vol. 189, No. 11

Mycobacterial Bacilli Are Metabolically Active during Chronic Tuberculosis in Murine Lungs: Insights from Genome-Wide Transcriptional Profiling

Adel M. Talaat et al.,
Laboratory of Bacterial Genomics, Department of Pathobiological Sciences, University of Wisconsin—Madison, Madison, Wisconsin 53706

... Using a promoter recognition algorithm, BPROM (http://www.softberry.com/berry.phtml), we were able to predict a potential promoter binding site (TGGGTA-N[12 ...


Environmental Microbiology
Volume 9, Number 3, March 2007 , pp. 814-818(5)

The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata

Burke, Catherine; Thomas, Torsten; Egan, Suhelen; Kjelleberg, Staffan

... Upstream of the cluster a consensus region for a bacterial promoter was identified using the Softberry BPROM program (http://www.softberry.com). ...


Molecular Biology Reports
Volume 34, Number 2 / June, 2007 pp.79-87

The expression of Bacillus intermedius glutamyl endopeptidase gene in Bacillus subtilis recombinant strains

Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia

... was inspected for the occurrence of the characteristic –35 and –10 boxes of SigA-type promoters (Helmann 1995) by using the Softberry BPROM (Prediction of ...


Journal of Bacteriology,
January 2007, p. 351-362, Vol. 189, No. 2

Global Gene Expression and Phenotypic Analysis of a Vibrio cholerae rpoH Deletion Mutant

Leyla Slamti, Jonathan Livny, and Matthew K. Waldor*
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, 136 Harrison Avenue, Boston, Massachusetts 02111

... Promoter predictions were performed by using Bprom on the Softberry website (http://www.softberry.com/berry.phtml). Microarray accession number. ...


Applied and Environmental Microbiology,
January 2007, p. 390-398, Vol. 73, No. 2

Involvement of Pseudomonas aeruginosa Rhodanese in Protection from Cyanide Toxicity

Rita Cipollone et al.,
Dipartimento di Biologia, Universita Roma Tre, Viale G. Marconi 446, 00146 Rome, Italy

... promoter elements was predicted by the Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) and BPROM (Softberry Inc.) software ...


Archives of Microbiology
Volume 187, Number 1 / January, 2007 67-77

Multiple regulators of the Flavohaemoglobin (hmp) gene of Salmonella enterica serovar Typhimurium include RamA, a transcriptional regulator conferring the multidrug resistance phenotype

Elizabeth Hernandez-Urzua et al.,
Laboratorio de Microbiologia y Genetica Molecular, Departamento de Biologia Molecular y Biotecnologia, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico, P.O. Box 70-228, Coyoacan, Mexico City, 04510, Mexico

... 1). Interestingly, a very recent and independent in silico study using theBacterial PROMoter prediction program BPROM (http://www.softberry.com) arrived at the ...


Cellular Microbiology,
Volume 9, Number 4, April 2007 , pp. 1039-1049(11)

Bile salts induce expression of the afimbrial LDA adhesin of atypical enteropathogenic Escherichia coli

Torres, Alfredo G et al.,
Departments of Microbiology and Immunology, and 2: Pathology, University of Texas Medical Branch, Galveston, TX?77555-1070, USA.

... found within the lda locus using BPROM, which is a bacterial promoter recognition program with about 80% accuracy and specificity (http://www.softberry.com). ...


Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753

Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture

Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States

... the sequences for bacterial promoters and rho-independent transcription termination sites was performed using BPROM and FindTerm, available at www.softberry.com ...


Canadian Journal of Microbiology,
Volume 53, Number 3, 1 March 2007 , pp. 417-426(10)

Comparison of transformation protocols in Streptococcus gordonii and evaluation of native promoter strength using a multiple-copy plasmid

Warren, Travis K.; Lund, S. A.; Jones, Kevin F.; Hruby, Dennis E.
... start (TIGR 2006). The internet program BPROM at www. softberry.com/berry. phtml identified two sequences, TTGACA and ATATATAAT,


Environmental Microbiology
Volume 8 Issue 8 Page 1460-1470, August 2006

Diversity of polyketide synthase genes from bacteria associated with the marine sponge Pseudoceratina clavata: culture-dependent and culture-independent approaches

Tae Kyung Kim and John A. Fuerst
School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Qld 4072, Australia

... at ?79 (AGTGACACT) and ?96 (TTCACG) positions using a bacterial promoter prediction program BPROM (available at the web site http:/ / www.softberry.com ). ...


Extremophiles
Volume 10, Number 4 / August, 2006 301-310

Characterization of a b-glycosidase from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius

Barbara Di Lauro 1, Mose Rossi 1, 2 and Marco Moracci 1
(1) Institute of Protein Biochemistry, Consiglio Nazionale delle Ricerche, Via P. Castellino 111, 80131 Naples, Italy
(2) Dipartimento di Biologia Strutturale e Funzionale, Universita di Napoli “Federico II”, Complesso Universitario di Monte S. Angelo, Via Cinthia 4, 80126 Naples, Italy

... 2a). The program BPROM for the prediction of bacterial pro- moters (http://www. softberry.com/berry.phtml) revealed only one possible cassette of A10 and A35 ...


Journal of Biochemistry
2006 140(3):429-438; doi:10.1093/jb/mvj168

Homologous Response Regulators KvgA, KvhA and KvhR Regulate the Synthesis of Capsular Polysaccharide in Klebsiella pneumoniae CG43 in a Coordinated Manner

Ching-Ting Lin, Teng-Yi Huang, Wan-Chun Liang and Hwei-Ling Peng*
Department of Biological Science and Technology, National Chiao Tung University, 75 Po-Ai Street, Hsin Chu 30050, Taiwan, Republic of China

... The BPROM program (http://www.softberry.com) used to analyze the sequences of the P kvgAS , P kvhAS , and P kvhR did not identify any cis-element, indicating ...


BMC Microbiology
2006, 6:104 doi:10.1186/1471-2180-6-104

Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome

Catherine E Chambers, Erika I Lutter, Michelle B Visser, Peggy PY Law and Pamela A Sokol*
Address: Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada

..Potential promoter elements were identified using BPROM [44]. 44. Softberry (www.softberry.com). . ...


Molecular Microbiology
Volume 62 Issue 3 Page 794-810, November 2006

Thiosulphate oxidation in the phototrophic sulphur bacterium Allochromatium vinosum

Daniela Hensen, Detlef Sperling, Hans G. Truper, Daniel C. Brune, Christiane Dahl
1Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany.
2Department of Chemistry and Biochemistry, Arizona State University, PO Box 871604, Tempe, AZ 85287-1604, USA.

... Manager (SES central) software. Promoter prediction was performed using bprom at http:/ / www.softberry.com . Similarity searches were ...


Journal of Microbiological Methods
Volume 66, Issue 2, August 2006, Pages 276-285

Genomic flank-sequencing of plasposon insertion sites for rapid identification of functional genes

Johan H.J. Leveaua, Saskia Gerardsa, Kathrin Fritschea, Gerben Zondagb and Johannes A. van Veena
Netherlands Institute of Ecology (NIOO-KNAW), Department of Terrestrial Microbial Ecology, Boterhoeksestraat 48, 6666 GA Heteren, The Netherlands BaseClear, Leiden, The Netherlands

... DNA sequences were analyzed using Lasergene software (DNASTAR, Madison, WI). Promoter searches were performed using Softberry's BPROM (www.softberry.com). ...


Infection and Immunity
November 2006, p. 6171-6178, Vol. 74, No. 11

Hierarchy of Iron Uptake Systems: Yfu and Yiu Are Functional in Yersinia pestis

Olga Kirillina, Alexander G. Bobrov, Jacqueline D. Fetherston, and Robert D. Perry*
Department of Microbiology, Immunology, and Molecular Genetics, University of Kentucky, Lexington, Kentucky

... Sequence analysis. Nucleotide sequences were analyzed for promoters using the web-based program BPROM (www.softberry.com). Predictions ...


Applied and Environmental Microbiology,
November 2006, p. 6994-7002, Vol. 72, No. 11

Transcriptional Regulation of the pdt Gene Cluster of Pseudomonas stutzeri KC Involves an AraC/XylS Family Transcriptional Activator (PdtC) and the Cognate Siderophore Pyridine-2,6-Bis(Thiocarboxylic Acid)

Sergio E. Morales and Thomas A. Lewis*
Department of Microbiology and Molecular Genetics, University of Vermont, Burlington, Vermont 05405

... The DNA and protein sequence analysis software used were Sequencher (Gene Codes, Ann Arbor, MI), BPROM (Softberry, Inc., Mount Kisco, NY), GenomeMatScan (http ...


Journal of Bacteriology ,
July 2006, p. 5089-5100, Vol. 188, No. 14

Molecular Characterization of Pantoea stewartii subsp. stewartii HrpY, a Conserved Response Regulator of the Hrp Type III Secretion System, and its Interaction with the hrpS Promoter

Massimo Merighi,1, Doris R. Majerczak,1 Michael Zianni,2 Kimberly Tessanne,2 and David L. Coplin1*
Department of Plant Pathology and the Plant Molecular Biology and Biotechnology Program,1 Plant-Microbe Genomic Facility, The Ohio State University, Columbus, Ohio 432102

... Promoter and DNA binding site predictions were determined with BPROM (http://www. softberry.com/), PromScan (http://molbiol-tools.ca/mtoolwww-cgi/promscan.cgi ...


Appl Environ Microbiol. ,
2006 April; 72(4): 2539-2546

Cloning and Sequencing of the ompA Gene of Enterobacter sakazakii and Development of an ompA-Targeted PCR for Rapid Detection of Enterobacter sakazakii in Infant Formula

Manoj Kumar Mohan Nair and Kumar S. Venkitanarayanan*
Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 06269

.... in Table 2. The sequences generated were analyzed by Sequencher 4.1.4 (Gene Codes Corporation, Ann Arbor, Mich.), BPROM (http://www.softberry.com), SignalP ...


PNAS ,
August 22, 2006 vol. 103 no. 34 12897-12902

Deletion of TolC orthologs in Francisella tularensis identifies roles in multidrug resistance and virulence

Gil et al.,
Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120

... 42). The locations of promoters and operons were investigated by using the FGENESB and BPROM programs available from Softberry (Mt. Kisco, NY). ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis

Grieshaber, Nicole A.1; Grieshaber, Scott S.1; Fischer, Elizabeth R.2; Hackstadt, Ted
Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an ?120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


Applied and Environmental Microbiology,
January 2006, p. 368-377, Vol. 72, No. 1

Cloning and Expression of a Xylitol-4-Dehydrogenase Gene from Pantoea ananatis

J. S. Aarnikunnas,1* A. Pihlajaniemi,2 A. Palva,1 M. Leisola,2 and A. Nyyssola2
Division of Microbiology and Epidemiology, Department of Basic Veterinary Sciences, Faculty of Veterinary Medicine, P.O. Box 66, FIN-00014 University of Helsinki, Finland,1 Laboratory of Bioprocess Engineering, Department of Chemical Technology, Helsinki University of Technology, P.O. Box 6100, FIN-02015 Espoo, Finland2

... uk/blast2/]). The BPROM program (SoftBerry Inc.) was used to localize putative promoter regions in the sequences. The protein sequences ...


Journal of Bacteriology,
January 2006, p. 789-793, Vol. 188, No. 2

Autorepression of RctB, an Initiator of Vibrio cholerae Chromosome II Replication

Elizabeth S. Egan, Stephane Duigou, and Matthew K. Waldor
Genetics Program and Department of Molecular Microbiology, Tufts University School of Medicine and Howard Hughes Medical Institute, 136 Harrison Ave., Boston, Massachusetts 02111

.. BPROM, a computer program designed to identify sigma 70-dependent promoters for bacterial genes (SoftBerry, Mount Kisco, NY), predicted -10 and -35 sites ...


FEBS Journal
Volume 272 Issue 24 Page 6324 - 6335. December 2005

Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath).

Odd A. Karlsen1 et al.,
1 Department of Molecular Biology, University of Bergen, Norway
2 Computational Biology Unit, Bergen Centre for Computational Science, Norway

... fruitfly.org/ seq_tools/ promoter.html ) and bprom available at http://www.softberry.com ... In Microbial Growth on C1 Compounds (Murrell JC &Kelley DP, eds), ...


Extremophiles
Issue: Volume 9, Number 2 Date: April 2005 Pages: 99 - 109 DOI: 10.1007/s00792-004-0425-0

The genome of BCJA1c: a bacteriophage active against the alkaliphilic bacterium, Bacillus clarkii

Andrew M. Kropinski1, Melissa Hayward1, M. Dorothy Agnew1 and Ken F. Jarrell1
(1) Department of Microbiology and Immunology, Queens University, Kingston, ON, K7L 3N6, Canada

... al. 2002). Promoters were predicted using Softberry's BPROM program at http://www.softberry. com/berry. phtml?topic=promoter. ...


Journal of Bacteriology,
February 2005, p. 1091-1104, Vol. 187, No. 3 0021-9193/05/$08.00+0 doi:10.1128/JB.187.3.1091-1104.2005

The Generalized Transducing Salmonella Bacteriophage ES18: Complete Genome Sequence and DNA Packaging Strategy

Sherwood R. Casjens et al.,
Department of Pathology, University of Utah Medical School, Salt Lake City, Utah,1 Department of Biological Sciences,4 Pittsburgh Bacteriophage Institute, University of Pittsburgh, Pittsburgh, Pennsylvania ,2 Institut fur Genetik und Mikrobiologie, Universitat Munchen, Munich, Germany3

... The DNA sequence analysis software used was DNA Strider (24), GeneMark (5), Staden programs (78), BLAST (2), BPROM (http://www.softberry.com/berry.phtml?topic ...


Infection and Immunity,
May 2005, p. 2899-2909, Vol. 73, No. 5

Characterization of the Major Secreted Zinc Metalloprotease- Dependent Glycerophospholipid:Cholesterol Acyltransferase, PlaC, of Legionella pneumophila

Sangeeta Banerji,1 Mayte Bewersdorff,1, Bjorn Hermes,1, Nicholas P. Cianciotto,2 and Antje Flieger1*
Robert Koch-Institut, Berlin, Germany,1 Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois2

... legion.) (12). Nucleotide sequences were also analyzed for promoters using the web-based program BPROM (www.softberry.com). Sequence ...


Journal of Bacteriology,
April 2005, p. 2458-2468, Vol. 187, No. 7

The Type III-Dependent Hrp Pilus Is Required for Productive Interaction of Xanthomonas campestris pv. vesicatoria with Pepper Host Plants

Ernst Weber et al.,
Institute of Genetics,1 Biozentrum, Martin Luther University, Halle, Germany,4 General Microbiology, Faculty of Biosciences, University of Helsinki, Helsinki, Finland,2 Institut des Sciences Vegetales, CNRS, Gif-sur-Yvette, France3

... The promoter recognition program BPROM (Softberry, Inc., Mt. Kisco, NY) was used for prediction of bacterial sigma70 promoter motifs. RESULTS. ...


FEMS Microbiology Letters
2005, Volume 248 Issue 1, Pages 1 - 8

RelA alone appears essential for (p)ppGpp production when Neisseria gonorrhoeae encounters nutritional stress

Scott D. Fisher a , Andrew D. Reger a , Atalie Baum a , Stuart A. Hill* a
a Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA

... Puta- tive promoters and gene expression regulatory motif sequences were determined using the BPROM analysis program housed at: http://www.softberry.com/berry. ...


FEMS Microbiol Lett.
2005 Jul 15;248(2):199-205

Characterization of IS1501 mutants of Leptospira interrogans serovar pomona

Zuerner RL, Trueba GA.
National Reference Center for Leptospirosis, Bacterial Diseases of Livestock Research Unit, National Animal Disease Center, USDA, ARS, P.O. Box 70, Ames, IA 50010, USA

... and the data analyzed using Clone Manager 7 and Primer Designer 5 (Scien- tific and Educational Software), BLAST [24], and BPROM (http://www.softberry.com/).


Journal of Bacteriology
June 2005, p. 4005-4014, Vol. 187, No. 12

Characterization of the Small Untranslated RNA RyhB and Its Regulon in Vibrio cholerae

Davis et al.,
Howard Hughes Medical Institute,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 021112

... MacVector (Accelrys). Promoter prediction was done with BPROM (Softberry, Inc., Mt. Kisco, NY). Microarray analyses. Paired cultures ...


Can J Microbiol.
2005 Oct;51(10):821-3

Characteristics of adjacent family 6 acetylxylan esterases from Fibrobacter succinogenes and the interaction with the Xyn10E xylanase in hydrolysis of acetylated xylan

Kam DK, Jun HS, Ha JK, Inglis GD, Forsberg CW.
Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON, Canada

... The putative -10 and -35 pro- moter sequences of axe6A and axe6B shown in Fig. 1 were predicted by using the program BPROM (http://www.softberry. ...


FEMS Microbiology Letters
2005, Volume 251 Issue 1, Pages 29 - 36

Transcriptional regulation of the S-layer protein type I secretion system in Caulobacter crescentus

Michael C. Toporowski a , John F. Nomellini a , Peter Awram a , Assaf Levi b , John Smit a, *
a University of British Columbia, Department of Microbiology and Immunology, Vancouver, B.C. Canada V6T 1Z3 b University of Basel, Division of Molecular Microbiology, Basel, Switzerland

... Fig. 1. In-silico predicted rsaD promoter orientation and binding sites: (a) prediction of the rsaD promoter using the Softberry BPROM program. ...


Journal of Bacteriology,
November 2004, p. 7411-7419, Vol. 186, No. 21

Use of In Vivo Expression Technology To Identify Genes Important in Growth and Survival of Pseudomonas fluorescens Pf0-1 in Soil: Discovery of Expressed Sequences with Novel Genetic Organization

Mark W. Silby and Stuart B. Levy*
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts

...Promoter searches were carried out by using SoftBerry software...
...An examination of the 1,486 bp of intergenic sequence upstream of the Pflu4867 gene with SoftBerry software suggests the presence of two predicted promoters, both in the correct orientation to drive expression of Pflu4867 and both within the region contained in the iiv6 fusion...
... Candidate promoters were detected by SoftBerry software upstream of the iiv1, iiv5, iiv12, iiv14, and iiv19 ORFs....


J Bacteriol.
2004 September; 186(17): 5945-5949. doi: 10.1128/JB.186.17.5945-5949.2004.

Identification of Operators and Promoters That Control SXT Conjugative Transfer

John W. Beaber and Matthew K. Waldor*
Department of Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, Boston, Massachusetts

...Computer algorithms and 5? random amplification of cDNA ends (RACE) were used to define the setR and s086 transcription start sites. Software for the identification of bacterial promoters (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) identified putative ?10 and ?35 elements for both PL and PR (Fig. 2) (23, 24)...


Antimicrobial Agents and Chemotherapy
October 2004, p. 4042-4046, Vol. 48, No. 10

CARB-9, a Carbenicillinase Encoded in the VCR Region of Vibrio cholerae Non-O1, Non-O139 Belongs to a Family of Cassette-Encoded b-Lactamases

Petroni et al.,
Servicio Antimicrobianos, Dpto. Bacteriologia, Instituto Nacional de Enfermedades Infecciosas-ANLIS "Dr. Carlos G. Malbran," Buenos Aires, Argentina,1 Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada2

... 35 and -10) and the RBS reported previously are shown in boldface, and those identified in this work (the BPROM program, http://www.softberry.com/berry.phtml ...


JOURNAL OF BACTERIOLOGY,
Mar. 2004, p. 1818-1832 Vol. 186, No. 6

The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca

Sherwood R. Casjens,1,2* Eddie B. Gilcrease,1 Wai Mun Huang,1 Kim L. Bunny,3
Marisa L. Pedulla,2,4 Michael E. Ford,2,4 Jennifer M. Houtz,2,4 Graham F. Hatfull,2,4 and Roger W. Hendrix2,4
Department of Pathology, University of Utah Medical School, Salt Lake City, Utah 841321; Pittsburgh Bacteriophage Institute2 and Department of Biological Sciences,4 University of Pittsburgh, Pittsburgh, Pennsylvania 15260; and Section of Microbiology, University of California at Davis, Davis, California 956163

...The DNA sequence analysis software packages used were DNA Strider (27), GeneMark (8), the Staden programs (94), BLAST (3), BPROM http://www.softberry.com/berry.phtml?topic_gfindb), and DNA Master (J. Lawrence [http://cobamide2.bio.pitt.edu/])....


BMC Microbiology
2004, 4:4

Analysis of the lambdoid prophage element e14 in the E. coli K-12 genome

Preeti Mehta1, Sherwood Casjens2 and Sankaran Krishnaswamy*1
Bioinformatics Centre, School of Biotechnology, Madurai Kamaraj University, Madurai-625021, India and 2University of Utah Medical School, Department of Pathology, 90 North 1900 East, Salt Lake City UT 84132-2501, USA

... Putative promoters predicted using BPROM available at the website http:// www.softberry.com. Scores are as given by BPROM. Promoters ...


PNAS
July 27, 2004 vol. 101 no. 30 11013-11018

Transfer of photosynthesis genes to and from Prochlorococcus viruses

Lindell et al.,
Departments of *Civil and Environmental Engineering and ¶Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; ‡Joint Program in Biological Oceanography, Woods Hole Oceanographic Institution and Massachusetts Institute of Technology, Cambridge, MA 02139; and §Department of Biology, San Diego State University, San Diego, CA 92182

... 10 and a tail score of <-5. Potential bacterial ? 70 promoters were identified in intergenic regions by using the program bprom (SoftBerry, Mount Kisco, NY ...


Plant Molecular Biology
53 (6): 865-876, December 2003

Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase

Allison E. McDonald, Sasan Amirsadeghi, Greg C. Vanlerberghe
Department of Life Sciences and Department of Botany, University of Toronto at Scarborough, 1265 Military Trail, Scarborough, Ontario, M1C 1A4 Canada

... The A. variabilis PTOX sequence was analyzed in the upstream region of the start codon with Softberry's BPROM software (http://www.softberry.com). ..


FindTerm

Microbiology
2014, 160(Pt 2), 287-295. DOI:10.1099/mic.0.073783-0

Expression of the six chromate ion transporter homologues of Burkholderia xenovorans LB400

Acosta-Navarrete Y. M. et al.,
1 Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico 2 Laboratorio Estatal de Salud Publica, Secretaria de Salud de Michoacan, Morelia, Michoacan, Mexico

... software (http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators were searched using the program FindTerm (Softberry). Bacterial growth and susceptibility tests. Bacteria were grown routinely by diluting 1 ...


Journal of virology
2014, 88(5), 2461-2480. DOI:10.1128/JVI.03363-13

Cluster M mycobacteriophages Bongo, PegLeg, and Rey with unusually large repertoires of tRNA isotypes

Pope W. H. et al.,
a Department of Biological Sciences, University of Pittsburgh, Pittsburgh, Pennsylvania, USA b Department of Biology, Gonzaga University, Spokane, Washington, USA

... programs. Dot plots were constructed using the Gepard program (27), and further bioinformatic analyses were performed using the DNA Master, FindTerm (Softberry), Splitstree (28), GLAM2, GLAM2SCAN, and MEME (29) programs. ...


Microbiology
April 2013 vol. 159 no. Pt 4 665-677 DOI:10.1099/mic.0.063396-0

The regulatory mechanism of 2,4,6-trichlorophenol catabolic operon expression by HadR in Ralstonia pickettii DTP0602

Torii et al.,
1Department of System Science, Graduate School of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan 2Department of Biomedical Engineering, Faculty of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan

... The rho-independent terminator was predicted with FindTerm (Softberry; http://linux1. softberry.com/berry.phtml). ... The presence of rho-independent terminator in the R1 and R10 regions was sought using FindTerm (Softberry), but not located. ...


Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


Antonie van Leeuwenhoek
Volume 104, Issue 6 , pp 941-948 DOI:10.1007/s10482-013-0013-3

An Lrp-type transcriptional regulator controls expression of the Bacillus subtilis chromate transporter

Aguilar-Barajas et al.,
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Mich., Mexico 3. Genomica Alimentaria, Universidad de la Cienega, Sahuayo, Mich., Mexico 2. Depto. Bioquimica, Facultad de Medicina, Universidad Nacional Autonoma de Mexico, Mexico, D.F., Mexico

... bin/seq_tools/promoter.pl). Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc., New York, NY, USA). Cloning of the ywrC-chr3N-chr3C gene cluster. The ywrC-chr3N-chr3C gene ...


Microbiology
November 2013 mic.0.073783-0 DOI:10.1099/mic.0.073783-0

Expression of the Six CHR Chromate Ion Transporter Homologues of Burkholderia xenovorans LB400

Acosta-Navarrete et al.,
1 Universidad Michoacana; 2 Laboratorio Estatal de Salud Publica

... Putative promoter sequences were identified employing PromScan software 109 (http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators were 110 searched using the program FindTerm (Softberry Inc.). 111 112 Bacterial growth and susceptibility tests ...


Microbiology
April 2013 vol. 159 no. Pt 4 691-700 DOI:10.1099/mic.0.064741-0

A Q-like transcription factor regulates biofilm development in Escherichia coli by controlling expression of the DLP12 lysis cassette

Karl-Gustav Rueggeberg 1, Faustino A. Toba 1, Mitchell G. Thompson 1, Bryan R. Campbell 1 and Anthony G. Hay 1,2
1Department of Microbiology, Cornell University, Ithaca, NY 14853, USA 2Institute for Comparative and Environmental Toxicology, Cornell University, Ithaca, NY 14853, USA

... Antiterminator predictions. essDp sequence encompassing 400 bp upstream of the translation start site was analysed for the presence of putative Rho-independent transcriptional terminators using FindTerm software from Softberry (Hagen et al., 2010). ...


Research in Microbiology
Volume 164, Issue 10, December 2013, Pages 979–986 DOI:10.1016/j.resmic.2013.08.007

Characterization and complete genome sequence of the Shigella bacteriophage pSf-1

Jun et al.,
a Laboratory of Aquatic Biomedicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 151-742, Republic of Korea b Korea Institute of Ocean Science & Technology, Ansan 426-744, Republic of Korea

... promoter.html) (minimum promoter score: 0.9). Rho-independent transcription terminators were identified using FindTerm programs (http://www.softberry.ru) (energy threshold value: ?11). Additional characteristics of the putative ...


Microbiology
May 2013 mic.0.063776-0 DOI:10.1099/mic.0.063776-0

Isolation, characterization and complete genome sequence of PhaxI: a phage of Escherichia coli O157:H7

Shahrbabak et al.,
1 Tehran University of Medical Sciences; 2 University of Helsinki; 3 Laval University

... 2004; Schattner et al., 2005). To find Rho-independent terminators, TransTerm 230 (Ermolaeva et al., 2000) and FindTerm (SoftBerry) were used. PHIRE was also used 231 to find phage regulatory elements (Lavigne et al., 2004). The genomic map was 232 ...


Current Microbiology
Volume 66, Issue 6 , pp 535-543 DOI:10.1007/s00284-013-0308-7

Characterization and Genome Sequencing of Phage Abp1, a New phiKMV-Like Virus Infecting Multidrug-Resistant Acinetobacter baumannii

Huang et al.,
1. Department of Microbiology, Third Military Medical University, Chongqing, 400038, China 2. Institute of Burn Research, Southwest Hospital, Third Military Medical University, Chongqing, China

... Bacte- riophage-specific promoters were determined using Neural Network Promoter Prediction [29] and PHIRE [30]. Tran- scriptional termination sites were determined using the FindTerm program (http://www.softberry.ru/berry.phtml). ...


PloS one
(2013). 8(5), e62933. DOI:10.1371/journal.pone.0062933

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

Lu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, China

...Predicted promoter regions were identified using neural network promoter prediction [51], and putative terminator structures were identified using the web tool FindTerm (http://linux1.softberry.com/berry.phtml)....


BMC genomics
(2013). 14(1), 849. DOI:10.1186/1471-2164-14-849

The Clostridium small RNome that responds to stress: the paradigm and importance of toxic metabolite stress in C. acetobutylicum

Venkataramanan et al.,
1 Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE, USA 2 Delaware Biotechnology Institute, University of Delaware, Newark, DE, USA

...Rho independent terminators were predicted using RNAmotif [90], Erpin [91] and Findterm (http://www.softberry.com webcite). ...


J. Virol.
August 2012 vol. 86 no. 16 8781-8792 doi: 10.1128/JVI.00446-12

Genome, Integration, and Transduction of a Novel Temperate Phage of Helicobacter pylori

Cheng-Hung Luo a, Pei-Yu Chiou a, Chiou-Ying Yang b and Nien-Tsung Lin c
aInstitute of Medical Sciences, Tzu Chi University, Hualien, Taiwan bInstitute of Molecular Biology, National Chung Hsing University, Taichung, Taiwan

... Putative ?-independent transcriptional terminators were analyzed as a potential stem-loop structure followed by a uracil-rich stretch with a stable secondary structure (?G < ?10 kcal/mol) using the FindTerm program on the SoftBerry website. ...


Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 464-471 DOI: 10.1128/AAC.00602-11

Identification of Hopanoid Biosynthesis Genes Involved in Polymyxin Resistance in Burkholderia multivorans

Rebecca J. Malott, Barbara R. Steen-Kinnaird, Tracy D. Lee and David P. Speert
Centre for Understanding and Preventing Infection in Children, Department of Pediatrics, University of British Columbia, Vancouver, British Columbia, Canada

.. Lynnon Biosoft, Vaudreuil, Quebec, Canada). Additional in silico promoter and terminator predictions were performed with BPROM and FindTerm (Softberry, Inc., Mount Kisco, NY). Sequence similarity searches were performed ...


PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709

The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae

Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain

...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...


World Journal of Microbiology and Biotechnology
Volume 28, Issue 3 , pp 865-869 DOI 10.1007/s11274-011-0883-3

The ChrA homologue from a sulfur-regulated gene cluster in cyanobacterial plasmid pANL confers chromate resistance

Esther Aguilar-Barajas (1) (2) Paulina Jeronimo-Rodriguez (1) Martha I. Ramirez-Diaz (1) Christopher Rensing (2) Carlos Cervantes (1)
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Michoacan, Mexico 2. Department of Soil, Water, and Environmental Science, University of Arizona, Tucson, AZ, USA

... Promoter sequences were searched with the Neural Network Promoter Predic- tion (http://www.fruitfly.org/cgi-bin/seq_tools/promoter.pl software. Rho-independent terminators were predicted with the FindTerm (Softberry Inc.) program. ...


Archives of Virology
Volume 157, Issue 2 , pp 391-395 DOI 10.1007/s00705-011-1175-9

Complete genomic sequence of a T4-like bacteriophage, phiAS4, infecting Aeromonas salmonicida subsp. salmonicida

J. H. Kim et al.,
1. Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, Korea 2. Basic Science Institute for Cell Damage Control, Sogang University, Seoul, 121-742, Korea

... 13]. Rho-independent transcription terminators were also pre- dicted using the FindTerm program (http://www.softberry.ru/ berry.phtml?topic=findterm&group= programs&subgroup= gfindb) (energy threshold value: -11). Additional ...


BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain 2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain

... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...


Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002

IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany 2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile

... to GenBank sequences. Additional searches for genes, operons, promoters, and terminators were done using FGENESB, BPROM, and FindTerm at www.softberry. com (Softberry, Mount Kisco, NY, USA). The sequence data ...


PLoS ONE
7(5): e38283. (2012) doi:10.1371/journal.pone.0038283

Molecular Characterization of Podoviral Bacteriophages Virulent for Clostridium perfringens and Their Comparison with Members of the Picovirinae.

Volozhantsev NV et al.,
1 State Research Center for Applied Microbiology and Biotechnology, Obolensk, Moscow region, Russian Federation, 2 Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, Athens, Georgia, United States of America,

...Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.gatech.edu/GeneMark) [73] and SoftBerry FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs. ... Putative promoters were analyzed by using Martin Reese's neural network prediction program at http://www.fruitfly.org/seq_tools/promot?er.html and BPROM (Softberry, Inc., Mount Kisco, NY, USA) at its website http://linux1.softberry.com/berry.phtml. Potential transcriptional terminators were assessed using the software programs TransTerm at the Nano+Bio-Center (http://nbc3.biologie.uni-kl.de) and FindTerm (Softberry, Inc., Mount Kisco, NY, USA) at the web site http://linux1.softberry.com/berry.phtml. ...


Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002

Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes

M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico

... Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc.). ... Search for genomic islands was made using CpG finger program from Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...


RNA Biology
Volume 8, Issue 1 January/February 2011 Pages 11 - 13 DOI: 10.4161/rna.8.1.13346

ARNold: A web tool for the prediction of Rho-independent transcription terminators

Magali Naville, Adrien Ghuillot-Gaudeffroy, Antonin Marchais and Daniel Gautheret
Univ. Paris-Sud, Institut de Genetique et Microbiologie, Orsay Cedex, France

... search to intergenic regions, which makes it unfit for certain applications, including detection of transcriptional attenuators that occur after gene starts. Other available tools include com- mercial programs such as Softberry's Findterm (www.softberry. ...


Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142

Complete genome sequence of the lytic Pseudomonas fluorescens phage fjIBB-PF7A

Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga, Portugal

... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/ tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly. org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ... ...Terminators were predicted using FindTerm http://linux1.softberry. com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...


Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050

The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay

Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening of serotype-specific gene. Cross-hybridization experiments ...


FEMS Microbiology Letters
(2011), 324: 117–124. doi: 10.1111/j.1574-6968.2011.02394.x

Genetic analysis of the capsular polysaccharide synthesis locus in 15 Streptococcus suis serotypes.

Wang, K., Fan, W., Cai, L., Huang, B. and Lu, C.
1Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, China 2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Sequence annotation and bioinformatic analysis. The promoters and terminators of the sequenced cps locus were predicted using the bprom and findterm program (http://linux1.softberry.com/berry. phtml), respectively. ORFs were analyzed using the vectornt? program. ...


International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019

Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus

Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... Presence of putative promoters, terminators and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter. html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...


BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198

Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny

Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden

... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70- promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...


Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166

Antisense RNA associated with biological regulation of a restriction–modification system

Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences

... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator prediction were performed using the BPROM and FindTerm software, respectively (http://www.softberry.com/all.htm). RNA secondary structure ...


Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921

The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1

YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture

... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the & independent terminators were predicted using the BPROM and the FindTerm program respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...


J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11

A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550

Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland 2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy

... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique terminator region downstream of TTHA1327 were identified using BPROM and FindTerm (Softberry), respectively. Those findings showed that ...


PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108

Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence

Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611

...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the BProm and TermFind/RNAFold programs (Softberry)....


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...


Plasmid
Volume 63, Issue 2, March 2010, Pages 108-117

Sequence analysis of plasmid pIR52-1 from Lactobacillus helveticus R0052 and investigation of its origin of replication

Hagen et al.,
a Department of Research and Development, Institut Rosell Inc., 6100 Avenue Royalmount, Montreal, Que., Canada H4P 2R2 b Department of Biology, Utah State University, Logan, UT 84322-5305, USA

... To predict the presence of rho-independent terminators, the Softberry FindTerm program (version 2.8) was used (http://www.softberry.ru/berry.phtml?group=programs&subgroup= gfindb&topic=findterm). 2.7. Analysis of repA genes for repeat sequences. ... 


Journal of Bacteriology
October 2010, p. 5441-5453, Vol. 192, No. 20 doi:10.1128/JB.00709-10

Brochothrix thermosphacta Bacteriophages Feature Heterogeneous and Highly Mosaic Genomes and Utilize Unique Prophage Insertion Sites

Samuel Kilcher, Martin J. Loessner, and Jochen Klumpp
Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland

... Rho-independent bacterial transcription terminators were predicted by using Softberry FindTerm (http://www.softberry.ru/berry.phtml?topic=findterm&group=programs&subgroup= gfindb) using an energy threshold value of –11 (default setting). ... 


Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10

Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9

Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2

... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc., 234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator 236 sequences using BPROM and FindTerm programs (Softberry Inc.). ... 


Genomics
Volume 96, Issue 3, September 2010, Pages 167-172 doi:10.1016/j.ygeno.2010.06.001

Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii

Zhu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing 400038, China

... Bacteriophage-specific promoters were determined using Neural Network Promoter Prediction [32] and PHIRE [33]. Transcrptional termination sites were determined using FindTerm programs (http://www.softberry.ru/berry.phtml). ...


Microbiology
156 (2010), 2305-2315; DOI 10.1099/mic.0.038760-0

Detection and quantification of intergenic transcription in Mycoplasma hyopneumoniae

Stuart W. Gardner 1,2 and F. Chris Minion 1
1 Department of Veterinary Microbiology and Preventive Medicine, Interdepartmental Microbiology Program, Iowa State University, Ames, IA 50011, USA 2 Department of Statistics, Iowa State University, Ames, IA 50011, USA

... To identify stem–loop structures in the ig-072, ig-106, ig-282, ig-682 and ig-684 IG regions, SoftBerry FindTerm software was used. Heat-shock experimental design and data analysis. ... putative stem–loop structure as predicted by SoftBerry FindTerm software. ... 


BMC Microbiology
2010, 10:301doi:10.1186/1471-2180-10-301

Characterization of JG024, a pseudomonas aeruginosa PB1-like broad host range phage under simulated infection conditions

Garbe et al.,
1 Institute of Microbiology, Technische Universitat Braunschweig, Spielmannstr. 7, 38106 Braunschweig, Germany 2 DSMZ, German Collection of Microorganisms and Cell Cultures, Inhoffenstr. 7B, 38124 Braunschweig, Germany

... Two promoter regions were identified in this way. Rho-independent terminator structures were identified using the TransTerm [46] and FindTerm (Softberry, Inc.) software tools. The program MEME was used for identification of conserved intergenic motifs in phage JG024 [47]. ...


Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010

Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1 predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...


Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035

Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...


BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153

Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13

Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland

... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map of ICEclc was designed from SeqBuilder of the Lasergene software package ...


Food Microbiology
Volume 26, Issue 1, February 2009, Pages 52-57

Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis

Emmanuel Coton and Monika Coton
aADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France

... Prokaryotic promoter prediction was performed using the Internet site http://www.fruitfly.org/ seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm program at http://www.softberry.ru. 3. Results and discussion. 3.1. ...


Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080

Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing

Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA

... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table 2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...


Research in Microbiology
Volume 160, Issue 6, July-August 2009, Pages 401-408

Characterization of salivaricin CRL 1328, a two-peptide bacteriocin produced by Lactobacillus salivarius CRL 1328 isolated from the human vagina

Esteban Vera Pingitore, Elvira Maria Hebert, Maria Elena Nader-Macias and Fernando Sesma
aCentro de Referencia para Lactobacilos (CERELA–CONICET), Chacabuco 145 (T4000ILC), San Miguel de Tucuman, Tucuman, Argentina

... The presence of putative promoter elements was predicted by Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html). Transcriptional terminators were predicted with the FindTerm algorithm (http://www.softberry.ru/berry.phtml). ...


Journal of Bacteriology
February 2009, p. 1056-1065, Vol. 191, No. 3

Transcription of clpP Is Enhanced by a Unique Tandem Repeat Sequence in Streptococcus mutans

Jiaqin Zhang 1,2, Anirban Banerjee 1, and Indranil Biswas 1*
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160,1 Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong 250012, China2

... 55). The intergenic region between clpP and SMU.1671, which is 115 bp long, encodes a putative -independent terminator located between bp 85 and 109 that was identified by the FindTerm program (Softberry, Inc.). Figure ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


Journal of Bacteriology
doi:10.1128/JB.01436-08 JB Accepts, published online ahead of print on 1 December 2008

Transcription of clpP is enhanced by a unique tandem repeat sequence in Streptococcus mutans

Jiaqin Zhang, Anirban Banerjee, and Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160; Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong, 250012, P R China

... encodes a putative ?-independent terminator located between 85- and 109-bp that was identified 18 by FindTerm program (Softberry Inc.). 19 ...


Food Microbiology
doi:10.1016/j.fm.2008.07.009

Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis

Emmanuel Coton and Monika Coton
ADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France

... site http://www.fruitfly.org/seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm program at http://www.softberry.ru. ...


Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0

Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes

Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry. com), were used for operon and gene predictions. RESULTS. ...


Nucleic Acids Research
doi:10.1093/nar/gkm836 published online on October 16, 2007

Characterization of bacterial operons consisting of two tubulins and a kinesin-like gene by the novel Two-Step Gene Walking method

Martin Pilhofer et al.,
Lehrstuhl fur Mikrobiologie, Technical University Munich, Am Hochanger 4, D-85354 Freising, Germany

... The prediction of Rho-independent terminators was performed with the program FindTerm (www.softberry.com/berry.phtml?topic=findterm&group=programs&subgroup ...


Microbiology
153 (2007), 2148-2158;

ss-Dependent carbon-starvation induction of pbpG (PBP 7) is required for the starvation-stress response in Salmonella enterica serovar Typhimurium

William J. Kenyon et al.,
Department of Biomedical Sciences, University of South Alabama, Mobile, AL 36688, USA

... Relevant nucleotide sequences were retrieved using the NCBI's Entrez server. Bacterial terminator analysis was done using FindTerm (http://www.softberry.com/). ...


Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54

Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520

Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China

... Promoter and terminator predictions were performed using BPROM and FindTerm, respectively (http://www.softberry.com/berry.phtml). ...


Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753

Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture

Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States

... the sequences for bacterial promoters and rho-independent transcription termination sites was performed using BPROM and FindTerm, available at www.softberry.com ...


Journal of Bacteriology,
June 2006, p. 4362-4372, Vol. 188, No. 12

Characterization of a Novel Partition System Encoded by the d and w Genes from the Streptococcal Plasmid pSM19035

Micha Dmowski,* Izabela Sitkiewicz, and Piotr Cegowski
Department of Microbial Biochemistry, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawiskiego 5A, 02-106 Warsaw, Poland

... Despite the presence of a putative rho-independent terminator (FindTerm; Softberry) (positions 6281 to 6337 in pBT233), we wanted to confirm that and ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


Journal of Bacteriology,
January 2006, p. 160-168, Vol. 188, No. 1

Identification of the syr-syp Box in the Promoter Regions of Genes Dedicated to Syringomycin and Syringopeptin Production by Pseudomonas syringae pv. syringae B301D

Nian Wang,1, Shi-En Lu,1, Qingwu Yang,2 Sing-Hoi Sze,3 and Dennis C. Gross1*
Department of Plant Pathology and Microbiology,1 Department of Computer Science,2 Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 778433

... typical rho-independent terminators, located after the syrP-syrD-sypA-sypB operon and the syrC gene, were identified by the FindTerm program (Softberry) (Fig. ...


Journal of Bacteriology,
January 2006, p. 202-210, Vol. 188, No. 1

Reconstruction and Regulation of the Central Catabolic Pathway in the Thermophilic Propionate-Oxidizing Syntroph Pelotomaculum thermopropionicum

Tomoyuki Kosaka,1 Taku Uchiyama,1 Shun-ichi Ishii,1 Miho Enoki,1,2 Hiroyuki Imachi,3 Yoichi Kamagata,2 Akiyoshi Ohashi,3 Hideki Harada,3 Hiroshi Ikenaga,1 and Kazuya Watanabe1*
Laboratory of Applied Microbiology, Marine Biotechnology Institute, Kamaishi, Iwate 026-0001,1 Japan3

... were manually checked. Terminator sequences were analyzed using the FindTerm program (SoftBerry). Molecular weights and isoelectric ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis

Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


Bacterial Genomes Explorer

Theoretical and Applied Genetics
February 2013, DOI: 10.1007/s00122-013-2052-6

Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1

Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan 2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan

... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry. phtml) software was then used to allow the simultaneous comparison of distinct annotated genomes. Phylogenetic analysis. Protein sequence ...


Various programs

Bioprocess and biosystems engineering
2014, 37(2), 245-260. DOI:10.1007/s00449-013-0991-6

Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H2 blend

Kiriukhin, M., Tyurin, M.
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA 2. Ajinomoto-Genetika Research Institute, 1-st Dorozny pr. 1-1, Moscow, 117545, Russia

M Kiriukhin, M Tyurin - Bioprocess and biosystems engineering, 2014 - Springer ... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://?linux1.?softberry.?com/?). RT-PCR. ...


Journal of industrial microbiology & biotechnology
2014, 41(5), 763-781. DOI:10.1007/s10295-014-1416-5

Genome tailoring powered production of isobutanol in continuous CO2/H2 blend fermentation using engineered acetogen biocatalyst

Gak E., Tyurin M., Kiriukhin M.
2. Prosp. Andropova 19, kv. 27, 115470, Moscow, Russia 1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA

... 1 3 Promoter and terminator sequences for the components of all vectors Promoter and terminator sequences for the compo- nents of all vectors were identified using the softBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Rt-PcR ...


World Journal of Microbiology and Biotechnology
2014, 30(5), 1559-1574. DOI:10.1007/s11274-013-1579-7

UVC-mutagenesis in acetogens: resistance to methanol, ethanol, acetone, or n-butanol in recombinants with tailored genomes as the step in engineering of commercial biocatalysts for continuous CO2/H2 blend fermentations.

Kiriukhin M., Tyurin M., Gak E
State

... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). ...


Proceedings of the National Academy of Sciences, India Section B: Biological Sciences,
2014, 84(1), 131-143. DOI:

Organization and classification of cytochrome P450 genes in Castor (Ricinus communis L.).

Kumar, M. S., Babu, P. R., Rao, K. V., & Reddy, V. D.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, India

... The CYP proteins which are below 300 and above 600 amino acids were validated by using Softberry gene prediction tool (http://linux1.softberry. com/berry.phtml) by increasing the scaffold size to 2,000 bp upstream of 50 end. ...


Plant Systematics and Evolution
2014, 1-6. DOI: 10.1007/s00606-014-1066-0

Classification of cytochrome P450s in common bean (Phaseolus vulgaris L.)

Kumar, M. S., Chakravarthy, S. S., Babu, P. R., Rao, K. V., & Reddy, V. D.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500 007, India

... The CYP proteins which are below 300 and above 600 amino acids were validated using Soft- berry gene prediction tool (http://linux1.softberry.com/ berry.phtml) by increasing the scaffold size to 2,000 bp upstream of 50 end. ...


Tree Genetics &: Genomes
2014, 10(2), 399-409. DOI: 10.1007/s11295-013-0695-8

Structural organization, classification and phylogenetic relationship of cytochrome P450 genes in Citrus clementina and Citrus sinensis

Mittapelli, S. R., Maryada, S. K., Khareedu, V. R., & Vudem, D. R.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500 007, India

... Out-of- range CYP candidate proteins which are below 300 and above 600 amino acids were validated by using Softberry gene prediction tool (http://linux1.softberry.com/berry.phtml) by increasing the scaffold size to 2,000-bp upstream of 5? end. ...


Journal of Molecular Catalysis B: Enzymatic, 104, 23-28.
2014, 104, 23-28. DOI: 10.1016/j.molcatb.2014.03.001

Characterization of a novel cold-adapted phosphinothricin N-acetyltransferase from the marine bacterium Rhodococcus sp. strain YM12.

Wu G. et al.,
a State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China b Key Laboratory of Protection and Utilization of Biological Resources in Tarim Basin of Xinjiang Production and Construction Corps, College of Life Science, Tarim University, Alar 843300, Xinjiang, China

... 2.4. Gene analysis and cloning. DNA sequences were analyzed using the Softberry Gene Finding tool (http://linuxl.softberry.com/berry/). The DNA and protein sequence alignments were carried out using the Blast program (http://blast.ncbi.nlm.nih.gov/Blast). ...


Enzyme and Microbial Technology.
Volume 63, September 2014, Pages 64–70 DOI: 10.1016/j.enzmictec.2014.02.010

Characterization and site-directed mutagenesis of a novel class II 5-enopyruvylshikimate-3-phosphate (EPSP) synthase from the deep-sea bacterium Alcanivorax sp L27

Zhang Y. et al.,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, People's Republic of China b National Key Laboratory of Crop Genetic Improvement, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, People's Republic of China

... 2.4. Gene Analysis. The recombinant plasmid pUC-3.66k was sequenced by Genscript. (Nanjing, China), and the nucleotide sequences were analyzed using the Softberry Gene Finding tool (http://linuxl.softberry.com/berry/). ...


Microbiology
2014, mic.0.077818-0 DOI: 10.1099/mic.0.077818-0

Calcineurin phosphatase and phospholipase C are required for developmental and pathological functions in the citrus fungal pathogen Alternaria alternata.

Tsai H. C., Chung K. R.
Institute of Food and Agricultural Sciences, University of Florida, USA

... Open reading 23 Page 8. Microbiology 8 frame (ORF) and exon/intron positions were predicted using Softberry gene-finding software 1 (http://www.softberry.com). Fungal RNA was purified with Trizol reagent (Molecular Research 2 ...


Journal of Plant Biochemistry and Biotechnology
2014, , 1-5. DOI: 10.1007/s13562-014-0266-6

Development of intron-containing barnase gene (barnase-int) encoding a toxic protein to facilitate its cloning in bacterial cells

Mehrotra, A. K., Bhullar, S., Burma, P. K.
1. Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India

... Analysis of the promoter AEG1 using SOFTBERRY (www. softberry.com) showed that it contained sequences similar to ?10 and ?35 regions of prokaryotic promoters (Table 1). These putative bacterial promoters could possibly have been activated in E. coli cells. ...


Journal of experimental botany
2014, eru164. DOI: 10.1093/jxb/eru164

A novel gene, MdSSK1, as a component of the SCF complex rather than MdSBP1 can mediate the ubiquitination of S-RNase in apple

Yuan H et al.,
1 Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China 2 College of Horticulture, Shenyang Agricultural University, Shenyang 110866, China

... Mixtures were immunoblotted with anti-S-RNase. Sequence analysis. The gene analysis and chromosomal locations were searched using the apple genome database (http://genomics.research.iasma.it/, http://linux1.softberry.com/berry.phtml). ... ...and then the contig was annotated using Softberry (http://linuxl.softberry.com/berry.phtml). ...


Food chemistry
2014, 162, 229-234. DOI: 10.1016/j.foodchem.2014.04.069

A novel low-temperature-active pectin methylesterase from Penicillium chrysogenum F46 with high efficiency in fruit firming.

Pan X. et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China b National Animal Husbandry Extension Service, Beijing 100125, People’s Republic of China

... BLAST/). The promoter was predicted by the online eukaryote promoter prediction programme (http://www.fruitfly.org/seq_tools/promoter.html). The introns were predicted by softberry software (http://linux1.softberry.com/). The ...


World Journal of Microbiology and Biotechnology
2014, 30(1), 181-189. DOI: 10.1007/s11274-013-1436-8

Cloning and characterization of two allelic glyceraldehyde-3-phosphate dehydrogenase genes in Auricularia auricula-judae.

Fan X. et al.,
1. Institute of Applied Mycology, Huazhong Agricultural University, No. 1 Shizishan Rd., Wuhan, 430070, Hubei, China 2. Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, China

... The SoftBerry program (http://?linux1.?softberry.?com) was used to predict the amino acid sequence. Southern blot analysis. Approximately 20 ?g genomic DNA was digested separately using HindIII, EcoRI, BssHII, or MaeI, and fractionated on 0.8 % (w/v) agarose gels. ...


FEMS microbiology letters
16 APR 2014 DOI: 10.1111/1574-6968.12435

Genomic analysis of Pseudomonas aeruginosa PA96, the host of carbapenem resistance plasmid pOZ176.

Deraspe, M. et al.,
1 Centre de Recherche en Infectiologie, CHU de Quebec, Quebec, QC, Canada 2 Departement de Biochimie, de microbiologie, et de bio-informatique, Universite Laval, Quebec, QC, Canada

... Additional software, including is finder (http://www-is.biotoul.fr), gcg (Version 11.1; Accelrys Inc., San Diego, CA), and various Softberry programs (http://linux1.softberry.com/berry.phtml), were used for analysis of features such as IS elements and genomic islands. ...


PloS one
2014, 9(4), e94430. DOI: 10.1371/journal.pone.0094430

Cloning and Characterization of TaPP2AbB"-a, a Member of the PP2A Regulatory Subunit in Wheat

Liu D. et al.,
State National Key Facility for Crop Gene Resources and Genetic Improvement/Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China

... Sequence alignments and comparisons were implemented by the MegAlign program in DNAStar and DNAman. Protein predictions were performed using Softberry (http://www.softberry.com). Subcellular localization of TaPP2AbB"-? protein. ...


PloS one
2014, 9(7), e101033. DOI: 10.1371/journal.pone.0101033

Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

Heindorf, M., Kadari, M., Heider, C., Skiebe, E., & Wilharm, G.
Robert Koch-Institute, Wernigerode Branch, Wernigerode, Germany

... 2714817 to 2715729. This region includes A1S_2343 as well as the putative promotor and terminator region of the gene as identified using the softberry package available online (http://linux1.softberry.com/berry.phtml). The PCR ...


Molecular Genetics and Genomics
2014, 289(3), 361-372. DOI: 10.1007/s00438-014-0815-7

Comparative analysis of alternative splicing, alternative polyadenylation and the expression of the two KIN genes from cytoplasmic male sterility cabbage (Brassica oleracea L. var. capitata L.)

Tao P. et al.,
1. Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China 2. College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China

... l. The transcription start site (TSS) of each KIN gene was predicted using SoftBerry (http://linux1.softberry.com/ berry.phtml). ... expression. at first, we used SoftBerry to predict the transcription start site (TSS) of the two KIN genes. ...


Microbiological research
2014, 169(5), 453-462 DOI: 10.1016/j.micres.2013.08.004

Cloning, expression and phylogenetic analysis of a divergent laccase multigene family in Auricularia auricula-judae

Fan X. Z. et al.,
a Institute of Applied Mycology, Huazhong Agricultural University, No. 1 Shizishan Rd., Wuhan 430070, Hubei, China b Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, China

... Corporation (Nanjing, China). DNAMAN version 5.2.2 software was used for sequences analysis and assembly. The SoftBerry program (http://linux1.softberry.com) was used to predict the amino acid sequence. The deduced amino ...


Plant molecular biology
July 2014, Volume 85, Issue 4-5, pp 333-347 DOI: 10.1007/s11103-014-0192-y

RcLEA, a late embryogenesis abundant protein gene isolated from Rosa chinensis, confers tolerance to Escherichia coli and Arabidopsis thaliana and stabilizes enzyme activity under diverse stresses.

Zhang X. et al.,
1. State Key Laboratory of Genetic Engineering, Institute of Genetics, Fudan University, 220 Handan Road, Shanghai, 200433, China 2. Institute of Plant Biology, School of Life Science, Fudan University, 220 Handan Road, Shanghai, 200433, China

... (GRAVY) analysis of deduced amino acid sequence was performed by using the ExPasy (http://www.expasy.org/ tools), PSORT (http://psort.ims.u-tokyo.ac.jp), and Soft- Berry (http://www.softberry.com) programs. RNA isolation and expression analysis ...


Journal of Agricultural Science and Technology
2014, 16(1), 191-202. DOI:

Isolation and Characterization of DBR2 Gene Promoter from Iranian Artemisia annua

Sarvestani, R., Peyghambary, S. A., Abbasi, A.
Department of Agronomy and Plant Breeding, Agricultural College, University of Tehran, Karaj, Islamic Republic of Iran

... DNA sequencing was performed on an ABI 373A automated sequence. Then, promoter prediction, characterization, and search for the putative cis-acting elements were carried out using different databases: Softberry, PlantCARE [23] and PLACE [24]. Page 4. ...


Plant molecular biology
2014, 84(3), 243-257. DOI: 10.1007/s11103-013-0129-x

The maize d2003, a novel allele of VP8, is required for maize internode elongation.

Lv H. et al.,
1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Zhongguancun South Street 12, Beijing, 100081, China 2. College of Agriculture and Biotechnology, China Agricultural University, Yuanmingyuan West Road 2, Beijing, 100193, China

... that the d2003 gene was located within the AC210968 BAC clone (Fig. 4A, c and e). The Softberry program (http://linux1.softberry.com/ berry.phtml), the genome annotation software, was used to predict the candidate genes within the AC210968 BAC clone. ...


FEMS microbiology letters
2014, 354(1), 19-26. DOI: 10.1111/1574-6968.12431

Antibacterial enzymes from the functional screening of metagenomic libraries hosted in Ralstonia metallidurans

Iqbal, H. A., Craig, J. W., Brady, S. F.
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, New York, NY, USA

... Sequences were annotated using the online tool softberry to predict open-reading frames (ORFs), and alignments to blast and PFAM databases were used to predict gene function (Altschul et al., 1990; Solovyev & Salamov, 2011; Punta et al., 2012). ...


Archives of virology
2014, 1-3. DOI: 10.1007/s00705-014-2005-7

Complete genome sequence of the Pectobacterium carotovorum subsp. carotovorum virulent bacteriophage PM1.

Lim J. A. et al.,
1. Microbial Safety Division, National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Korea 2. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea

... Page 2. software (Softberry Inc., Mount Kisco, NY), and the function of the predicted ORFs was assessed using BLASTP [1] and Pfam domain prediction. Prediction of the tRNA coding region was performed using the tRNAscan- SE software [14]. ...


Journal of integrative plant biology
2014, 56(3), 315-332. DOI:10.1111/jipb.12144

SbHKT1; 4, a member of the high?affinity potassium transporter gene family from Sorghum bicolor, functions to maintain optimal Na+/K+ balance under Na+ stress

Wang T. T. et al.,
1 Key Laboratory of Plant Resources, Institute of Botany, the Chinese Academy of Sciences, Beijing, China 2 College of Life Sciences, Capital Normal University, Beijing, China

... protein (GFP) in the control was observed in the border and the cell nucleus, but cells expressing the SbHKT1;4::GFP displayed a bright border fluorescence, which was consistent with the cell membrane-localized prediction by TMHMM server and the softberry online database ...


Gene
2014, 538(1), 12-22. DOI: 10.1016/j.gene.2014.01.029

Characterization of three Arabidopsis thaliana immunophilin genes involved in the plant defense response against Pseudomonas syringae.

Pogorelko G. V. et al.,
a 219 Bessey Hall, Department of Plant Pathology and Microbiology, Iowa State University, Ames 50014, IA, USA b NI Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia

... Using the Softberry online bioinformatics tools (http://linux1.softberry.com/berry.phtml) allowed us to identify endogenous promoter elements 58 nucleotides upstream of AtCYP19 start codon, 214 nucleotides upstream AtCYP57 and 303 nucleotides upstream AtFKBP65. ...


Environmental microbiology
2014 DOI: 10.1111/1462-2920.12409

Degradation of oxalic acid by the mycoparasite Coniothyrium minitans plays an important role in interacting with Sclerotinia sclerotiorum

Zeng L. M. et al.,
1 State Key Laboratory of Agricultural Microbiology, Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan, China 2 United States Department of Agriculture, Agricultural Research Service, Washington State University, Pullman, WA, USA

... Analysis using the Softberry program (Softberry Inc., New York, USA) predicted that the open reading frame (ORF) of Cmoxdc2 is 1227 bp long and is interrupted by five introns varying in length from 48 to 70 bp long (Supporting Information Fig. S3). ...


World Journal of Microbiology and Biotechnology
2014, 30(2), 613-620. DOI: 10.1007/s11274-013-1477-z

Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate

Wang J. R. et al.,
1. Department of Bioengineering, College of Food Science, South China Agricultural University, 482 Wu-Shan Road, Tian-He District, Guangzhou, 510642, Guangdong, China 3. Guangdong VTR Bio-Tech Co., Ltd., Zhuhai, China

... Further analyses of the sequences were performed by using Recognition of Regulatory Motifs with statistics in the softberry software (http://www.softberry.rn/berry.html) and PLACE Web Signal Scan (http://www.dna.affrc.go.jp/PLACE/signalscan.html). ...


PloS one
2014, 9(6), e98873. DOI: 10.1371/journal.pone.0098873

High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

Catone M. V. et al.,
Departamento de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina Universidad de Buenos Aires, Buenos Aires, Argentina, Instituto de Investigaciones en Biociencias Agricolas y Ambientales, CONICET, Buenos Aires, Argentina

... fr/cap3.php), ORFfinder (http://www.ncbi.nlm.nih.gov/projects/gor?f/), and ClustalW (http://www.ebi.ac.uk/Tools/clustalw/). Promoters were predicted using Softberry program (http://linux1.softberry.com/berry.phtml). thumbnail. ...


3 Biotech
September 2013, DOI:10.1007/s13205-013-0164-y

Siderophore biosynthesis genes of Rhizobium sp. isolated from Cicer arietinum L.

Bejoysekhar Datta, Pran K. Chakrabartty
1. Department of Botany, University of Kalyani, Nadia, Kalyani, West Bengal, 741 235, India 2. Acharya J.C. Bose Biotechnology Innovation Centre, Madhyamgram Experimental Farm, Madhyamgram, Kolkata, West Bengal, 700 129, India

... an operon. In the sequence of 4,921 bp, a probable ribosome-binding site (AGGAGG) was identified six bp upstream of the ATG start codon of sidC of BICC 651 using Promoter prediction search tool (www.softberry.com). A presumable ...


Applied Microbiology and Biotechnology
Volume 97, Issue 5 , pp 1941-1952 DOI:10.1007/s00253-012-4044-x

Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen

Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China 2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China

... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry. com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...


Journal of Industrial Microbiology & Biotechnology
Volume 40, Issue 7 , pp 749-758 DOI:10.1007/s10295-013-1279-1

Gene replacement and elimination using ?Red- and FLP-based tool to re-direct carbon flux in acetogen biocatalyst during continuous CO2/H2 blend fermentation

Michael Tyurin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA

... Promoter and terminator sequences. Promoter and terminator sequences used in both vectors were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Primers for the synthetic genes used in this project are listed in Table ...


World Journal of Microbiology and Biotechnology
Volume 29, Issue 9 , pp 1611-1623 DOI:10.1007/s11274-013-1324-2

Selective methanol or formate production during continuous CO2 fermentation by the acetogen biocatalysts engineered via integration of synthetic pathways using Tn7-tool

Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA 2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia

... early sporulation gene. Promoter and terminator sequences for the components of all vectors used were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). The confirmation ...


Bioprocess Biosyst Eng.
2013 Jun 18. DOI:

Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H 2 blend.

Kiriukhin M, Tyurin M.
Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA.

... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR. ...


Journal of Applied Microbiology
Volume 114, Issue 4, pages 1033–1045, April 2013 DOI:10.1111/jam.12123

Expression of amplified synthetic ethanol pathway integrated using Tn7-tool and powered at the expense of eliminated pta, ack, spo0A and spo0J during continuous syngas or CO2/H2 blend fermentation

M. Kiriukhin 1, M. Tyurin 2,
1Ajinomoto-Genetika Research Institute, Moscow, Russia 2Syngas Biofuels Energy, Inc, Houston, TX, USA

... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). rtPCR. ...


Applied Biochemistry and Biotechnology
Volume 170, Issue 6 , pp 1503-1524 DOI:10.1007/s12010-013-0285-0

Synthetic 2,3-Butanediol Pathway Integrated Using Tn7-tool and Powered Via Elimination of Sporulation and Acetate Production in Acetogen Biocatalyst

Michael Tyurin, Michael Kiriukhin
State

... Promoter and Terminator Sequences for the Components of All Vectors Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR ...


Theoretical and Applied Genetics
Volume 126, Issue 5 , pp 1273-1283 DOI:10.1007/s00122-013-2052-6

Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1

Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan 2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan

... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry. phtml) software was then used to allow the simultaneous comparison of distinct annotated genomes. Phylogenetic analysis. Protein sequence ...


Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 950-959 DOI: 10.1007/s12010-012-0060-7

Selective n-Butanol Production by Clostridium sp. MTButOH1365 During Continuous Synthesis Gas Fermentation Due to Expression of Synthetic Thiolase, 3-Hydroxy Butyryl-CoA Dehydrogenase, Crotonase, Butyryl-CoA Dehydrogenase, Butyraldehyde Dehydrogenase, and NAD-Dependent Butanol Dehydrogenase

Vel Berzin, Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA 2. Ajinomoto–Genetika Research Institute, 1st Dorozhny pr. 1-1, 117545, Moscow, Russia

... Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Electrotransformation procedure [7] was used in modification. ...


FGENESV, FGENESV0

Archives of Virology
2016, 1-4. doi:10.1007/s00705-016-3005-6

The complete genome sequence of PE3-1, a novel E. coli O153 phage

Liu, H. et al.,
College of Resources and Environmen tUniversity of Chinese Academy of Sciences

... Potential ORFs were predicted using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and ORFs were further identified using GLIMMER (ver.3.02) [15] and the ''Gene Finding in Viral Genomes'' function in Softberry (http://linux1.softberry.com/all.htm). ...


Genome Announcements
2016, 4(3), e00536-16. doi: 10.1128/genomeA.00536-16

Genome sequence of Vaccinia virus strain Lister-Butantan, a Lister vaccine variant used during a smallpox eradication campaign in Brazil

Assis, F. et al.,
aLaboratorio de Virus do Instituto de Ciencias Biologicas da Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil bNational Center for Emerging and Zoonotic Infectious Diseases (NCEZID), Centers for Disease Control and Prevention, Atlanta, Georgia, USA

... Chromatogram data were assembled using SeqMerge (Accelrys, Inc., Madison, WI), Phred/Phrap was used for base-calling and assembly software, and Consed was used for sequence editing. The FgenesV tool was used for gene prediction (http://www.softberry.com/). ...


Genome Announcements
2016, 4(3), e00601-16. doi: 10.1128/genomeA.00601-16

Complete genome sequences of T1-like phages JMPW1 and JMPW2

Shen, M. et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, People’s Republic of China

... Genome annotations of the phages were revealed using fgenesV (http://linux1.softberry.com/ berry.phtml?topic=virus&group=programs&subgroup=gfindv) and manually verified by screening all the predicted proteins against the NCBI protein database using BLASTp (6). Then ...


Evolutionary Bioinformatics Online
2016, 12(Suppl 2), 1. doi: 10.4137/EBO.S38518

Bioinformatic Characterization of Mosquito Viromes within the Eastern United States and Puerto Rico: Discovery of Novel Viruses

Frey, K. G. et al.,
1Naval Medical Research Center – Frederick, Fort Detrick, MD, USA. 2Henry M. Jackson Foundation, Bethesda, MD, USA. 3Hood College, Frederick, MD, USA

... A second in silico gene finder, FGENESV (linux1.softberry.com), confirmed the four ORFs. ...


Viruses
2016, 8(3), 76; doi:10.3390/v8030076

A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae

Dornas, F. P. et al.,
1 Laboratorio de Virus, Departamento de Microbiologia, Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais 31270-901, Brazil 2 Unite de Recherche sur les Maladies Infectieuses et Tropicales Emergentes (URMITE) UM63 CNRS 7278 IRD 198 INSERM U1095, Aix-Marseille Univ., 27 boulevard Jean Moulin, Faculte de Medecine, Marseille 13385, France

... Gene predictions were performed using FgenesV [31], RAST (Rapid Annotation using Subsystem Technology) [32] and GeneMarkS [33] tools, and merged. ...


Journal of Invertebrate Pathology
2016, 139, 56-66. doi:10.1016/j.jip.2016.07.011

An alphabaculovirus isolated from dead Lymantria dispar larvae shows high genetic similarity to baculovirus previously isolated from Lymantria monacha–An example of adaptation to a new host

Rabalski, L., Krejmer-Rabalska, M., Skrzecz, I., Wasag, B., Szewczyk, B.
a Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Laboratory of Recombinant Vaccines, Abrahama Str. 58, 80-307 Gdansk, Poland b Forest Research Institute, Department of Forest Protection, Raszyn Braci Lesnej Str. 3, 05-090 Sekocin Stary, Poland

... ORFs were identified using Glimmer3 (gene model pre-computed on RefSeq LdMNPV genome (NC_001973)) (Delcher et al., 2007), GeneMarkS (parameter: intron less eukaryotic-virus) (Borodovsky and McIninch, 1993) (http://linux1.softberry.com/berry.phtml?topic=virus0&group=programs&subgroup=gfindv), and tcode EMBOSS 6.5.7 (Rice et al., 2000)....


PloS one
2016, 11(7), e0160389. doi: 10.1371/journal.pone.0160389

The Complete Genome Sequence of Plodia Interpunctella Granulovirus: Evidence for Horizontal Gene Transfer and Discovery of an Unusual Inhibitor-of-Apoptosis Gene

Harrison, R. L., Rowley, D. L., Funk, C. J.
Invasive Insect Biocontrol and Behavior Laboratory, Beltsville Agricultural Research Center, USDA Agricultural Research Service, Beltsville, Maryland, United States of America Department of Biology, John Brown University, Siloam Springs, Arkansas, United States of America

.. eg no matches with e-values <0.010) were annotated if they did not overlap a larger ORF by >75 bp and if they were predicted to be protein-encoding by both the fgenesV (http://linux1.softberry.com/berry ...


BULLETIN OF THE EUROPEAN ASSOCIATION OF FISH PATHOLOGISTS
2016, 36(1), 11-23.

Novel viral infections threatening Cyprinid fish

Haenen, O. et al.,
1 Central Veterinary Institute of Wageningen UR, The Netherlands; 2 Centre for Environment, Fisheries and Aquaculture Science (CEFAS), Weymouth DT4 8UB, England

... Fish Pathol., 36(1) 2016, 19 sembler), (Hunt et al., 2015). Surprisingly a 16 kb putative viral sequence was generated and subsequently annotated using a selection of bioinformatics tools including FGENESV0 (htp://linux1.softberry.com), Prokka (Seemann, 2014) and BLAST. ...


PloS one
2016, 11(5), e0155134 doi: 10.1371/journal.pone.0155134

Genome Sequencing and Analysis of Catopsilia pomona nucleopolyhedrovirus: A Distinct Species in Group I Alphabaculovirus

Wang, J. et al.,
State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China

...Putative ORFs were analyzed using the FGENESV0 program (http://www.softberry.com/berry.phtml) [48] and the NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ...


J. Gen. Virol.
March 2016 97: 706-714, doi: 10.1099/jgv.0.000394

A Cripavirus in the brown planthopper, Nilaparvata lugens

Wang, S. L., Cheng, R. L., Lu, J. B., Yu, X. P., Zhang, C. X.
1? State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Science, Zhejiang University, Hangzhou, Zhejiang 310058, PR China 2? College of Life Science, China Jiliang University, Hangzhou, Zhejiang 310018, PR China

... The NlCV genome sequence comprised 9144 nt, excluding the 3! poly(A) tail, with 37.8 % GC content. The coding sequence (CDS) of the virus genome was predicted through the FGENESV0 program in SoftBerry (http://linux1.softberry. ...


Genome Announcements
2016, 4(3), e00115-16. doi: 10.1128/genomeA.00115-16

Complete genome sequence of bacteriophage Deep-Blue infecting emetic Bacillus cereus

Hock, L., Gillis, A., Mahillon, J.
Laboratory of Food and Environmental Microbiology, Universite Catholique de Louvain, Louvain-la-Neuve, Belgium

... Genome Announc 4(3):e00115-16. doi:10.1128/genomeA.00115-16. Copyright © 2016 Hock et al. ... The potential coding sequences (CDSs) were pre- dicted using Glimmer v3.02 (5), RAST 2.0 (6), GenMarkS 2.5p (7), and FgenesV (http://www.softberry.com/). ...


Veterinary microbiology
2016, 182, 135-140. doi:10.1016/j.vetmic.2015.11.015

Genomic characterisation of canine papillomavirus type 17, a possible rare cause of canine oral squamous cell carcinoma

Munday, J. S., Dunowska, M., Laurie, R. E., Hills, S.
a College of Science, Massey University, Palmerston North, New Zealand b Otago Genomics and Bioinformatics Facility, Otago University, Dunedin, New Zealand

... 8.04 software (Drummond et al., 2010). 2.3. DNA and protein sequence analysis. The putative coding regions in the PV sequence were predicted using FGENESV0 (http://linux1.softberry.com). The characteristics of the putative ...


Virus genes
2016, 1-7. DOI: 10.1007/s11262-016-1340-z

Genomic characterization of a novel Epsilonpapillomavirus associated with pigmented papillomas in a red deer (Cervus elaphus)

Munday, J. S. et al.,
1. College of Science, Massey University, Palmerston North, New Zealand 2. Gribbles Veterinary Pathology, Palmerston North, New Zealand

... Geneious version 8.04 software [12]. DNA and protein sequence analysis The putative coding regions in the PV sequence were predicted using FGENESV0 (http://linux1.softberry.com). The characteristics of the putative viral ...


Archives of virology
2016, 161(1), 209-212. DOI: 10.1007/s00705-015-2608-7

Genome sequence of a cluster A13 mycobacteriophage detected in Mycobacterium phlei over a half century ago

Marton, S. et al.,
1. Institute for Veterinary Medical Research, Centre for Agricultural Research, Hungarian Academy of Sciences, Hungaria krt 21, 1143, Budapest, Hungary 2. Biological Research Centre, Hungarian Academy of Sciences, Temesvari krt. 62, 6726, Szeged, Hungary

... with MIRA 4.0. GeneMarkS, FGENESV [http://www.softberry.com/], Glimmer 3.02 and DNA Master 5.22.9 software were applied for genome annotation and gene prediction [1–3, 15; http:// phagesdb.org/]. Protein homology was ...


Virologica Sinica
2015, 30(6), 417-424. DOI: 10.1007/s12250-015-3658-4

Genome sequencing and analysis of a granulovirus isolated from the Asiatic rice leafroller, Cnaphalocrocis medinalis

Zhang et al.,
1. State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou, 510275, China 2. State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, 430071, China

... nih.gov/genbank). Hypothetical ORFs were predicted by soft berry FGENESV program (http://www.softberry.com/berry. phtml) (Solovyev and Salamov, 1999) and defined by the standard ATG start, and a stop codon and potentially en- code at least 50 amino acids. ...


Genome announcements
2015, 3(6), e01192-15. doi: 10.1128/genomeA.01192-15

First complete genome sequence of Felis catus gammaherpesvirus 1

Troyer, R. M. et al.,
aDepartment of Biomedical Sciences, Oregon State University, Corvallis, Oregon, USA bDepartment of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, USA

... We verified the final sequence by reassembly of the MiSeq reads to the consensus genome using Bowtie2 (8). We defined open reading frames (ORFs) by prediction with GeneMarkS (9) and FGENESV (SoftBerry) and comparison to herpesvirus and cellular genes using NCBI ...


PloS one
2014, 9(1), e86450. DOI:10.1371/journal.pone.0086450

Genome Sequence and Analysis of Buzura suppressaria Nucleopolyhedrovirus: A Group II Alphabaculovirus

Zhu Z. et al.,
State State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China Canadian Forest Service, Great Lakes Forestry Centre, Sault Ste Marie, Ontario, Canada

... KF611977). Hypothetical ORFs were predicted by softberry FGENESV program (http://www.softberry.com/berry.phtml) [58] to contain the standard ATG start, and a stop codon and potentially encode at least 50 amino acids. Gene ...


Virus research
2014, 185, 110-113 DOI:10.1016/j.virusres.2014.02.019

The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields

Yin Z. et al.,
a Mlochow Research Center, Plant Breeding and Acclimatization Institute – National Research Institute, Platanowa Street 19, PL-05-831 Mlochow, Poland b Department of Plant Genetics, Breeding & Biotechnology, Faculty of Horticulture, Biotechnology and Landscape Architecture, Warsaw University of Life Sciences – SGGW, Nowoursynowska Street 159, PL-02-776 Warsaw, Poland

... SeqMan Pro. Version 9.1.0 (109) 418. Gene structure annotation was predicted by two software packages, GenMark (Besemer and Borodovsky, 1999, http://exon.gatech. edu/) and fgenesV0 (http://linuxl.softberry.com). The models ...


Archives of virology
2014, 1-5. DOI:10.1007/s00705-014-2128-x

Single-nucleotide polymorphisms and reading frame shifts in RNA2 recombinant regions of tobacco rattle virus isolates Slu24 and Deb57

Yin, Z., Pawelkowicz, M., Michalak, K., Chrzanowska, M., & Zimnoch-Guzowska, E.
1. Mlochow Research Center, Plant Breeding and Acclimatization Institute - National Research Institute, Platanowa Street 19, 05-831, Mlochow, Poland 2. Department of Plant Genetics, Breeding and Biotechnology, Faculty of Horticulture, Biotechnology and Landscape Architecture, Warsaw University of Life Sciences-SGGW, Nowoursynowska Street 159, 02-776, Warsaw, Poland

... The corresponding bands were purified using a QIAquick Gel Extraction Kit (QIAGEN) and sequenced directly. Gene structure annotation was done using two software packages, GenMark [4, http:// exon.gatech.edu/] and fgenesV0 [http://linuxl.softberry. com]. ...


Applied and environmental microbiology
2014, 80(1), 374-384. DOI:10.1128/AEM.02279-13

Genomic Investigation of Lysogen Formation and Host Lysis Systems of the Salmonella Temperate Bacteriophage SPN9CC

Shin, H., Lee, J. H., Yoon, H., Kang, D. H., Ryu, S.
a Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, South Korea b Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, South Korea

... The prediction of open reading frames (ORFs) was conducted with Glimmer 3.02 (33), GeneMarkS (34), and FgenesV (Softberry, Inc., Mount Kisco, NY). The prediction of ribosomal binding sites of ORFs was performed with RBSfinder (J. Craig Venter Institute, Rockville, MD). ...


Virus Genes
November 2013 DOI:10.1007/s11262-013-1002-3

Genomic characterisation of Felis catus papillomavirus 4, a novel papillomavirus detected in the oral cavity of a domestic cat

Magdalena Dunowska, John S. Munday, Rebecca E. Laurie, Simon F. K. Hills
1. Institute of Veterinary, Animal and Biomedical Sciences, Massey University, Tennent Drive, Palmerston North, 4474, New Zealand 2. Biochemistry Department, Otago University, Dunedin, New Zealand

... Sequence analysis The putative coding regions in the PV sequence were predicted using FGENESV0 (http://linux1.softberry.com). The characteristics of the putative viral proteins, the pre- sence of conserved protein domains ...


Virus Genes.
2013 Aug;47(1):133-51. doi: 10.1007/s11262-013-0922-2. Epub 2013 May 28.

Complete genomic sequences and comparative analysis of Mamestra brassicae nucleopolyhedrovirus isolated in Korea

Choi et al.,
Department of Agricultural Biology, College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju, Republic of Korea.

... Sequence data were assembled and analysed using Lasergene7 software (DNASTAR). Putative open reading frames (ORFs) were analysed using the FGENESV0 (http://linux1.softberry.com/ berry.phtml) and the NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ...


Veterinary Microbiology
Volume 165, Issues 3–4, 30 August 2013, Pages 319–325 DOI:10.1016/j.vetmic.2013.04.006

Genomic characterization of Felis catus papillomavirus-3: A novel papillomavirus detected in a feline Bowenoid in situ carcinoma

John S. Munday a, Magda Dunowska a, Simon F. Hills a, Rebecca E. Laurie b
a College of Sciences, Massey University, Palmerston North, New Zealand b Biochemistry Department, Otago University, 710 Cumberland Street, Dunedin, New Zealand

... primer sequences available on request). 138 2.3 DNA and protein sequence analysis The putative coding regions in the PV sequence were predicted using FGENESV0 141 (http://linux1.softberry.com). The characteristics of the ...


Appl. Environ. Microbiol.
March 2013 vol. 79 no. 6 1956-1968 doi: 10.1128/?AEM.02793-12

wksl3, a New Biocontrol Agent for Salmonella enterica Serovars Enteritidis and Typhimurium in Foods: Characterization, Application, Sequence Analysis, and Oral Acute Toxicity Study

Hyun-Wol Kang a, Jae-Won Kim b, Tae-Sung Jung c and Gun-Jo Woo a
aFood Safety and Evaluation Laboratory, Department of Food Bioscience and Technology, Korea University, Anam-dong 5-ga, Seongbuk-gu, Seoul, Republic of Korea bCJ Research Institute of Biotechnology, CJ CheilJedang, Seoul, Republic of Korea

... with SeqMan II sequence analysis software (DNASTAR). Possible open reading frames (ORFs) were predicted with the genome annotation software GeneMarkS (28) and confirmed with FgenesV (SoftBerry) and Glimmer 3.02 (29) by submitting the whole genome of wksl3. ...


PLoS ONE
7(5): e37557. doi:10.1371/journal.pone.0037557

Genome Characteristics of a Novel Phage from Bacillus thuringiensis Showing High Similarity with Phage from Bacillus cereus

Yihui Yuan, Meiying Gao, Dandan Wu, Pengming Liu, Yan Wu
Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, People's Republic of China

... Each base had at least five-fold coverage. Open reading frames (ORFs) were predicted with FGENESV software (http://linux1.softberry.com/berry.phtml??topic=virus&group= programs&subgroup=gfin?dv) and by visual inspection. ...


J. Virol.
August 2012 vol. 86 no. 15 8014-8030 DOI: 10.1128/JVI.00723-12

A Novel Bat Herpesvirus Encodes Homologues of Major Histocompatibility Complex Classes I and II, C-Type Lectin, and a Unique Family of Immune-Related Genes

Huajun Zhang et al.,
aCSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, Victoria, Australia bWuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei, China

... Computer-assisted analysis.Open reading frames (ORFs) were initially predicted with the software programs FgenesV (Softberry) and GeneMarkS (5). ORFs that contained canonical start and stop codons were BLASTed against the local protein database of betaherpesviruses ...


PLoS One;
2011 May Journal Volume: 5; Journal Issue: 1;

Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community

Reddy et al.,

... the BLAST scores. After manual frameshift correction, genes were called using fgenesb (http:// www.softberry.com). For phylogenetic ... to Iodobacteriophage. Genes were predicted using fgenesV (www. softberry.com). Found at: doi ...


J. Virol.
May 2012 vol. 86 no. 9 5039-5054 DOI: 10.1128/JVI.07162-11

Biological Characterization and Next-Generation Genome Sequencing of the Unclassified Cotia Virus SPAn232 (Poxviridae)

Afonso et al.,
aLaboratorio de Biologia Molecular de Virus bLaboratorio de Ultraestrutura Hertha Meyer, Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil

... with default parameters. Open reading frames (ORFs) longer than 30 amino acids were detected by FGENESV (Softberry), Vector NTI (Invitrogen), and CLC DNA Workbench (CLC bio, Aarhus, Denmark). Predicted ORFs containing ...


Aquat Biol
Vol. 14: 223–232, 2012 doi: 10.3354/ab00395

Genetic diversity of the Caribbean spiny lobster virus, Panulirus argus virus 1 (PaV1), and the discovery of PaV1 in lobster postlarvae

Jessica Moss 1, *, Mark J. Butler IV 2, Donald C. Behringer 3, Jeffrey D. Shields 1
1 Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, Greate Road, Gloucester Point, Virginia 23062, USA 2 Department of Biological Sciences, Old Dominion University, Norfolk, Virginia 23529, USA

... FgenesV (http:// linux1. softberry. com/), a trained pattern/Markov chain-based viral gene prediction program, was used to translate the sequenced region and to identify ORFs or possible viral genes. RESULTS PaV1 detection by PCR Postlarvae ...


PLoS ONE
7(8): e43106. doi:10.1371/journal.pone.0043106

Isolation and Characterization of Three Mammalian Orthoreoviruses from European Bats

Kohl et al.,
Robert Koch Institute, Centre for Biological Security 1, Berlin, Germany

... Pro package. The sequence was also analyzed by the FGENESV Trained Pattern/Markov chain-based viral gene prediction program (http://www.softberry.com). Phylogenetic Tree Reconstruction. Multiple alignments (ClustalW ...


Appl. Environ. Microbiol.
January 2012 vol. 78 no. 1 58-69 DOI: 10.1128/AEM.06231-11

Characterization and Comparative Genomic Analysis of a Novel Bacteriophage, SFP10, Simultaneously Inhibiting both Salmonella enterica and Escherichia coli O157:H7

Park et al.,
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea bLaboratory of Food Microbiology and Functional Genomics, Department of Food Science and Biotechnology, CHA University, Seongnam, South Korea

... Prediction of all open reading frames (ORFs) was carried out using the Glimmer by GAMOLA automatic annotation program (1) and confirmed using GeneMark (5) and FgenesV software (Softberry, Inc., Mount Kisco, NY). Annotation ...


BMC Microbiology
2012, 12:297 http://www.biomedcentral.com/1471-2180/12/297

Characteristics of a broad lytic spectrum endolysin from phage BtCS33 of Bacillus thuringiensis

Yihui Yuan, Qin Peng and Meiying Gao *
Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, P.R. China

...Open reading frames (ORFs) of the phage BtCS33 genome (GenBank: JN191664) were predicted using FGENESV software (http://linux1.softberry.com/berry.phtml?topic=- virus&group=programs&subgroup=gfindv) and by visual inspection. ...


Environmental Microbiology
Special Issue: Microbial Communities - Structure, Behaviour, Evolution Volume 14, Issue 9, pages 2564–2576, September 2012 DOI: 10.1111/j.1462-2920.2012.02775.x

Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses

David T. Pride 1,*, Julia Salzman 2, David A. Relman 3,4,5
1 Departments of Pathology and Medicine, University of California, San Diego, 9500 Gilman Drive, MC 0612, La Jolla, CA 92093-0612, USA 2Departments of Biochemistry and Statistics 3 Microbiology & Immunology, Stanford University School of Medicine, Stanford, CA, USA

... spacers. Viral contigs were analysed using FGenesV (Softberry, Mount Kisco, NY) for open reading frame prediction, and individual open reading frames analysed using blastX analysis against the NCBI non-redundant database. ...


Research in Microbiology
Volume 163, Issue 3, April 2012, Pages 233–241 http://dx.doi.org/10.1016/j.resmic.2012.01.002,

Characterization of endolysin from a Salmonella Typhimurium-infecting bacteriophage SPN1S

Jeong-A. Lim , Hakdong Shin , Dong-Hyun Kang , Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Agricultural Biomaterials, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Republic of Korea

... 2. Materials and methods. 2.1. Bioinformatic analysis. Prediction of ORFs in the lysis cluster of the SPN1S genome was done using Glimmer 3.02 (Delcher et al., 2007), GeneMark.hmm (Lukashin and Borodovsky, 1998) and FgenesV software (http://www.softberry.com). ...


Archives of Virology
August 2012, Volume 157, Issue 8 , pp 1559-1564 DOI 10.1007/s00705-012-1316-9

Sequencing and analysis of the complete genome of Rana grylio virus (RGV)

Xiao-Ying Lei (1) Tong Ou (1) Ruo-Lin Zhu (1) Qi-Ya Zhang zhangqy@ihb.ac.cn (1)
1. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Wuhan, 430072, China

... Madison, WI, USA). The ORFs were predicted using Gene Finding in the virus genome program at the website http://www.softberry.com and NCBI ORF Finder (http://www. ncbi.nlm.nih.gov/gorf/ gorf.html). Comparisons of homologous ...


J. Virol.
doi: 10.1128/?JVI.01796-12 October 2012 vol. 86 no. 19 10894

Complete Genome Sequence of Bacteriophage SSU5 Specific for Salmonella enterica serovar Typhimurium Rough Strains

Minsik Kim, Sujin Kim and Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea

... GS De Novo assembler (v. 2.60) was used to assemble quality filtered reads, and GeneMarkS (2), Glimmer 3.02 (4), and FgenesV (Softberry, Inc., Mount Kisco, NY) were used to predict open reading frames (ORFs) that encode proteins of more than 40 amino acids. ...


J. Virol.
doi: 10.1128/?JVI.01579-12 September 2012 vol. 86 no. 18 10234-10235

Complete Genome Sequence of Caulobacter crescentus Bacteriophage phiCbK

Gael Panis a, Christophe Lambert b and Patrick H. Viollier a
aDepartment of Microbiology and Molecular Medicine, Faculty of Medicine, University of Geneva, Geneva, Switzerland bProgenus S.A., Gembloux, Belgium

.. of ?CbK genomic DNA (extracted using the Norgen Biotek phage DNA extraction kit), we assembled quality-filtered reads (Velvet 01.01.04 software), predicted coding sequences (pCDS), and transfer RNAs (tRNAs) using Glimmer3.02 (4), FgenesV (Softberry, Inc., Mount Kisco ...


J. Virol.
doi: 10.1128/?JVI.01529-12 September 2012 vol. 86 no. 17 9552

Genome Sequence of a Novel Actinophage PIS136 Isolated from a Strain of Saccharomonospora sp.

Richa Bajpai et al.,
aInstitute of Microbial Technology, CSIR, Chandigarh, India bInstitute of Genomics and Integrative Biology, CSIR, Delhi, India

... The open reading frames (ORFs) were predicted using FGENESV (SoftBerry, Inc., Mount Kisco, NY) and GeneMark (1). After manual curation, a total of 132 ORFs (61 ORFs on the positive strand and 71 on the negative strand) were annotated by using homology search at the ...


J. Virol.
doi: 10.1128/?JVI.00636-12 June 2012 vol. 86 no. 11 6367-6368

Complete Genome Sequence of Cronobacter sakazakii Bacteriophage CR3

Hakdong Shin a, Ju-Hoon Lee b, Yeran Kim a and Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea

... Korea. The quality-filtered reads were assembled using Newbler 2.3, and the prediction of open reading frames (ORFs) was performed using GeneMarkS (1), Glimmer3 (2), and FgenesV (Softberry, Inc., Mount Kisco, NY). Transfer ...


Nucl. Acids Res.
(2012) 40 (W1): W186-W192. doi: 10.1093/nar/gks528

VIGOR extended to annotate genomes for additional 12 different viruses

Shiliang Wang 1,*, Jaideep P. Sundaram 2 and Timothy B. Stockwell 1
1J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850 and 2Genomics Department, BioReliance Corporation, 14920 Broschart Rd, Rockville, MD 20850, USA

... These complex gene features must be accurately defined in order to correctly understand these genomes. Universal gene prediction programs, such as FgenesV (www.softberry.com) and Zcurve_V (1), are available for public use. ...


J. Virol.
doi: 10.1128/?JVI.07226-11 March 2012 vol. 86 no. 6 3404-3405

Complete Genome Sequence of Salmonella enterica Serovar Typhimurium Bacteriophage SPN3UB

Ju-Hoon Lee b, Hakdong Shin a and Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology and Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea bDepartment of Food Science and Biotechnology, CHA University, Seongnam, South Korea

... Assembly of quality filtered reads was performed using a 454 Newbler 2.3 assembler, and open reading frames (ORFs) were predicted using GeneMarkS (5), Glimmer 3.02 (9), and FgenesV (Softberry, Inc., Mount Kisco, NY). ...


J. Virol.
doi: 10.1128/?JVI.06696-11 January 2012 vol. 86 no. 2 1284-1285

Complete Genome Sequence of Salmonella enterica Serovar Typhimurium Bacteriophage SPN1S

Hakdong Shin a, Ju-Hoon Lee b, Jeong-A Lim a, Hyeryen Kim a and Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, Korea bDepartment of Food Science and Biotechnology, CHA University, Seongnam, Korea

... From the complete genome sequence of phage SPN1S, open reading frames (ORFs) were predicted using the GAMOLA automatic annotation program (1) and confirmed using GeneMarkS (3), Glimmer 3.02 (6), and FgenesV (SoftBerry). ...


J. Virol.
January 2012 vol. 86 no. 1 637-638 doi: 10.1128/?JVI.06520-11

Complete Genome Sequence of Bacillus cereus Bacteriophage BCP78

Ju-Hoon Lee b, Hakdong Shin a, Bokyung Son a and Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921, South Korea bDepartment of Food Science and Biotechnology, CHA University, Seongnam 463-836, South Korea

... The assembly of quality filtered reads was performed using 454 Newbler 2.3 assembler, and the prediction of open reading frames (ORFs) and their confirmation were conducted using the Glimmer 3.02 (3), GeneMark.hmm (10), and FgenesV softwares (Softberry, Inc., Mount ...


Extremophiles
September 2012, Volume 16, Issue 5, pp 715-726 DOI 10.1007/s00792-012-0467-7

Genome sequence of temperate bacteriophage Psymv2 from Antarctic Dry Valley soil isolate Psychrobacter sp. MV2

Tracy L. Meiring (1) I. Marla Tuffin (1) Craig Cary (2) Don A. Cowan (1)
1. Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Office 2117, Level 2 Life Sciences Building, Modderdam Rd, Bellville, 7535, South Africa 2. Department of Biological Sciences, University of Waikato, Hamilton, New Zealand

... Ab initio gene predictions were performed using GeneMark.hmm 2.0 (http://www.exon.biology. gatech.edu/heuristic_hmm2.cgi) (Besemer and Borodovsky 1999), fgenesv and fgenesb (http://www.linux1.softberry.com/berry.phtml) (Softberry, Mount Kisco, NY, USA) using the ...


Australasian Plant Disease Notes
April 2012 DOI 10.1007/s13314-012-0048-8

Clitoria yellow mottle virus: a tobamovirus from Northern Australia

Kejun Wei (1) Adrian Gibbs (2) Anne Mackenzie (3)
1. Faculty of Applied Science, University of Canberra, Canberra, ACT, 2617, Australia 2. Australian National University Emeritus Faculty, Canberra, ACT, 0200, Australia 3. CSIRO Division of Plant Industry, Canberra, ACT, 2601, Australia

... The genome of CYMV has the same structure as most other tobamoviruses (Stobbe et al. 2011). The MolQuest- Softberry viral gene detector (http://www.softberry.com) found four open reading frames (ORFs) in the CYMV sequence. ...


J. Virol.
March 2011 vol. 85 no. 6 2642-2656 DOI: 10.1128/JVI.01661-10

Identification and Sequencing of a Novel Rodent Gammaherpesvirus That Establishes Acute and Latent Infection in Laboratory Mice

Loh et al.,
1Department of Pathology and Immunology 2Department of Molecular Microbiology 3Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St. Louis, Missouri

... Viral genome and phylogenetic analyses.Predicted ORFs were identified using Geneious (see above), fgenesV (SoftBerry, Mount Kisco, NY) (13, 69), and GeneMark (6) and were analyzed using BLAST algorithms (3). ORFs that were predicted by both fgenesV and GeneMark ...


J. Virol.
October 2011 vol. 85 no. 19 10230-10238 DOI: 10.1128/JVI.00637-11

The Genome of Yoka Poxvirus

Zhao et al.,
1 Departments of Pathology and Immunology and Molecular Microbiology, Washington University School of Medicine, and the Midwest Regional Center of Excellence for Biodefense and Emerging Infectious Diseases Research, St. Louis, Missouri 2 Department of Pathology, University of Texas Medical Branch, Galveston, Texas

... described for other recently sequenced poxviruses (1, 2, 23). Briefly, ORFs were predicted using FgenesV (SoftBerry, Inc.; www.softberry.com/) and Getorf (Emboss package). All predicted ORFs of more than 90 nucleotides with ...


J. Virol.
December 2011 vol. 85 no. 24 13470-13471 doi: 10.1128/JVI.06344-11

Complete Genome Sequence of Salmonella Bacteriophage SPN3US

Ju-Hoon Lee 1, Hakdong Shin 2, Hyeryen Kim 2 and Sangryeol Ryu 2
1Department of Food Science and Biotechnology, CHA University, Seongnam 463-836, South Korea 2Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921, South Korea

... Prediction of open reading frames (ORFs) was performed using the GAMOLA automatic annotation program (1), and predicted ORFs were confirmed using the Glimmer 3.02 (5), GeneMark.hmm (7), and FgenesV (Softberry, Inc., Mount Kisco, NY) software. ...


Virus Research
Volume 160, Issues 1–2, September 2011, Pages 128–135 DOI: 10.1016/j.virusres.2011.05.023

Genomic and phylogenetic analyses of murine adenovirus 2

Hemmi et al.,
a Institute of Molecular Life Sciences, University of Zurich, Switzerland b Veterinary Medical Research Institute, Hungarian Academy of Sciences, Budapest, Hungary

... annular.org/sdbrown/dna/translator.html). The sequence was also analyzed by the FGENESV Trained Pattern/Markov chain-based viral gene prediction program (http://www.softberry.com). Splice sites were determined manually ...


The ISME Journal
6, 915-926 (May 2012) | doi:10.1038/ismej.2011.169

Evidence of a robust resident bacteriophage population revealed through analysis of the human salivary virome

Pride et al.,

... Viral contigs were analyzed using FGenesV (Softberry Inc., Mount Kisco, NY, USA) for open reading frame prediction, and individual Open reading frames were analyzed using blastX analysis against the NCBI non-redundant database (E-score <10 ?5 ). If the best hit was to a ...


Virology Journal
2011, 8:331 http://www.virologyj.com/content/8/1/331

The complete genome sequence and genetic analysis of fFCA82 a novel uncultured microphage from the turkey gastrointestinal system

Zsak et al.,
1 Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, 934 College Station Road, Athens, GA 30605 USA

...Putative ORFs within the FCA82 genome were predicted using the FGENESV Trained Pattern/Markov chain-based viral gene prediction method from the Softberry website [27]....


Aquat Biol
Vol. 14: 223–232, 2012 doi: 10.3354/ab00395

Genetic diversity of the Caribbean spiny lobster virus, Panulirus argus virus 1 (PaV1), and the discovery of PaV1 in lobster postlarvae

Jessica Moss 1, *, Mark J. Butler IV 2 , Donald C. Behringer 3 , Jeffrey D. Shields 1
1 Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, Greate Road, Gloucester Point, Virginia 23062, USA 2 Department of Biological Sciences, Old Dominion University, Norfolk, Virginia 23529, USA

... FgenesV (http:// linux1. softberry. com/), a trained pattern/Markov chain-based viral gene prediction program, was used to translate the sequenced region and to identify ORFs or possible viral genes. RESULTS PaV1 detection by PCR Postlarvae ...


PLoS ONE
(2011), 6(11): e28163. doi:10.1371/journal.pone.0028163

Genomic Sequence Analysis of Granulovirus Isolated from the Tobacco Cutworm, Spodoptera litura.

Wang et al.,
Department of Agricultural Biotechnology, College of Agriculture and Life Sciences, Seoul National University, Seoul, Korea

...Putative coding regions of the SpliGV genome were predicted using FGENESV0 (http://www.softberry.com/berry.phtml) [70] and the ...


Virology
Volume 414, Issue 1, 25 May 2011, Pages 42–50 DOI: 10.1016/j.virol.2011.03.009

Deep sequencing of Cotesia vestalis bracovirus reveals the complexity of a polydnavirus genome

Chen et al.,
a State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Insect Sciences, Zhejiang University, Hangzhou 310029, China b Shanghai-MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center at Shanghai, Shanghai 201203, China

...Putative open reading frames (ORFs) were predicted using FGENESV (http://linux1.softberry.com/berry.phtml) and GENSCAN...


J Gen Virol
November 2011 vol. 92 no. 11 2679-2690 DOI: 10.1099/vir.0.033852-0

The enigmatic genome of Chara australis virus

Gibbs et al.,
Research School of Biological Science, Australian National University, Canberra, ACT 0200, Australia

...ORFs were predicted by using the MolQuest-Softberry viral gene detector, ...



PLoS ONE
5(1): e8812. doi:10.1371/journal.pone.0008812

Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community

Allgaier et al.,
1 Deconstruction Division, Joint BioEnergy Institute, Emeryville, California, United States of America, 2 Department of Biological and Agricultural Engineering, University of California Davis, Davis, California, United States of America

.. scores. After manual frameshift correction, genes were called using fgenesb (http://www.softberry.com). For ... Iodobacteriophage. Genes were predicted using fgenesV (www.softberry.com). (1.12 MB EPS). Figure S2. Correspondence ... 


Journal of Insect Physiology
Volume 56, Issue 6, June 2010, Pages 650-658 doi:10.1016/j.jinsphys.2010.01.013

Transient expression of specific Cotesia plutellae bracoviral segments induces prolonged larval development of the diamondback moth, Plutella xylostella

Bowon Kwon a, c, Seongbaeck Song a, Jae Young Choi b, Yeon Ho Je b and Yonggyun Kim a
a Department of Bioresource Sciences, Andong National University, Andong 760-749, Republic of Korea b Department of Entomology, Seoul National University, Seoul 151-742, Republic of Korea

... Putative genes encoded in the CpBV genome segments were analyzed by FGENESV ORF Finder (http://linux1.softberry.com/berry.phtml?topic=index&group=programs&subgroup=gfindv) and NCBI-BLAST searching programs, in which genes were predicted by two criteria that ... 


PLoS Pathog
2010 6(5): e1000923. doi:10.1371/journal.ppat.1000923

Analysis of Virion Structural Components Reveals Vestiges of the Ancestral Ichnovirus Genome

Volkoff et al.,
1 UMR 1231 INRA - Universite Montpellier 2, Biologie Integrative et Virologie des Insectes, Place Eugene Bataillon, Montpellier, France, 2 Institut de Genomique Fonctionnelle, Plate-forme Proteomique, CNRS UMR 5203, INSERM U661, Universite Montpellier 1, Universite Montpellier 2, Montpellier, France

... Five related sequences, showing more than 65% nucleotide identity, are highlighted. Arrows represent the predicted coding sequences in IVSPER-2 (names as per Figure 1) and CsIV SH-C (as determined using FGENESV0 at http://linux1.softberry.com/berry.phtml). ...


Archives of Virology
Volume 154, Number 8 / August 2009, pp. 1313-1327

Sequence and gene organization of 24 circles from the Cotesia plutellae bracovirus genome

Jae Young Choi et al.,
(1) Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, 151-742, Korea

... specific primers. For each genomic segment, putative coding genes were predicted using FGENESV0 (http://www.softberry.com/berry.phtml) [48] and GENSCAN (http://genes.mit.edu/GENSCAN.html). Sequence comparisons ...


Virus Research
Volume 132, Issues 1-2, March 2008, Pages 132-139 doi:10.1016/j.virusres.2007.11.009

Completion of the genome analysis of snake adenovirus type 1, a representative of the reptilian lineage within the novel genus Atadenovirus

SL Farkas, B Harrach, M Benko
Veterinary Medical Research Institute, Hungarian Academy of Sciences, H-1581, Budapest, P.O. Box 18, Hungary

... The complete genome sequence was also submitted to the FGENESV program at www.softberry.com (Softberry Inc.) for putative gene prediction. ...


Entomological Research
Volume 38 Issue 1 Page 77-86, March 2008

Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella

Wael GAD, Jae Young, Yeon Ho JE, Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea
2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea

... Putative open reading frames (ORF) were predicted using fgenesv0 (Solovyev & Salamov 1999; http://www.softberry.com/berry.phtml) and genescan (http://genes.mit ...


Archives of Virology
Volume 152, Number 11 / October 2007 p. 2027-2033

Identification, detection and transmission of a new vitivirus from Mentha

I. E. Tzanetakis, J. D. Postman and R. R. Martin
Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR, U.S.A.

... Genome analysis The open reading frames (ORF) encoded by MV-2 were identified with the FGENESV0 and ORF finder programs (http:==www.softberry.com and http:==www ...


Journal of Virology
July 2007, p. 6920-6926, Vol. 81, No. 13

Detection of a Novel and Highly Divergent Coronavirus from Asian Leopard Cats and Chinese Ferret Badgers in Southern China

B. Q. Dong et al.,
Guangxi Center for Disease Control and Prevention

... Open reading frames (ORFs) of the partial genome of the novel CoV were identified with the program fgenesV (Softberry Inc., Mount Kisco, NY) and mapped with ...


J Gen Virol
87 (2006), 1531-1541;

Comparative genomic analysis of two strains of human adenovirus type 3 isolated from children with acute respiratory infection in southern China

Qiwei Zhang et al.,
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China

... or 'hypothetical proteins' were also identified by using FGENESV, software for predicting potential genes in viral genomes (http://www.softberry.com/berry ...


Journal of Virology
March 2006, p. 2127-2140, Vol. 80, No. 5

Vaccinia Virus Proteome: Identification of Proteins in Vaccinia Virus Intracellular Mature Virion Particles

Che-Sheng Chung,1, Chein-Hung Chen,2, Ming-Yi Ho,2 Cheng-Yen Huang,1 Chung-Lin Liao,2* and Wen Chang1*
Institute of Molecular Biology,1 The Genomics Research Center, Academia Sinica, Taipei, Taiwan, Republic of China2

... predicted from WR viral genome sequences using two programs, GeneMarkS (http://opal.biology.gatech.edu/GeneMark/) and fgenesV (http://softberry.com; 17). ...


Biochem Biophys Res Commun.
2005 Jul 1;332(2):487-93.

Genomic segments cloning and analysis of Cotesia plutellae polydnavirus using plasmid capture system

Choi et al.,
School of Agricultural Biotechnology, Seoul National University, Seoul 151-742, Republic of Korea.

... Putative coding regions were predicted using FGENESV0 ([21]; http://www.softberry. com/berry.phtml) and GENSCAN (http://genes.mit.edu/GENSCAN.html). ...


Journal of Asia-Pacific Entomology
2005, v. 8(4) p. 359-366

Structure and Expression Profiles of Two Putative Cotesia plutellae Bracovirus Genes (CpBV-H4 and CpBV-E94?) in Parasitized Plutella xylostella

MA Ibrahim Ahmed, et al.,
Andong National University, Andong, Republic of Korea

... Puta- tive ORFs were predicted using FGENESV0 (Solovyev and Salamov, 1999: http://www.softberry. com/berry. phtml) and GENSCAN (http://genes.mit. edu/ GENSCAN. ...


Journal of Asia-Pacific Entomology
2005, v. v. 8(3) p. 249-255

Gene Expression of Cotesia plutellae Bracovirus EP1-like Protein (CpBV-ELP1) in Parasitized Diamondback Moth, Plutellae xylostella

Lee, et al.,
Andong National University, Andong, Republic of Korea

... Puta- tive ORFs were predicted using FGENESV0 (Solovyev and Salamov, 1999: http://www.softberry. com/berry. phtml) and GENSCAN (http://genes.mit. edu/ GENSCAN. ...


Virus Research
Volume 112, Issues 1-2, September 2005, Pages 32-37

New features in the genus Ilarvirus revealed by the nucleotide sequence of Fragaria chiloensis latent virus

Ioannis E. Tzanetakis a and Robert R. Martin a, b,
aDepartment of Botany and Plant Pathology, Center for Gene Research and Biotechnology, Oregon State University, Corvallis, OR 97331, USA bHorticultural Crops Research Laboratory, USDA-ARS, Corvallis, OR 97330, USA

... that position of FClLV RNA 2. An ORF at an alternative reading frame was identified (Pattern/Markov chain-based viral gene prediction at softberry.com) between ...


Archives of Virology
Volume 149, Number 10 / October, 2004 pp. 2001-2011

Strawberry necrotic shock virus is a distinct virus and not a strain of Tobacco streak virus

I. E. Tzanetakis, I. C. Mackey and R. R. Martin
Molecular and Cellular Biology Program and Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR, U.S.A.
USDA-ARS, HCRL, Corvallis, OR, U.S.A.

... similarity to any gene in the database and this was predicted not to be a virus-encoding gene sequence (Virus gene identification, www.softberry.com ...


Journal of Virology
November 2004, p. 12576-12590, Vol. 78, No. 22

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

Wen Jun Song,1 Qi Wei Qin,2 Jin Qiu,1 Can Hua Huang,1 Fan Wang,1 and Choy Leong Hew1*
Department of Biological Sciences,1 Tropical Marine Science Institute, National University of Singapore, Singapore2

... A total of 162 ORFs, predicted by the FGENESV program (available through: http://www.softberry.com), supplemented with Vector NTI suite 7.1, are indicated ...


Virus Genes
28 (3): 239-246, April 2004 Article ID: 5269250

Complete Nucleotide Sequence of a Strawberry Isolate of Beet Pseudoyellows Virus

Ioannis E. Tzanetakis
Molecular and Cellular Biology Program, Department of Botany and Plant Pathology, Oregon State University, Corvallis 97331, USA
Robert R. Martin
Horticultural Crops Research Laboratory, USDA-ARS, Corvallis OR 97330, USA;

... http://www.ncbi.nlm.nih. gov/gorf/gorf.html) and the gene finder in viruses at http://www.softberry.com. The amino acid comparisons ...


Geno., Prot. & Bioinfo.
Vol. 1 No. 3 August 2003 226-235

Genome Organization of the SARS-CoV

Jing Xu1* et al
1 Beijing Genomics Institute, Chinese Academy of Sciences, Beijing 101300, China

...FGENESV, a program for gene prediction provided by Softberry Inc. (Mount Kisco, USA) through a web-based interface, has been specially modi?ed and trained with parameters for virus (http://www.softberry.com/berry.phtml?topic= gfindv). ...
The hypothetical minus sense ORF iden-ti?ed by FGENESV (from 48 to 203 nt on the minus strand or 29,523 to 29,678 nt on the plus strand) may be fake, but we should not absolutely deny the prob-ability of the existence of minus ORFs. ...Furthermore, we employed FGENESV to explore the sequences of MHV (NC 001846 in NCBI) and AIBV (NC 001451 in NCBI), and compared the re-sults with their previous annotations, respectively.


Rapport de stage de DEA Juin 2003

Analyse du genome du virus de l'archee Pyrococcus abyssi (PAV1)

ROUAULT Karen
Laboratoire de Microbiologie et Biotechnologie des Extremophiles IFREMER- Centre de Brest et Equipe Microbiologie LEMAR - Institut Universitaire Europeen de la Mer

... [14]. FGENESV http://www.softberry.com/berry. phtml?topic=gfindv Virus ( >10 kb) Modeles de Markov Forme du genome Code genetique [40]. ...


PROT_MAP

PLoS ONE
(2013), 8(1): e53525. doi:10.1371/journal.pone.0053525

A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s.

Dalman et al.,
Uppsala BioCenter, Department of Forest Mycology and Plant Pathology, Swedish University of Agricultural Sciences, Uppsala, Sweden

...he gene annotations found in TC32-1 were transferred to the reference sequence using PROT_MAP, FGENESH-2 (SoftBerry, Mount Kisco, NY) and Artemis ...


PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.

Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany

...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99] and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...


J Gen Virol
July 2011 vol. 92 no. 7 1500-1507 doi: 10.1099/vir.0.027706-0

Genotypic characterization of two bacterial artificial chromosome clones derived from a single DNA source of the very virulent gallid herpesvirus-2 strain C12/130

Stephen J. Spatz 1, Lorraine P. Smith 2, Susan J. Baigent 2, Lawrence Petherbridge 2 and Venugopal Nair 2
1Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA 30605, USA 2Institute for Animal Health, Compton, Berkshire RG20 7NN, UK

... 1988; Peng et al. 1995; Peng & Shirazi 1996a, b) were compared to pC12/130-10 and pC12/130-15 genomes using PROT_Map (SoftBerry, Mount Kisco, NY). Transcription factor-binding sites were investigated by using the TFsearch program (Maray et al. 1988; Peng ...


Virus Genes
2008 37:69–80 DOI 10.1007/s11262-008-0242-0

Clustering of mutations within the inverted repeat regions of a serially passaged attenuated gallid herpesvirus type 2 strain

Stephen J. Spatz, Cary Rue, Daniel Schumacher, Nikolaus Osterrieder
Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, 934 College Station Rd., Athens, GA 30605, USA Department of Microbiology and Immunology, Cornell University, Ithaca, NY 14853, USA Institut fu.r Virologie, Philippstra.e 13, 10115 Berlin, Germany

... Published mRNA [20] and cDNA [28–30] data were compared to the 584Ap80 genome using PROT_MAP (SoftBerry, Mount Kisco, NY). ...


Virus Genes
Volume 35, Number 3 / December 2007 p. 753-766

Comparative sequence analysis of a highly oncogenic but horizontal spread-defective clone of Marek’s disease virus

Stephen J. Spatz et al.,
Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, 934 College Station Rd., Athens, GA 30605, USA

... PairwiseFLAG. Published mRNA and cDNA data were compared to the pRB-1B-5 genome using PROT_MAP (SoftBerry, Mount Kisco, NY). Multiple ...


Virus Genes
Volume 35, Number 1 / August 2007 p. 41-53

Polymorphisms in the repeat long regions of oncogenic and attenuated pathotypes of Marek’s disease virus 1

Stephen J. Spatz and Robert F. Silva
US Department of Agriculture, Southeast Poultry Research Laboratory, Agricultural Research Service, 934 College Station Rd, Athens, GA 30605, USA , US Department of Agriculture, Avian Disease and Oncology Laboratory, Agricultural Research Service, 3606 East Mount Hope Rd, East Lansing, MI 48823, USA

... Pub- lished mRNA and cDNA data were compared to the genomes of attenuated and nonattenuated strains of MDV using PROT_MAP (SoftBerry, Mount Kisco, NY). ...


Genetics
Vol. 176, 599-609, May 2007

The FLOWERING LOCUS T-Like Gene Family in Barley (Hordeum vulgare)

Sebastien Faure, Janet Higgins, Adrian Turner and David A. Laurie
John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom

... New gene predictions were made using FGENESH+ and PROT_MAP (http://sun1.softberry. com) for FT-like genes showing incorrect alignment within the PEBP domain and ...


J Gen Virol
88 (2007), 1080-1096

Comparative full-length sequence analysis of oncogenic and vaccine (Rispens) strains of Marek's disease virus

Stephen J. Spatz1, Lawrence Petherbridge2, Yuguang Zhao2 and Venugopal Nair2
1 Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA 30605, USA
2 Institute for Animal Health, Compton, Berkshire RG20 7NN, UK

... BMEC/ITRI). Published mRNA and cDNA data were compared with the CVI988 genome by using PROT_MAP (SoftBerry). Multiple protein ...


MaliN

Journal of Experimental Botany
2007 58(3):439-451;

Factors involved in root formation in Medicago truncatula

Nijat Imin*, Mahira Nizamidin, Tina Wu and Barry G. Rolfe
Australian Research Council Centre of Excellence for Integrative Legume Research, Genomic Interactions Group, Research School of Biological Sciences, Australian National University, Canberra City, ACT 2601, Australia

... Then the PLETHORA genes were aligned using the program MaliN (Softberry Inc., NY, USA) and the forward degenerative primer, PLTconsF (CAACAYGGRAGRTGGCAAGCAAG ...


MaliP

MPMI
Vol. 24, No. 9, 2011, pp. 1051–1060. doi:10.1094/ MPMI -12-10-0281

A Dual-Targeted Soybean Protein Is Involved in Bradyrhizobium japonicum Infection of Soybean Root Hair and Cortical Cells

Libault et al.,
1 Division of Plant Sciences, National Center for Soybean Biotechnology, C.S. Bond Life Sciences Center, University of Missouri, Columbia 65211 U.S.A.; 2 Donald Danforth Plant Science Center, 975 North Warson Road, St. Louis 63132 U.S.A.;

...Given the lack of functional annotation for GmNMNa, we used MaliP software to identify conserved domains. T...


EST_map

PLoS genetics
(2013). 9(1), e1003233. DOI:10.1371/journal.pgen.1003233

Comparative Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens

Condon et al.,
Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, New York, United States of America Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon, United States of America

... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions with Fgenesh+ [103] and Genewise ....


International Journal of Food Microbiology
Volume 157, Issue 2, 2 July 2012, Pages 202–209 DOI: 10.1016/j.ijfoodmicro.2012.05.008,

The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties

Jure Piskur et al.,
a Wine Research Centre, University of Nova Gorica, Slovenia b Department of Biology, Lund University, Sweden

... 2) homology-based — FGENESH+; Genewise (Birney and Durbin, 2000) seeded by BLASTx alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm. nih.gov/BLAST/), and 3) EST-based — EST_map (http://www.softberry.com/) seeded by ...


Fungal Genetics and Biology
Volume 49, Issue 3, March 2012, Pages 217–226 DOI: 10.1016/j.fgb.2012.01.007

The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction

Mahajabeen Padamsee et al.,
a Department of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, United States b Department of Plant Biology, University of Minnesota, Saint Paul, MN 55108, United States

... 2) homology-based – FGENESH +; Genewise (Birney and Durbin, 2000) seeded by BLASTx alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm. nih.gov/BLAST/), and (3) EST-based – EST_map (http://www.softberry.com/) seeded by ...


New Phytologist
Volume 194, Issue 4, pages 1001–1013, June 2012 DOI: 10.1111/j.1469-8137.2012.04128.x

Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen

Olson et al.,
1 Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, Box 7026, Ullsvag 26, 750 05 Uppsala, Sweden 2 US DOE Joint Genome Institute, Walnut Creek, CA 94598, USA

... based – FGENESH+, Genewise (Birney & Durbin, 2000) seeded by BLASTx (Altschul et al., 1990) alignments against GenBank's database of nonredundant proteins (NR: http://www.ncbi.nlm.nih. gov/BLAST/); and EST-based – EST_map (http://www.softberry.com/) seeded by ...


PLoS Pathog
8(12): e1003037. doi:10.1371/journal.ppat.1003037

Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi

Ohm et al.,
United States Department of Energy (DOE) Joint Genome Institute (JGI), Walnut Creek, California, United States of America

... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions with Fgenesh+ [87] and Genewise...


Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976

Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.

Berka et al.,
Novozymes, Inc., Davis, California, USA. US Department of Energy Joint Genome Institute, Walnut Creek, California, USA. Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.

... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly; cDNA-based EST_map (http://www.softberry.com/) seeded ...


SCAN2

Annals of Translational Medicine
Vol 1, No 3 (October 2013) DOI:10.3978/j.issn.2305-5839.2012.12.01

The physiological roles of secretin and its receptor

Afroze et al.,
1Department of Medicine, Division Gastroenterology, 2Research, Central Texas Veterans Health Care System, 3Scott & White Digestive Disease Research Center, Scott & White, and Texas A&M Health Science Center, College of Medicine, Temple, TX 76504, USA;

... gene. Homology was analyzed using SCAN2 software from Softberry, http://linux1. softberry.com/berry.phtml?topic=scan2&group=programs&subgroup=scanh subsequently, % homology was calculated independently. Secretin ...


Folia Biologica
Volume 61, Numbers 3-4, August 2013 , pp. 149-153(5) DOI:10.3409/fb61_3-4.149

The Use of Primed in situ Synthesis (PRINS) to Analyze Nucleolar Organizer Regions (NORs) and Telomeric DNA Sequences in the Domestic Chicken Genome

Bugno-Poniewierska et al.,

... Comparative alignment analysis performed by SCAN2 software by Softberry (http://linux1.soft- berry.com/berry.phtml) for aligning two multi- megabyte-size nucleotide sequences revealed that our set of primers is partially complementary to 18S and 28S rDNA sequences (SHAO ...


Virus Genes
April 2012, Volume 44, Issue 2, pp 273-285 DOI: 10.1007/s11262-011-0696-3

Comparative full genome analysis of four infectious laryngotracheitis virus (Gallid herpesvirus-1) virulent isolates from the United States

S. J. Spatz et al.,
1. United States Department of Agriculture, Southeast Poultry Research Laboratory, Agricultural Research Service, Athens, GA, 30605, USA 2. BASE2BIO, Madison, WI, 53714, USA

... Homology searches were con- ducted using the NCBI program blastP with default settings. Multiple alignments of proteins and nucleotide sequences were generated using MAFFT [28], Multalin [3] and SCAN2 (Softberry.com). Results and discussion ...

Virus Genes
Volume 42, Issue 3 , pp 331-338 DOI: 10.1007/s11262-011-0573-0

Comparative genomic sequence analysis of the Marek’s disease vaccine strain SB-1

Stephen J. Spatz, Karel A. Schat
1. Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA, 30605, USA 2. Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY, 14853, USA

... Homology searches were con- ducted using the NCBI program blastP with default set- tings. Multiple alignments of proteins and nucleotide sequences were generated using MAFFT [12] and SCAN2 (Softberry.com). Results and discussion Phylogenetic relatedness ...



African Journal of Biotechnology
Vol. 2 (12), pp. 714-718, December 2003
Available online at http://www.academicjournals.org/AJB

Minireview
Web-based bioinformatic resources for protein and nucleic acids sequence alignment

Kamel A. Abd-Elsalam
Molecular Markers Lab., Plant Pathology Research Institute, Agricultural Research Center, Orman 12619, Giza, Egypt.

... 16-SCAN2:: program for aligning two multimegabyte-size sequences. http://www.softberry.com/berry.phtml?topic=scanh&prg= SCAN2. derived ...


Nucleic Acids Research,
2003, Vol. 31, No. 13 3540-3545

PromH: promoters identification using orthologous genomic sequences

V. V. Solovyev* and I. A. Shahmuradov
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK

... The full-length sequences of gene pairs have been aligned by the SCAN2 program (http://softberry.com/berry.phtml?topic=scanh&prg=SCAN2), which can align ...


Genome Comparison Browser

The Plant Journal ,
2008 Volume 53 Issue 1, Pages 124 - 132

Low X/Y divergence in four pairs of papaya sex-linked genes

Qingyi Yu et al.,
Hawaii Agriculture Research Center, Aiea, HI 96701, USA

... The predicted transcripts were tested by RT-PCR, and the BAC sequences were aligned using a genome comparison browser (http://sun1.softberry.com). ...


Molecular Genetics and Genomics ,
Volume 278, Number 2 / August 2007 p. 177-185

Chromosomal location and gene paucity of the male specific region on papaya Y chromosome

Qingyi Yu et al.,
Hawaii Agriculture Research Center, Aiea, HI 96701, USA

... The predicted transcripts were tested by RT-PCR. Genome comparison browser (http://www.sun1.softberry.com) was used for comparative sequence analysis. RT-PCR ...


PROTCOMP

Int. J. Mol. Sci.
2016, 17(8), 1211; doi:10.3390/ijms17081211

Glutathione Transferases Superfamily: Cold-Inducible Expression of Distinct GST Genes in Brassica oleracea

Vijayakumar, H. et al.,
1 Department of Horticulture, Sunchon National University, 255, Jungang-ro, Suncheon 57922, Korea 2 Plant Systems Engineering Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahangno, Daejeon 34141, Korea

... Subcellular localization prediction of predicted BoGST proteins was performed using Protcomp 9.0 from Softberry [96]. ...


Journal of Plant Biochemistry and Biotechnology
2016, 25(2), 155-167. DOI: 10.1007/s13562-015-0321-y

Molecular cloning, characterization and three-dimensional structure prediction of Lipoxygenase from Finger millet [Eleusine coracana (L.) Gaertn.] germinating seedlings

Kotapati, K. V. et al.,
Centre for Bioinformatics, School of Life SciencesPondicherry University; Department of BiochemistryYogi Vemana University

... The sub cellular localization of EcLOX was predicted by utilizing different publicly available programs, Plant-mPLoc, EpiLoc, YLoc, ProtComp (http://linux1.softberry.com), TargetP (http://www.cbs.dtu.dk/services/TargetP/), ChloroP ...


Fungal Genetics and Biology
2016, 90, 12-22 http://dx.doi.org/10.1016/j.fgb.2016.03.002

Chasing stress signals–Exposure to extracellular stimuli differentially affects the redox state of cell compartments in the wild type and signaling mutants of Botrytis cinerea

Marschall, R., Schumacher, J., Siegmund, U., Tudzynski, P.
Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat, Schlossplatz 8, D-48143 Munster, Germany

... Subcellular localization patterns of proteins were predicted by ProtComp v.9.0 (http://linux1.softberry.com/berry.phtml?topic=protcompan&group=help&subgroup=proloc ...


Journal of Experimental Botany
2016, erw297. doi: 10.1093/jxb/erw297

Rice putative methyltransferase gene OsTSD2 is required for root development involving pectin modification

Qu, L. et al.,
1 National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China 2 College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China

... OsTSD2 is predicted to be localized in the Golgi body (http://www.softberry.com/berry.phtml?topic= protcompan&group=programs&subgroup=proloc; Integral Prediction of protein location: Membrane-bound Golgi with score 7.4), which is consistent with its putative role at the site ...


Fish & shellfish immunology
2016, 50, 297-309. http://dx.doi.org/10.1016/j.fsi.2016.02.009

Abundant members of Scavenger receptors family and their identification, characterization and expression against Vibrio alginolyticus infection in juvenile Larimichthys crocea

He, J., Liu, H., Yang, J., Dong, X., & Wu, C
National Engineering Research Center of Marine Facilities Aquaculture, Zhejiang Ocean University, Zhoushan 316022, PR China

... The sub-cellular localization was predicated by tool ProtComp 9.0 (http://www.softberry.com/). ...


PLoS Genet
2016, 12(7), e1006152. http://dx.doi.org/10.1371/journal.pgen.1006152

A High Temperature-Dependent Mitochondrial Lipase EXTRA GLUME1 Promotes Floral Phenotypic Robustness against Temperature Fluctuation in Rice (i>Oryza sativa L.)

Zhang, B. et al.,
State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences and National Center for Plant Gene Research, Beijing, the People’s Republic of China, University of Chinese Academy of Sciences, Beijing, the People’s Republic of China

... Among them, TargetP [88] (http://www.cbs.dtu.dk/services/TargetP/) has the best consistency compared with MitoProt II-v1.101 [80] (https://ihg.gsf.de/ihg/mitoprot.html), iPSORT [89] (http://ipsort.hgc.jp/), ProtComp 9.0 (http://linux1.softberry.com/berry.phtmtopic=protcompan&group=help&subgroup=proloc) and WoLF PSORT ...


Journal
2016 http://dx.doi.org/10.1371/journal.pone.0157783

De Novo Transcriptome Analysis of the Common New Zealand Stick Insect Clitarchus hookeri (Phasmatodea) Reveals Genes Involved in Olfaction, Digestion and Sexual Reproduction

Wu C. et al.,
Landcare Research, Auckland, New Zealand, School of Biological Sciences, The University of Auckland, Auckland, New Zealand; New Zealand Institute for Plant & Food Research Ltd, Auckland, New Zealand

... Signal peptides and sub-cellular locations were identified using SignalP (v4.1) [54] and ProtComp (v9.0) (http://linux1.softberry.com), respectively. ...


Genome biology and evolution
2016, 8(3), 681-704. doi: 10.1093/gbe/evw026

A tale of genome compartmentalization: the evolution of virulence clusters in smut fungi

Dutheil, J. Y. et al.,
1Department of Organismic Interactions, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany 2German Research Center for Environmental Health (GmbH), Institute of Bioinformatics and Systems Biology, Helmholtz Zentrum Munchen, Neuherberg, Germany

... 2004). Annotation of CSEPs. SignalP version 4.1 was used for signal peptide prediction and ProtComp 9.0 (online version) for localization prediction (http://linux1.softberry.com/berry.phtml). We used two prediction schemes. ...


Journal of Agricultural Science and Technology
2016, 18(4), 1129-1141.

Characterization of a Desiccation Stress Induced Lipase Gene from Brassica napusL

Zhang, H. et al.,
1Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu, People’s Republic of China. 2Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, National Engineering Research Center of Edible Fungi; Key Laboratory of Edible Fungi Resources and Utilization (South),Ministry of Agriculture, Shanghai 201403, People’s Republic of China.

... Molecular weight and pI of the deduced protein were detected with DNAStar. Subcellular localization prediction was performed with SoftBerry (http://linux1.softberry.com/berry.phtml) and ChloroP Server (http://www.cbs.dtu.dk/services/ChloroP- 1.1/). ...


Planta
August 2016, Volume 244, Issue 2, pp 505–515 DOI: 10.1007/s00425-016-2520-8

Xyloglucan endo-transglycosylase/hydrolase (XET/H) gene is expressed during the seed germination in Podophyllum hexandrum: a high altitude Himalayan plant

Dogra, V., Sharma, R., Yelam, S.
Biotechnology DivisionCSIR-Institute of Himalayan Bioresource Technology Laboratory of Photosynthesis and Stress SignalingShanghai Center for Plant Stress Biology, CAS

...Subcellular localization was predicted using ProCompv9.0 (http://?linux1.?softberry.?com/?berry.?phtml). Secondary structure ...


Algal Research
2016, 17, 236-243. doi:10.1016/j.algal.2016.05.015

Transcriptome analysis of Chlorella zofingiensis to identify genes and their expressions involved in astaxanthin and triacylglycerol biosynthesis

Huang, W., Ye, J., Zhang, J., Lin, Y., He, M., Huang, J.
a Kunming Institute of Botany, Chinese Academic of Sciences, Kunming, Yunnan Province, PR China b University of Chinese Academic of Sciences, Beijing, PR China

... Protein location prediction by ProtComp (http://linux1.softberry. com) suggested that one of these isoforms, namely T1_Unigene_BMK.22394, may ...


BMC biotechnology
2016, 16(Suppl 1):35 DOI: 10.1186/s12896-016-0261-1

Over-expression of a NAC 67 transcription factor from finger millet (Eleusine coracana L.) confers tolerance against salinity and drought stress in rice

Rahman, H., Ramanathan, V., Nallathambi, J., Duraialagaraja, S., Muthurajan, R.
Department of Plant Biotechnology, Centre for Plant Molecular Biology and Biotechnology, Tamil Nadu Agricultural University

... structure (PSIPHRED; http://bioinf.cs.ucl.ac.uk/psipred/); pI/Mw (Compute pI/Mw; http://web.expasy.org/compute_pi/); functional region (PROSITE; http://www.expasy.org/) and subcellular localization (ProtCompv9.0; http://www.softberry.com/ ...


Front Plant Sci.
2016; 7: 215. doi: 10.3389/fpls.2016.00215

Identification and Characterization of the Glucose-6-Phosphate Dehydrogenase Gene Family in the Para Rubber Tree, Hevea brasiliensis

Xiangyu Long, Bin He, Yongjun Fang, and Chaorong Tang
Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences Danzhou, China.

... Online software, ProtComp 9.02, was used to evaluate the presence of a transit peptide, which suggested the localization of HbG6PDH3 in the cytosol, and HbG6PDH1, 2 and 4 in the chloroplast (Table ?Table22)....


Applied microbiology and biotechnology
2016, Volume 100, Issue 16 , pp 7125-7136 DOI: 10.1007/s00253-016-7579-4

SILAC and LC-MS/MS identification of Streptococcus equi ssp. zooepidemicus proteins that contribute to mouse brain microvascular endothelial cell infection

Zhe, M. et al.,
1. College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, 210095, China 2. Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009, China

... Softberry ProtComp Neural Nets identification showed that 22 of these 25 proteins were cytoplasmic and the other three were membrane proteins (Table 1). Structural analysis of these three membrane proteins is shown in Fig. ... 2013b; Sun et al. 2016). ...


Gene
2016, 588(2), 173-179. doi:10.1016/j.gene.2016.05.024

Identification and expression of a novel carbonic anhydrase isozyme in the pufferfish Takifugu vermicularis

Sumi, K. R., Nou, I. S., Kho, K. H.
a Department of Fisheries Science, College of Fisheries and Ocean Sciences, Chonnam National University, 50, Daehak-ro, Yeosu, Jeonnam 59626, Republic of Korea b Department of Horticulture, College of Life Science and Natural Resources, Sunchon National University, 255, Jungang-ro, Suncheon-Si, Jeollanam-do, 67922, Republic of Korea

.. were analyzed using ProtParam (http://expasy.org/tools/protparam.html) and the protein location within the cell determined by using Protcomp (http://linux1.softberry.com/berry ...


Front Plant Sci.
2016; 7: 1011. doi: 10.3389/fpls.2016.01011

Group 3 LEA Protein, ZmLEA3, Is Involved in Protection from Low Temperature Stress

Liu, Y., Liang, J., Sun, L., Yang, X., Li, D.
1State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an, China 2Faculty of Chemistry and Chemical Engineering, Taishan Medical University, Tai’an, China

... 3 http://linux1.softberry.com/ berry.phtml?topic=protcomppl\&group=Programs\&subgroup=proloc. ...


Frontiers in Plant Science
2016, 7: 936. doi: 10.3389/fpls.2016.00936

A Genome-Wide Analysis Reveals Stress and Hormone Responsive Patterns of TIFY Family Genes in Brassica rapa

Saha, G., Park, J. I., Kayum, M. A., Nou, I. S.
Department of Horticulture, Sunchon National University, Suncheon, South Korea

.. The subcellular location of TIFY proteins in B. rapa was determined using ProtComp 9.0 from Softberry (http://linux1.softberry.com/ berry.phtml) and Blast2GO software (http://www.blast2go.de). ...


Plant biotechnology journal
2016, 14(2), 699-708. DOI: 10.1111/pbi.12418

Interspecies gene transfer provides soybean resistance to a fungal pathogen

Langenbach, C. et al.,
Department of Plant Physiology, RWTH Aachen University, Aachen, Germany, BASF Plant Science Company GmbH, Agricultural Center, Limburgerhof, Germany

... Analysis with the subcellular localization tool for plant proteins 'softberry Protcomp 9.0' (http://linux1.softberry.com), correctly predicting 86% of extracellular proteins (Klee and Ellis, 2005), even assigned eight ...


Plant Molecular Biology Reporter
2016, 34(2), 512-523. DOI: 10.1007/s11105-015-0943-1 A Comprehensive Analysis of Carotenoid Cleavage Dioxygenases Genes in Solanum Lycopersicum

Wei, Y. et al.,
1. State key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China 2. Institute of Economic Crop, Hebei Academy of Agriculture and Forestry Sciences, Shijiazhuang, 050051, China

... An N-terminal sorting signal of the SlCCD genes was inves- tigated using online tool iPSORT (http://ipsort.hgc.jp/). The subcellular localization of the SlCCD family was performed by Wolf PSORT (http://wolfpsort.org/) and ProtComp (http:// linux1.softberry.com/all.htm). ...


Journal of cancer research and therapeutics
2016, 12(1), 58-61. DOI: 10.4103/0973-1482.146083

Bioinformatic analysis of c-Myc target from laryngeal cancer cell gene of laryngeal cancer

Zhang, W. D. et al.,
1 Department of Otorhinolaryngology, People's Hospital of Zhengzhou, Henan, Henan Province, China 2 Department of Otorhinolaryngology, The First Affiliated Hospital, Sun Yat Sen University, Guangdong, China

... Table 1: Predictive analysis of secondary structure of MTLC protein Click here to view. Sub-cellular localization of c-Myc target from laryngeal cancer cell protein Sub-cellular localization analysis of ProtComp v. 9.0 (Softberry, Inc. ...


Folia biologica
2016, 64(1), 23-29. DOI: http://dx.doi.org/10.3409/fb64_1.23

Identification and characterization of pathogen-response genes (repat) in Spodoptera frugiperda (Lepidoptera: Noctuidae)

Machado, V., Serrano, J., Galian, J.

... www.cbs.dtu.dk/services/ SignalP/). The potential subcellular localization of proteins was V. MACHADO et al. 24 Page 3. predicted using ProtComp Version 9.0 (http:// www.softberry.com). The frequency of each repat EST in ...


American Journal of Potato Research
2016, 1-12. DOI: 10.1007/s12230-016-9525-5

Genome-Wide Analyses of Subtilisin-Like Serine Proteases on Solanum tuberosum

Norero, N. S., Castellote, M. A., de la Canal, L., Feingold, S. E.
1. Laboratorio de Agrobiotecnologia, Instituto Nacional de Tecnologia Agropecuaria (INTA) EEA - Balcarce, Ruta 226, Km 73,5. C.C. 276, (7620), Balcarce, Argentina 2. Instituto de Investigaciones Biologicas (IIB), Universidad Nacional de Mar del Plata (UNMdP), Dean Funes 3350. C.C. 722, (7600), Mar del Plata, Argentina

... 2007). PredoTar V1.3 (https://urgi.versailles.inra.fr/Tools/ Predotar) and ProtComp V9.0 (http://www.softberry.com/berry. phtml?topic=protcompplandgroup=programsandsubgroup= proloc) were used to predict signal sequences to organelles and other subcellular localizations. ...


Frontiers in plant science
2016, 7: 310. doi: 10.3389/fpls.2016.00310

AtHD2D Gene Plays a Role in Plant Growth, Development, and Response to Abiotic Stresses in Arabidopsis thaliana

Han, Z. et al.,
1College of Life Science, Northwest A & F University, Yangling, China 2Department of E-A Information Engineering, Liaoning Institute of Science and Technology, Benxi, China

... In addition, the tool for transmembrane regions and signal peptide sequence analysis, ProtComp 9.0 tool (http://linux1.softberry.com/berry.phtml?topic=protcomppl& group=programs&subgroup= proloc) fuzzy k-nearest neighbors (k-NN) algorithm (version 41.0), and TMHMM ...


Biotechnology & Biotechnological Equipment
2016, 1-8. DOI: 10.1080/13102818.2016.1184588

Molecular characterization, expression pattern and function analysis of the OsHSP90 family in rice

Zhang, H. et al.,
a Key Laboratory of Southwest Crop Genetic Resources and Improvement, Ministry of Education, Rice Institute of Sichuan Agricultural University, Chengdu, China

... We further examined the subcellular localization of the nine rice OsHSP90 members with Softberry ProtComp (http://linux1.softberry.com/berry.phtmL). ...


Plant Biotechnology Journal
Volume 14, Issue 7 July 2016 Pages 1563–1577 DOI: 10.1111/pbi.12520

Genome-wide dissection of AP2/ERF and HSP90 gene families in five legumes and expression profiles in chickpea and pigeonpea

Agarwal, G. et al.,
International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India School of Plant Biology, Institute of Agriculture, The University of Western Australia, Crawley, WA, Australia

... Supplementary information. Phylogeny of HSP90 proteins. HSP90 proteins from all five legumes were analysed in silico for their location in cellular milieu using ProtComp v9.0 of Softberry (http://www.softberry.com/berry.phtml). In ...


Scientific reports
2016; 6: 26323. doi: 10.1038/srep26323

Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

Vimolmangkang, S. et al.,
1Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden of the Chinese Academy of Sciences, Wuhan, 430074, P. R. China 2Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand

... alignment was performed using web-based MUSCLE program (http://www.ebi.ac.uk/Tools/msa/ muscle/) and prediction of signal peptide was carried out using SignalP4.1 (http://www.cbs.dtu. dk/services/), WoLF PSORT 24 , and Protcomp 9.0 (http://linux1.softberry.com/berry ...


Parasitology research
2016, 1-13. DOI: 10.1007/s00436-016-5114-2

Bioinformatics analysis and construction of phylogenetic tree of aquaporins from Echinococcus granulosus

Wang, F., Ye, B.
1. Department of Pathogenic Biology, Chongqing Medical University, Chongqing, 400016, People’s Republic of China 2. Research Center for Molecule Medicine and Tumor, Chongqing Medical University, Chongqing, People’s Republic of China

... The conservative structural domain was predicted by Conserved Domain (http://www.ncbi.nlm. nih.gov/cdd/). The subcellular localization was predicted by ProtCompv. 9.0 (http://linux1. softberry.com/berry.phtml?topic=protcompan&group= programs&subgroup=proloc/). ...


Parasitology Research
2016, 1-8. DOI: 10.1007/s00436-016-5166-3

In silico cloning and B/T cell epitope prediction of triosephosphate isomerase from Echinococcus granulosus

Wang, F., Ye, B.
1. Department of Pathogenic Biology, Chongqing Medical University, Chongqing, 400016, China 2. Research Center for Molecule Medicine and Tumor, Chongqing Medical University, Chongqing, China

... The structural domain was predicted by SMART (http://smart.embl-heidelberg. de/). The subcellular localization was predicted by ProtComp v. 9.0 (http://linux1.softberry.com/berry. phtml? topic=protcompan&group=programs&subgroup=proloc/). ...


The Journal of Horticultural Science and Biotechnology
2016, 91(2), 203-209. doi: 10.1080/14620316.2015.1133608

Cloning and expression analysis of three genes encoding ubiquitins in papaya (Carica papaya L.).

Geng, J. J., Shen, Y. H., Yang, F. Y., Li, K., Chen, X. J.
a College of Horticulture Fujian Agriculture and Forestry University, Up and Down Road, Fuzhou 350002, P. R. China b Institute of Genetics and Breeding in Horticultural Plants, Fujian Agriculture and Forestry University, Up and Down Road, Fuzhou 350002, P. R. China

... program (http://us.expasy.org/tools/peptide-mass.html). Sub-cellular localisation was predicted using Softberry software (http://linux1.softberry.com/berry.phtml). The secondary structures and three-dimensional structures of the ...


International journal of molecular sciences
2016, 17(4), 441. doi:10.3390/ijms17040441

Molecular Characterization of MaCCS, a Novel Copper Chaperone Gene Involved in Abiotic and Hormonal Stress Responses in Musa acuminata cv. Tianbaojiao

Feng, X. et al.,
Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou 350002, China

... Signal peptide analysis using ChloroP1.1 software showed that the deduced MaCCS protein contains a chloroplast-targeting peptide like other plant CCSs (Figure 1), which agrees with the prediction results of subcellular localization obtained using the SoftBerry website. ...


Molecular biology reports
2016, 1-12. DOI: 10.1007/s11033-016-4008-9

Molecular cloning and characterization of the MsHSP17.7 gene from Medicago sativa L.

Li, Z. Y. et al.,
Institute of Animal SciencesChinese Academy of Agricultural Sciences

... motif prediction (TMHMM, http://?www.?cbs.?dtu.?dk/?services/?TMHMM-2.?0/?), protein secondary structure analysis (Garnier [v6.0.1]; William Pearson, European Bioinformatics Institute, UK), subcellular location prediction (ProtComp, http://?www.?softberry.?com) and ...


Genome
2016, 59(6), 379-391. doi: 10.1139/gen-2016-0018

Expression of salicylic acid-related genes in Brassica oleracea var. capitata during Plasmodiophora brassicae infection

Manoharan, R. K., Shanmugam, A., Hwang, I., Park, J. I., Nou, I. S.
Department of Horticulture, Sunchon National University, 255 Jungang-ro, Suncheon, Jeonam 57922, Republic of Korea.

... Further, N-glycosylation sites were predicted using the NetNGlyc 1.0 server (Gupta and Jung 2004). Subcellular localization prediction of predicted MES proteins was performed using Protcomp 9.0 from Softberry (http://linux1.softberry.com/berry.phtml). ...


PlantOmics Journal
2016 DOI:10.21475/poj.160902.p7778x

Isolation, cloning and bioinformatics analysis of ?-amyrin 11-oxidase coding sequence from licorice

Shirazi, Z., Aalami, A., Tohidfar, M., & Sohani, M. M.
1 Department of Plant Biotechnology, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran 2 Department of Biotechnology, Shahid Beheshti University, Tehran, Iran

... Subcellular studies using Softberry and Psort software showed that the activity of this protein is in endoplasmic reticulum. ... The Softberry and TargetP softwares showed the protein has a signal peptide and is located in the secretory pathway (Fig. ...


Biologia Plantarum
2016, 1-9. DOI 10.1007/s10535-016-0618-2

CsWRKY2, a novel WRKY gene from Camellia sinensis, is involved in cold and drought stress responses

Wang, Y. et al.,
1. Tea Science Research Institute, Nanjing Agricultural University, Nanjing, 210095, P.R. China

... CsWRKY2 and other WRKY proteins were subjected to phylogenetic analysis using MEGA 5.05. The online tool WoLF PSORT (http:// wolfpsort.org/) and Softberry ProComp v. 9.0 (http:// linux1.softberry.com/berry) were used to predict CsWRKY2 protein localization. ...


Genetics and molecular research: GMR
2014, 13(1), 117-126. DOI: 10.4238/2014.January.10.2

Molecular cloning, expression, and regulation of the ovalbumin gene in pigeon oviduct epithelial cells

Zhang H. et al.,
1College of Animal Sciences and Technology, Nanjing Agriculture University, Nanjing, Jiangsu, China 2Institute of Animal Husbandry and Veterinary Science

... Pigeon OVA amino acid sequences were predicted based on the open reading frames of the cDNA sequences (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The transmembrane seg- ments were detected using the Softberry program (http://linux1.softberry.com/berry.phtml). ... ...According to our computational analysis (ProtComp Version 9.0, Softberry), it is an extracellular secretory protein with 3 transmembrane segment residues: 27-47, 233-252, and 292-309....


Developmental & Comparative Immunology
2014, 42(2), 148-158. DOI: 10.1016/j.dci.2013.08.025

Identification and functional analysis of the peptidoglycan recognition protein LD gene in the mosquito, Armigeres subalbatus

Wang S., Beerntsen B. T
Department of Veterinary Pathobiology, University of Missouri, Columbia, MO 65211, United States

... services/SignalP) and transmembrane domain using ProtComp Ver. 8.0 on SoftBerry (http://www.softberry.com). 2.4. Sequence alignments and evolutionary analysis. The predicted AsPGRP-LD protein sequences were aligned ...


Journal of Tropical Crop Science
2014, 1(1). www.j-tropical-crops.com

Cloning and Characterization of P5CS1 and P5CS2 Genes from Saccharum officinarum L. under Drought Stress

Iskandar, H. M., Widyaningrum, D., Suhandono, S.
A Biotechnology Research Institute for Estate Crop, Jalan Taman Kencana No. 1, Bogor, Indonesia Genetics and Molecular Biology Division, School of Life Science and Technology, Institut Teknologi Bandung,

... J Amino acid sequence of protein were s SoP5CS predicted using Bioedit. In order to predict SoP5CS proteins celular localization, we used TargetP and ProtComp from Softberry (www.softberry.com). Realtimeq PCR(RT- PCR)analysis uantitative q ...


BMR BIOLOGY
2014; Volume:1; Article ID: 1; www.bmrjournals.com

In-Silico characterization of New Delhi Metallo-beta-lactamase-1

Vishwakarma S., Sahu S. K., Mishra S. K.
1 Study Center for Biotechnology, Govt. M. S. Golwalkar College, Rewa (M.P.)

... The tool ProtComp Identifying sub- cellular location of protein [22]. (http://linux1.softberry. com/berry.phtml? ... 2010; 38(Database issue):D161-6. 22. http://linux1.softberry.com/berry. phtml ?topic=pcompb&group=programs&sub group=proloc 23. ...


Molecular Breeding
2014, 1-9. DOI:10.1007/s11032-014-0130-3

Molecular cloning and functional analysis of a salt-induced gene encoding an RNA-binding protein in alfalfa

Long R. et al.,
1. Institute of Animal Science, Chinese Academy of Agriculture Science, Beijing, 100193, China 3. College of Prataculture Science, Nanjing Agriculture University, Nanjing, 210095, China

... pl??page=?/?NPSA/?npsa_?hnn.?html). The subcellular localization of MsRBP was analyzed by ProtComp version 9.0 software (http://?linux1.?softberry.?com/? berry.?phtml). Amino acid sequence alignment was carried ...


PloS one
2014, 9(1), e84359 DOI:10.1371/journal.pone.0084359

Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in Arabidopsis

Mao, X. et al.,
The Key Laboratory for Crop Gene Resources and Germplasm Enhancement, Ministry of Agriculture, The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China

... with PREDATOR (http://bioweb.pasteur.fr/seqanal/protein?/intro-uk.html), and the functional region was identified using PROSITE (http://expasy.hcuge.ch/sprot/prosite.htm?l). Subcellular localization was predicted with ProtComp v9.0 software (http://linux1.softberry.com/berry ...


Journal of chemical ecology
2014, 40(1), 63-70. DOI:10.1007/s10886-013-0373-1

A novel fatty acyl desaturase from the pheromone glands of Ctenopseustis obliquana and C. herana with specific Z5-Desaturase activity on myristic acid

Hagstrom, A. K. et al.,
1. Pheromone Group, Department of Biology, Lund University, Solvegatan 37, 223 62, Lund, Sweden 2. The New Zealand Institute for Plant & Food Research Limited, Auckland, New Zealand

... The C. obliquana and C. herana desaturase sequences were analyzed with the subcellular localization prediction tools Euk- mPLoc 2.0 (Chou and Shen 2010) and ProtComp 9.0 (Softberry, USA). Quantitative RT-PCR and Analysis ...


Archiv Tierzucht
57 (2014) 15, 1-12 DOI:10.7482/0003-9438-57-015

Molecular cloning, sequence characterization, and gene expression profile of a novel water buffalo (Bubalus bubalis) gene: Na+, K+-ATPase b -subunit (ATP1B2)

Song, S. et al.,
1Faculty of Animal Science and Technology, Yunnan Agricultural University, Kunming, China, 2Domestic Animal Breeding and Crossbreed-improvement Station of Yunnan Province, Kunming, China

... 2004). ProtComp 9.0 (http://www.softberry.com) was employed to predict protein sorting signals and intracellular localization. Secondary structures of deduced AA sequences were predicted by SOPMA (Geourjon & Deleage 1995). TMHMM version 2.0 (Krogh et al. ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 113, Issue 1 , pp 91-101 DOI:10.1007/s11240-012-0254-2

Transcript profiling identifies novel transcripts with unknown functions as primary response components to osmotic stress in wheat (Triticum aestivum L.)

Garg et al.,
1. Department of Bioscience and Biotechnology, Banasthali University, Banasthali, 304022, Rajasthan, India 2. Department of Biotechnology, Faculty of Science, Jamia Hamdard, New Delhi, 110062, India

... al. 2007 ) and ProtComp v. 9.0 from Softberry Inc. (http://linux1.softberry.com/berry. phtml?topic=protcomppl&group=programs&subgroup=proloc) were utilized to predict the sub-cellular localization of the proteins. Prediction ...


Journal of General Plant Pathology
Volume 79, Issue 2 , pp 96-104 DOI:10.1007/s10327-013-0428-8

Analysis of selected singleton transposable elements (SSTEs) and their application for the development of land PATE markers in Magnaporthe oryzae

Zhang et al.,
1. State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China 2. Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, China 4. Interdisciplinary Graduate Program in Genetic Engineering, Graduate School, Kasetsart University, Bangkok, 10900, Thailand

... The non-SSTE sequence was analyzed for predicting genes using the prediction program Fgenesh (http://www.softberry.com). ... 2004 ) and Protcomp (http://www.softberry.com). Analysis of P/A polymorphisms of SSTEs at each locus among different isolates. ...


PloS one
October 15, 2013DOI: 10.1371/journal.pone.0077275

The Scutellaria baicalensis R2R3-MYB Transcription Factors Modulates Flavonoid Biosynthesis by Regulating GA Metabolism in Transgenic Tobacco Plants

Yuan Yuan, Chong Wu, Yunjun Liu, Jian Yang, Luqi Huang
National Resource Center for Chinese Materia Medica, Academy of Chinese Medical Sciences, Beijing, China Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China

... is present in the NtPAL gene [25]. The box L sequence in the promoter sequence of NtPAL (GenBank:AB008199) was predicted as ACTTTG using Softberry (linux1.softberry.com). The sequence contains ACTTTG, which has ... ...The localizations of the deduced proteins were predicted on the ProtComp Version 9.0 (http://linux1.softberry.com/berry.phtml??topic=protcompan&group=programs&subgroup=proloc) as well as SubLoc v1.0 ...


Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics
Volume 1834, Issue 11, November 2013, Pages 2360–2371 DOI:10.1016/j.bbapap.2013.01.030

Sieving through the cancer secretome

Qifeng Lin a, Hwee Tong Tan a, Hannah Soo Rei Lim b, Maxey C.M. Chung a, b
a Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, 8 Medical Drive, 117597 Singapore b Department of Biological Sciences, Faculty of Science, National University of Singapore, 14 Science Drive 4, 117543 Singapore

... Other programs such as Softberry ProtComp 9.0 (http://linux1.softberry.com/berry.phtml?topic= protcompan&group=programs&subgroup=proloc) and KnowPredsite (http://bio-cluster.iis.sinica. edu.tw/kbloc) [29] are reportedly capable of predicting multiple localizations. ...


Plant Cell Reports
Volume 32, Issue 1 , pp 161-171 DOI:10.1007/s00299-012-1350-9

Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco

Sumita Omer, Santosh Kumar, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... 2). In silico sub-cellular localization of LlMYB1 protein was predicted to be nuclear using the program ProtComp ver- sion 9.0 (http://www.linux1.softberry.com/berry.phtml? topic= protcomppl&group=programs&subgroup=proloc) accessed from softberry server. ...


Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics
Volume 1834, Issue 11, November 2013, Pages 2442–2453 DOI:0.1016/j.bbapap.2013.01.039

Bioinformatics tools for secretome analysis

Dario Caccia a, Matteo Dugo b, Maurizio Callari b, c, Italia Bongarzone a,
a Proteomics Laboratory, Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy b Functional Genomics Core Facility, Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy

... org/tools/PRED-TAT. ProtComp, Subcellular localization prediction, +++, FASTA seq (one at a time), HTML, text, http://linux1.softberry.com/berry.phtml?topic=index&group= programs&subgroup=proloc. PSORTb v3.0, Subcellular ...


PloS one
July 23, 2013DOI: 10.1371/journal.pone.007029

Proteomic and Phytohormone Analysis of the Response of Maize (Zea mays L.) Seedlings to Sugarcane Mosaic Virus

Liuji Wu et al.,
Henan Agricultural University and Synergetic Innovation Center of Henan Grain Crops, Zhengzhou, China, Key Laboratory of Physiological Ecology and Genetic Improvement of Food Crops in Henan Province, Zhengzhou, China

... The subcellular locations of the unique proteins identified in this study were determined using Softberry bioinformatics software. Genetic map positions were determined in silico using the Maize GDB http://www.maizegdb.org/. ...


Appl. Environ. Microbiol.
December 2013 vol. 79 no. 24 7646-7653 DOI:10.1128/AEM.02905-13

Glycerol-3-Phosphate Acyltransferase Contributes to Triacylglycerol Biosynthesis, Lipid Droplet Formation, and Host Invasion in Metarhizium robertsii

Qiang Gao, Yanfang Shang, Wei Huang and Chengshu Wang
Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China

.. or gaps, and 1,000 bootstrap replicates. Prediction of mrGAT subcellular localization was performed with the program ProtComp (ver. 9.0, Softberry) and TargetP (ver. 1.1) (22). Gene deletion and complementation.For functional ...


Insect Biochemistry and Molecular Biology
Volume 43, Issue 6, June 2013, Pages 510–521 DOI:10.1016/j.ibmb.2013.03.006

Subcellular localization of the fatty acyl reductase involved in pheromone biosynthesis in the tobacco budworm, Heliothis virescens (Noctuidae: Lepidoptera)

Asa K. Hagstrom a, Andrea Walther b, Jurgen Wendland b, Christer Lofstedt a
a Pheromone Group, Department of Biology, Lund University, Solvegatan 37, SE-223 62 Lund, Sweden b Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-1799 Copenhagen V, Denmark

... on known N-terminal signal sequences (Emanuelsson et al., 2000; Emanuelsson et al., 2007), ProtComp that combines several methods of protein localization prediction of sequences containing signal sequences, anchors and other functional peptides (Softberry, USA), PTS1 ...


Environ. Sci. Technol.,
2013, 47 (10), pp 5327–5335 DOI:10.1021/es400113y

Effects of Deficiency and Excess of Zinc on Morphophysiological Traits and Spatiotemporal Regulation of Zinc-Responsive Genes Reveal Incidence of Cross Talk between Micro- and Macronutrients

Ajay Jain †, Bhaskaran Sinilal ‡, Gurusamy Dhandapani †, Richard B. Meagher §, and Shivendra V. Sahi *‡
† National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi-110012, India ‡ Department of Biology, Western Kentucky University, Bowling Green, Kentucky 42101-1080, United States § Department of Genetics, University of Georgia, Fred C. Davison Life Sciences Complex, Athens, Georgia 30602, United States

... Server, were analyzed in databases AtcisDB for identifying transcription factor binding sites(29, 30) and PlantCare for cis-regulatory elements, respectively.(31) Protein level subcellular localization of the ZIPs was predicted by amino acid sequence analysis at softberry.com. ...


Postharvest Biology and Technology
Volume 75, January 2013, Pages 106–113 DOI:10.1016/j.postharvbio.2012.08.005

Catabolism of GABA in apple fruit: Subcellular localization and biochemical characterization of two g-aminobutyrate transaminases

Trobacher et al.,
a Department of Plant Agriculture, University of Guelph, Guelph, Ontario, Canada N1G 2W1 b Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G 2W1

... Several web-based subcellular localization programs were used to assess the potential targeting of the apple GABA-Ts including TargetP (v1.1; http://www.cbs.dtu.dk/services/TargetP/; Emanuelsson et al., 2000), ProtComp (http://linux1.softberry.com/berry.phtml?topic ...


BMC Plant Biology
2013, 13:156 doi:10.1186/1471-2229-13-156

Functional characterisation of three members of the Vitis vinifera L. carotenoid cleavage dioxygenase gene family

Justin G Lashbrooke 1, Philip R Young 1, Samantha J Dockrall 1, Krishnan Vasanth1 2 and Melane A Vivier 1
1 Institute for Wine Biotechnology, Department of Viticulture and Oenology, Stellenbosch University, Private Bag X1, Matieland, 7602, South Africa 2 Current address: Department of Botany, Bharathiar University, Coimbatore, TN, 641 046, India

... bioinformatics.psb.ugent.be/plaza/) [27]. The putative sub-cellular localisation of protein sequences were predicted using ProtComp Version 8.0 (http://www.softberry. com/berry.phtml). V. vinifera expressed sequence tags (ESTs ...


mcp
M113.028480. DOI:10.1074/mcp.M113.028480

Linkage of oxidative stress and mitochondrial dysfunctions to spontaneous culture degeneration in Aspergillus nidulans

Li et al.,
Shanghai Institutes for Biological Sciences, CAS, China

... ver. 9.0, http://linux1.softberry.com/ ) and WoLF PSORT (http://wolfpsort.org/) to predict subcellular localizations and InterProScan analysis (www.ebi.ac.uk/Tools/pfa/iprscan/) to classify individual proteins to protein families. Functional ...


Advanced Science, Engineering and Medicine
Volume 5, Number 8, August 2013 , pp. 777-782(6) DOI:10.1166/asem.2013.1358

Cloning of Alcohol Dehydrogenase Gene from Rapeseeds and Correlation with Waterlogging Tolerance Index

Xu et al.,

... Software TargetP 1.1 could not predict a definite subcellular localization of BnADH-1, only pre- dicted other protein. PSORT predicted a weak subcellular localization of BnADH-1 at mitochondrial matrix space. WoLFPSORT20 and Softberry-ProtComp 21 predicted a Adv. Sci. ...


International Journal of Biotechnology and Biochemistry
Volume 9, Number 3 (2013) pp. 293-312 DOI:

Molecular Cloning, Characterization and Expression Analysis of Stress Responsive Dehydrin Genes from Drought Tolerant Horsegram (Macrotyloma uniflorum (Lam.) Verdc.)

Ramya et al.,
Department of Botany, Sri Krishnadevaraya University, Anantapuram, 515 003, India. ?Center for Honeybee Disease Control, Animal and Plant Quarantine Agency, 175 Anyang ro, Anyang City, 430-757, Gyeonggi-do, South Korea.

... 71, 79 and 65 respectively. 4.3 Localization of MuDHN1, MuDHN2 and MuDHN3 genes Integral prediction of protein location was analyzed by ProtComp v9.0 (http://linux1.softberry. com/berry). In this study, predicted localization ...


BMC Genomics
2013, 14:343 doi:10.1186/1471-2164-14-343

An integrative “omics” approach identifies new candidate genes to impact aroma volatiles in peach fruit

Sanchez et al.,
1 Instituto de Biologia Molecular y Celular de Plantas (IBMCP), Ingeniero Fausto Elio s/n, Valencia 46022, Spain 2 Instituto Nacional de Tecnologia Agropecuaria (INTA), Ruta N°9 Km 170, San Pedro 2930, Argentine

... Protein sequences were aligned by the clustalW method using the MegAlign software (DNAStar). Transmembrane domains were predicted with TMpred (http://www.ch.embnet.org) and protein localization with ProtComp v9.0 (http://linux1.softberry.com/berry.phtml). ...


Plant Cell Reports
Volume 32, Issue 8 , pp 1289-1298 DOI:10.1007/s00299-013-1443-0

Overexpression of a novel salt stress-induced glycine-rich protein gene from alfalfa causes salt and ABA sensitivity in Arabidopsis

Long et al.,
1. School of Life Science, Chongqing University, Chongqing, China 2. Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing, China

... Subcellular localization of MsGRP. The online ProtComp version 9.0 program (http://www.softberry. com) was used to predict the subcellular localization. The result predicted by the integral prediction method showed that MsGRP is most likely localized in the extracellular space. ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 115, Issue 3 , pp 443-455 DOI:10.1007/s11240-013-0375-2

Expression of SbSNAC1, a NAC transcription factor from sorghum, confers drought tolerance to transgenic Arabidopsis

Lu et al.,
1. Institute of Crop Science, Chinese Academy of Agricultural Sciences/The National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI), Beijing, 100081, China 2. Plant Science and Technology College, Beijing University of Agriculture, Beijing, China

... Subcellular localization of the SbSNAC1 protein. A nucleus-localization signal (NLS) was found in the N-terminal region of the SbSNAC1 protein using the online subcellular localization analysis software (http://linux1.softberry.com/berry.phtml). ...


Plant Molecular Biology
Volume 81, Issue 1-2 , pp 41-56 DOI:10.1007/s11103-012-9981-3

Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea

Sun et al.,
1. National Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, Zhejiang, China 2. Samuel Roberts Noble Foundation, Inc., 2510 Sam Noble Parkway, Ardmore, OK, 73401, USA

... 2007; Kaneda et al. 2009; Jensen et al. 2008; Wang et al. 2009; Bu et al. 2008; Takasaki et al. 2010). Subcellular localization of ONAC122 and ONAC131 ONAC122 and ONAC131 were predicted to localize in nucleus using ProtComp v9.0 (http://linux1.softberry. com/berry). ...


Malaria Journal
2013, 12:66 http://www.malariajournal.com/content/12/1/66

Expression profile of the Plasmodium falciparum intra-erythrocytic stage protein, PF3D7_1363700

Roberts1 et al.,
1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA. 2 Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, MO, USA.

... enter the se- cretory pathway. In support of this prediction, Softberry and PSORTII, two localization programs, predicted PF3D7_1363700 to be either a secreted or plasma mem- brane protein. Based on topology predictions, there ...


The Plant Cell Online
(2013). 25(6), 1946-1959. DOI:10.?1105/?tpc.?113.?113969

The transition from a phytopathogenic smut ancestor to an anamorphic biocontrol agent deciphered by comparative whole-genome analysis

Lefebvre et al.,
aDepartement de Phytologie, Universite Laval, Quebec G1V 0A6, Canada bAgriculture and Agri-Food Canada, Pacific Agri-Food Research Centre, Summerland V0H 1Z0, Canada

...TMHMM v2.0 (Krogh et al., 2001) predicted number of transmembrane domains and position according to cleavage site, and finally, correlation to LocDB or PotLocDB ProtComp v9.0 (http://www.softberry.com) databases....


PloS one
(2013). 8(2), e55879. DOI:10.1371/journal.pone.0055879

The NADPH Oxidase Complexes in Botrytis cinerea: Evidence for a Close Association with the ER and the Tetraspanin Pls1

Siegmund, U., Heller, J., van Kann, J. A., & Tudzynski, P.
Institut fuer Biologie und Biotechnologie der Pflanzen, Westfaelische Wilhelms Universitaet Muenster, Muenster, Germany Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands

...as well as Nox1, Nox2 and Nox4 from Homo sapiens were used to predict their cellular localization using ProtComp v. 9.0 (http://linux1.softberry.com/berry.phtml??topic=protcompan&group=programs&subgroup?=proloc)....


Molecular Microbiology
(2013),89: 29–51. DOI:10.1111/mmi.12254

Ustilago maydis natural antisense transcript expression alters mRNA stability and pathogenesis.

Donaldson, M. E. and Saville, B. J.
1Environmental and Life Sciences Graduate Program 2Forensic Science Program, Trent University, Peterborough, ON, Canada

...Furthermore, putative proteins were inspected for N-terminal secretion signals using SignalP v4.0 (Petersen et?al., 2011), TargetP v1.1 (Emanuelsson et?al., 2000), and ProtComp v9.0 (Softberry)...


Journal of Plant Physiology
Volume 169, Issue 10, 1 July 2012, Pages 992–998 DOI: 10.1016/j.jplph.2012.02.018

The AP2-like gene NsAP2 from water lily is involved in floral organogenesis and plant height

Luo et al.,
College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People's Republic of China

... The bar = 200 ?m. View thumbnail images. Subcellular localization of NsAP2 protein. The NsAP2 protein was predicted to be localized at the nucleus through sequence prediction analysis (http://linux1.softberry.com/berry.phtml?topic=proteinloc&prg=ProtComP). ...


Plant Molecular Biology Reporter
December 2012, Volume 30, Issue 6, pp 1283-1290DOI

Molecular Cloning and Characterization of Two 9-Lipoxygenase Genes from Taxus chinensis

Li et al.,
1. Institute of Resource Biology and Biotechnology, Department of Biotechnology, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, 430074, People’s Republic of China 2. Key Laboratory of Molecular Biophysics Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China

... Three different programs, Plant- mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/), SignalP (http://www.cbs.dtu.dk/services/SignalP/), and ProtComp (www.softberry.com/berry.phtml), were used for sub- cellular localization prediction based on the identification of ...


Malaria Journal
2012, 11:80 DOI: 10.1186/1475-2875-11-80

Transcript and protein expression profile of PF11_0394, a Plasmodium falciparum protein expressed in salivary gland sporozoites

Schlarman et al.,
1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA 2 Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, MO, USA

... Next, additional sequence analysis programs available on the ExPASy Bioinformatics Resource Portal and SoftBerry, such as PSORT and ProtComp, were used to verify that the proteins encoded by the genes were predicted to either be located on the surface and/or secreted ...


Plant growth regulation
2012, vol. 67, no2, pp. 171-184

CsPDR8 and CsPDR12, two of the 16 pleiotropic drug resistance genes in cucumber, are transcriptionally regulated by phytohormones and auxin herbicide in roots

Migocka M. (1) ; Papierniak A. (1) ; Warzybok A. (1) ; Klobus G. (1)
(1) Department of Plant Physiology, Institute of Plant Biology, Wroclaw University, 50-328, Wroclaw, Poland

... 0 software (Tamura et al. 2011) with bootstraps 1,000. The prediction of subcellular localization was performed using ProtComp v8.0 (softberry.com), whereas TMHMM method (Sonnhammer et al. 1998), based on a hidden ...


Plant Cell Reports
September 2012, Volume 31, Issue 9, pp 1737-1746 DOI: 10.1007/s00299-012-1287-z

An alfalfa (Medicago sativa L.) ethylene response factor gene, MsERF11, enhances salt tolerance in transgenic Arabidopsis

Tingting Chen et al.,
1. Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, 100193, People’s Republic of China 2. Department of Grassland Science, Animal Science and Technology College, Sichuan Agricultural University, Ya’an, 625014, People’s Republic of China

... Subcellular localization of the MsERF11 protein Subcellular localization of the MsERF11 protein was first carried out in silico using an online prediction program ProtComp Version 9.0 (http://linux1.softberry.com/berry.phtml). ...


Advanced Science Letters
Volume 10, Number 1, May 2012 , pp. 191-195(5) DOI: 10.1166/asl.2012.3742

A New Member of PAL Family Initiating Secondary Metabolism During Fatty Acid Biosynthesis in Camellia Oleifera Seeds

X Tan, H Chen, D Zhang, F Hu

... 281, and three transmembrane regions distributed at N-terminal of the protein. The sub-cellular location result predicted by Softberry revealed Co-PAL deposit in cytoplasmid. As shown as in Figure 3, it could be found that -helix ...


Journal of Integrative Agriculture
Volume 11, Issue 1, January 2012, Pages 31–42 DOI: 10.1016/S1671-2927(12)60780-9,

Molecular Characterization and Expression Analysis of TaZFP15, a C2H2-Type Zinc Finger Transcription Factor Gene in Wheat (Triticum aestivum L.)

Zhao-hua SUN a, Chang-huan DING a, Xiao-juan LI a, , , Kai XIAO b,
a College of Life Science, Agricultural University of Hebei, Baoding 071001, P.R. China b College of Agronomy, Agricultural University of Hebei, Baoding 071001, P.R. China

... 2). Based on analysis by SubLoc v1.0 www Server.url program and online analy- sis (http://linux1.softberry.com/berry.phtml), the sub- cellular location of TaZFP15 was predicted to be tar- geted onto the nucleus. ... 1.0 program (http://linux1. softberry.com/berry.phtml). ...


Molecular Biology Reports
September 2012, Volume 39, Issue 9, pp 9167-9177 DOI: 10.1007/s11033-012-1789-3

Analysis on DNA sequence of goat RFRP gene and its possible association with average daily sunshine duration

D. W. Huang et al.,
1. Key Laboratory of Farm Animal Genetic Resources and Germplasm Innovation of Ministry of Agriculture, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, 100193, People’s Republic of China 2. State Key Laboratory of Agricultural Biotechnology, China Agricultural University, Beijing, 100193, People’s Republic of China

... Protein struc- ture and function prediction were performed using Pep- stats (http://www.ebi.ac. uk/Tools/emboss/pepinfo/), PSO RT II Prediction (http://psort.hgc.jp/form2.html), ProtComp 9.0 (http://linux1.softberry.com/berry.phtml?topic= protcompan&group=programs&subgroup ...


Molecular Biology Reports
DOI: 10.1007/s11033-012-1577-0

Isolation and characterization of two hydroperoxide lyase genes from grape berries

Bao-Qing Zhu et al.,
1. Centre for Viticulture and Enology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China

... Sal I (for reverse primer) Mol Biol Rep 123 Page 4. PSORT (http://psort.ims.u-tokyo. ac.jp/), ChloroP 1.1 (http: //www.cbs.dtu.dk) and ProtComp (http://linux1.softberry. com/berry.phtml). The multiple sequence alignments of plant ...


PLoS ONE
7(4): e33731. doi:10.1371/journal.pone.0033731

The Predicted Secretome of the Plant Pathogenic Fungus Fusarium graminearum: A Refined Comparative Analysis

Brown NA, Antoniw J, Hammond-Kosack KE
Centre for Sustainable Pest and Disease Management, Department of Plant Pathology and Microbiology, Rothamsted Research, Harpenden, Hertfordshire, United Kingdom

... GPI-anchor proteins were predicted by big-PI (http://mendel.imp.ac.at/gpi/cgi-bin/gpi_?pred_fungi. cgi) [48]. ProtComp was also used to predict localization of the remaining proteins using the LocDB and PotLocDB databases (ProtComp v8.0; http://www.softberry.com). ...


Fungal diversity
2012, vol. 54, no 1, pp. 87-99 DOI: 10.1007/s13225-012-0169-6

First characterization of endophytic Corynespora cassiicola isolates with variant cassiicolin genes recovered from rubber trees in Brazil

Deon et al.,
(1) CIRAD, UMR AGAP, 63000, Clermont-Ferrand, France (2) Clermont Universite, Universite Blaise Pascal, UMR 547 PIAF, 63000, Clermont-Ferrand, France

... protein (Krogh et al. 2001). The ProtComp program (version 9.0; http://www.softberry. com) was used to predict the subcellular localization of the protein. Gene expression analyses by real-time PCR RNA extraction and cDNA ...


Plant Cell Reports
Volume 31, Issue 8 , pp 1473-1484 DOI: 10.1007/s00299-012-1262-8

ZmHSP16.9, a cytosolic class I small heat shock protein in maize (Zea mays), confers heat tolerance in transgenic tobacco

Liping Sun et al.,
1. State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, 61 Daizong Street, Tai’an, 271018, Shandong, China 2. Taishan Medical University, Tai’an, 271000, Shandong, China

... 2). In order to further confirm that ZmHSP16.9 belongs to cytosolic sHSP family, the amino acid sequence of ZmHSP16.9 was analyzed in the ProtComp v.9.0 database (http://linux1.softberry. com/berry.phtml?topic=protcomppl &group=programs&subgroup=proloc). ...


Molecular Biology Reports
Volume 39, Issue 3 , pp 2337-2345 DOI: 10.1007/s11033-011-0984-y

Molecular cloning and characterization of an F-box family gene CarF-box1 from chickpea (Cicer arietinum L.)

Yuying Jia et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China 2. Key Laboratory of Agricultural Biotechnology, Xinjiang Agricultural University, Urumqi, 830052, China

... proteins [42, 43]. But only one study reported that KFB protein LKP2 located in nuclei [33]. In this study, CarF-box1 was predicted to be located in the nucleus by ProtComp 6.1 (http://linux1.softberry.com/berry). To con- firm this ...


Biologia Plantarum
Volume 56, Issue 1 , pp 43-49 DOI: 10.1007/s10535-012-0014-5

Molecular cloning and characterization of a novel stress responsive gene in alfalfa

Long et al.,
1. College of Animal Science and Technology, China Agriculture University, Beijing, 100191, P.R. China 2. Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing, 100193, P.R. China

... 5). The position of the nucleus was visualized under laser scanning confocal microscope. In addition, we also used ProtComp v. 9.0 program online (www.softberry.com) to predict the subcellular localization, and the result showed that MsPBL most probably localized in nucleus. ...


BioMetals
Volume 25, Issue 2 , pp 275-283 DOI: 10.1007/s10534-011-9501-y

Identification and characterization of a novel outer membrane protein receptor required for hemin utilization in Vibrio vulnificus

Shreya Datta, Jorge H. Crosa
1. Department of Molecular Microbiology and Immunology, Oregon Health and Science University, 3181 SW Sam Jackson Park Road, Portland, OR, 97239, USA

... 2010) and ProtCompB (http:// linux1.softberry.com/berry.phtml?topic=protcompan &group=programs&subgroup) computational tools that are commonly used to predict subcellular local- ization of proteins in Gram-negative bacteria. ...


Gene
Volume 502, Issue 1, 1 July 2012, Pages 69–74 DOI: 10.1016/j.gene.2012.04.017

CsNAM-like protein encodes a nuclear localized protein and responds to varied cues in tea [Camellia sinensis (L.) O. Kuntze]

Asosii Paul a, 1, Richard Chalo Muoki a, b, 1, 2, Kashmir Singh b, Sanjay Kumar a
a Biotechnology Division, Council of Scientific and Industrial Research-Institute of Himalayan Bioresource Technology, Palampur, Himachal Pradesh-176061, India b Biotechnology Department, Panjab University, Chandigarh-160014, Punjab, India

... and [Peng et al., 2009]). In this study, CsNAM-like protein was expected to be localised in the nucleus as predicted by the analyses using PSORTII and ProComp v8.0 (http://linux1.softberry.com/berry). To confirm the localization ...


AJCS
6(4):649-655 (2012)

Molecular cloning and expression of 12-oxophytodienoic acid reductase gene from barley

Saeid Abu-Romman
Department of Biotechnology, Faculty of Agricultural Technology, Al-Balqa’ Applied University, Al-Salt, 19117, Jordan

... The amino acids sequence of HvOPR1 was deduced and analyzed with ProtParam tool (http://cn.expasy.org/tools/ protparam.html), and the prediction of subcellular localization was performed using the online tool ProtComp 9.0 (http://linux1.softberry.com/berry.phtml). ...


Journal of Plant Physiology
Volume 169, Issue 18, 15 December 2012, Pages 1807–1814 DOI: 10.1016/j.jplph.2012.07.014,

Characterization of a type-A response regulator differentially expressed during adventitious caulogenesis in Pinus pinaster

Jose M. Alvarez a, Millan Cortizo a, 1, Ricardo J. Ordas a, b
a Laboratorio de Biotecnologia Agroforestal, Escuela Politecnica de Mieres, Universidad de Oviedo, C/Gonzalo Gutierrez Quiros, 33600 Mieres, Spain b Area de Fisiologia Vegetal, Departamento BOS, Universidad de Oviedo, C/Catedratico Rodrigo Uria s/n, 33071 Oviedo, Spain

... The PipsRR1 protein was predicted to be nuclear (ProtComp 9.0 software, http://www.softberry. com). The receiver domain of PipsRR1, PipiRR1 and all of the Arabidopsis type-A RRs (RR 3–9 and RR 15–17) were aligned with the ClustalW software (Fig. ...


BMC Genomics x
BMC Genomics 2012, 13:221 doi:10.1186/1471-2164-13-221

Deciphering the genomic structure, function and evolution of carotenogenesis related phytoene synthases in grasses

Dibari et al.,
1 INRA - UMR 1095 ‘Genetique Diversite Ecophysiologie des Cereales’ (GDEC), 5 Chemin de Beaulieu, 63100, Clermont-Ferrand, France 2 INRA - Centre National de Ressources Genomiques Vegetales (CNRGV), Chemin de Borde Rouge BP 52627, 31326, Castanet Tolosan cedex, France

...However, according to ProtComp 9.0 [35] prediction, wheat PSY3 may have a putative chloroplast localization....


Plant Molecular Biology
Volume 81, Issue 1-2 , pp 41-56 DOI: 10.1007/s11103-012-9981-3

Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea

Sun et al.,
1. National Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, Zhejiang, China 2. Samuel Roberts Noble Foundation, Inc., 2510 Sam Noble Parkway, Ardmore, OK, 73401, USA

... 2007; Kaneda et al. 2009; Jensen et al. 2008; Wang et al. 2009; Bu et al. 2008; Takasaki et al. 2010). Subcellular localization of ONAC122 and ONAC131 ONAC122 and ONAC131 were predicted to localize in nucleus using ProtComp v9.0 (http://linux1.softberry. com/berry). ...


BMC Genomics
2012, 13:544 doi:10.1186/1471-2164-13-544

Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis

Katiyar et al.,
1 National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India 2 National Bureau of Plant Genetic Resources, Indian Agricultural Research Institute Campus, New Delhi, 110012, India

...and ProtComp 9.0 server ( http:/ / linux1.softberry.com/ berry.phtml?topic=protcomppl&group= programs&subgroup=proloc webcite). ...


PLoS ONE
7(12): e49904. doi:10.1371/journal.pone.0049904

Defining the Predicted Protein Secretome of the Fungal Wheat Leaf Pathogen Mycosphaerella graminicola

Morais do Amaral A, Antoniw J, Rudd JJ, Hammond-Kosack KE
Embrapa LabEx Programme, Rothamsted Research, Harpenden, Herts, United Kingdom, Department of Plant Biology and Crop Science, Rothamsted Research, Harpenden, Herts, United Kingdom

...ProtComp was also used to predict localization of the remaining proteins using the LocDB and PotLocDB databases (ProtComp v8.0; http://www.softberry.com)....


Molecular Biology Reports
Volume 39, Issue 2 , pp 1713-1720 DOI 10.1007/s11033-011-0911-2

Identification and expression pattern of one stress-responsive NAC gene from Solanum lycopersicum

Qinqin Han et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, China 2. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China

... affrc.go.jp/PLACE/index.html). Subcellular location of protein was predicted with ProComp v8.0 (http://linux1. softberry.com/berry). Multiple sequence alignment was performed using the ClustalW (http://www.ch.embnet.org /software/ClustalW.html). ...


BMC Genomics
2012 13(243). DOI: 10.1186/1471-2164-13-243

The genes and enzymes of the carotenoid biosynthetic pathway in Vitis vinifera L.

Young et al.,
Research and Innovation Centre. Genomics and Biology of Fruit Crops Department

... 1 cTP: Softberry ProtComp (http://www.softberry.com/berry.phtml) prediction for a chloroplast transit peptide 2 The size in base pairs of the cDNA copy of the gene from the predicted ATG to the predicted STOP codon; 3 The size in base pairs of the genomic copy of the gene from ...


POJ
5(2):94-102 (2012)

Genome-wide analysis of cytosolic and chloroplastic isoforms of glutathione reductase in plant cells

Ahmad Tahmasebi 1, Farzaneh Aram 2, Mansour Ebrahimi 3, Manijeh Mohammadi-Dehcheshmeh 4, Esmaeil Ebrahimie 1&5*
1Department of Crop Production & Plant Breeding, College of Agriculture, Shiraz University, Shiraz, Iran 2Institute of Biotechnology, College of Agriculture, Shiraz University, Shiraz University, Shiraz, Iran

...Genomic sequences were also analyzed in the FGENESH gene structure prediction program (http://www.softberry.com) and GeneMark program (http://opal.biology.gatech.edu/GeneMark).... ...Protein sorting and subcellular localization predictions were performed according to ProtComp program Version 5 (http://www.softberry.com/)...


Plant Cell Reports
October 2012 DOI 10.1007/s00299-012-1350-9

Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco

Sumita Omer (1) Santosh Kumar (1) (2) Bashir M. Khan (1)
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... 2). In silico sub-cellular localization of LlMYB1 protein was predicted to be nuclear using the program ProtComp ver- sion 9.0 (http://www.linux1.softberry.com/berry.phtml? topic= protcomppl&group=programs&subgroup=proloc) accessed from softberry server. ...


Molecular Biology Reports
Volume 39, Issue 4 , pp 3565-3572 DOI 10.1007/s11033-011-1130-6

Identification and characterization of a LEA family gene CarLEA4 from chickpea (Cicer arietinum L.)

Hanyan Gu et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China 2. Key Laboratory of Agricultural Biotechnology, Xinjiang Agricultural University, Urumqi, 830052, China

... For protein locali- zation analysis, ProtComp 6.1 (a program for identification of sub-cellular localization of eukaryotic proteins) (http:// linux1.softberry.com/berry.phtml?topic= protcompl&subgroup = programs&subgroup = proloc) and Subloc (Subcellular locali- zation) ...


Journal of Medical Entomology,
2012, Volume 49, Number 3, Pages 441-786 , pp. 656-671(16), DOI: http://dx.doi.org/10.1603/ME11165

Cloning and Characterization of the Peptidoglycan Recognition Protein Genes in the Mosquito, Armigeres subalbatus (Diptera: Culicidae)

Wang, Songjie; Conant, Gavin C.; Ou, Ruguang; Beerntsen, Brenda T.

... The AsPGRP protein sequences were analyzed for the presence of a signal peptide using SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP) and transmembrane domain using ProtComp Ver. 8.0 on SoftBerry (http://www.softberry.com). ...


Am J Trop Med Hyg
2012 vol. 86 no. 6 943-954 doi: 10.4269/ajtmh.2012.11-0797

PFE0565w, a Plasmodium falciparum Protein Expressed in Salivary Gland Sporozoites

Schlarman et al.,
Department of Veterinary Pathobiology, University of Missouri, Columbia, Missouri; Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, Missouri; Department of Global Health, University of South Florida, Tampa, Florida

... Next, additional sequence analysis programs available on the ExPASy Bioinformatics Resource Portal (www.expasy.org) and SoftBerry (www.softberry.com), such as PSORT and ProtComp, were used to verify that the proteins encoded by the genes were predicted to either be ...


Genet. Mol. Res.
11 (4): 3676-3687 (2012) DOI http://dx.doi.org/10.4238/2012.August.17.3

Regulation of ATG6/Beclin-1 homologs by abiotic stresses and hormones in rice (Oryza sativa L.)

R.M. Rana1,2, S. Dong1, Z. Ali3,4, J. Huang1 and H.S. Zhang1
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, China 2Department of Plant Breeding and Genetics, Pir Mehr Ali Shah Arid Agriculture University Rawalpindi, Rawalpindi, Pakistan

... Genomic and cDNA sequences of these proteins were retrieved from NCBI, and gene structure was predicted by FGENESH+ (http://linux1.softberry.com/ berry.phtml). The chromosomal location of each ATG6 gene in rice was determined from the rice physical map constructed by the International Rice Genome Sequencing Project (IRGSP) (http://rgp.dna.affrc.go.jp). Subcellular localization of the OsATG6 family was predicted by WoLF PSORT (Horton et al., 2006) and ProtComp (http://linux1.softberry.com/berry.phtml). ...


Gene
Volume 485, Issue 1, 1 October 2011, Pages 53–62 DOI: 10.1016/j.gene.2011.06.012

Novel genes specifically expressed during the development of the male thalli and antheridia in the dioecious liverwort Pellia endiviifolia

Sierocka et al.,
a Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland b Laboratory of Bioinformatics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland

... The subcellular location of predicted amino acid sequences was assigned with PSORT (http://psort.imsekundu-tokyo.ac.jp/form.html), TargetP 1.1 (http://www.cbsekunddtu.dk/services/ TargetP/) and ProtComp (http://linux1.softberry.com/berry.phtml?topic=protcompplandgroup ...


Insect Biochemistry and Molecular Biology
Volume 41, Issue 12, December 2011, Pages 956–967 DOI: 10.1016/j.ibmb.2011.09.005,

Functional characterization of ecto-5?-nucleotidases and apyrases in Drosophila melanogaster

Michaela Fenckova a, Radka Hobizalova a, Zdenek Faltynek Fric b, Tomas Dolezal a
a Faculty of Science, University of South Bohemia, Branisovska Street 31, Ceske Budejovice 37005, Czech Republic b Institute of Entomology, Biology Centre of the Academy of Sciences of the Czech Republic, Ceske Budejovice, Czech Republic

... 3; analyzed by SignalP 3.0 and SoftBerry ProtComp v. 9.0). Full-size image (30 K) Full-size image (30 K) Fig. 1. Gene structure of 5 loci with putative Ecto-5?-Nucleotidases. Three chromosomal regions with cytolocations marked in black boxes are shown. ...


Gene
485 (2011) 53–62 DOI: 10.1016/j.gene.2011.06.012

Novel genes speci?cally expressed during the development of the male thalli and antheridia in the dioecious liverwort Pellia endiviifolia

Sierocka et al.,
a Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland b Laboratory of Bioinformatics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland

... de/) programs. The subcellular location of predicted amino acid sequences was assigned with PSORT (http://psort.imsekundu- tokyo.ac.jp/form.html), TargetP 1.1 (http://www.cbsekunddtu. dk/ services/TargetP/) and ProtComp (http://linux1.softberry.com/berry. ...


POJ
4(5):239-249(2011)

Comparative analysis of the genomic regions flanking Xa21 locus in indica and japonica ssp. of rice (Oryza sativa L.)

Kumar et al.,
1Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Gachibowli Prof. C.R. Rao Road , Hyderabad 500046, India 2Department of Plant Pathology, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India

... Protcomp V 8.0 (http://linux1.softberry.com/ berry.phtml) analysis for the sub cellular location of proteins showed that 80% of the predicted TEs were nuclear in localization while the remaining were cytoplasmic or mitochondrial in both the rice lines (Table 9). GC Content in the ... ...Gene prediction from the 100 kb region flanking to Xa21 locus of chromosome 11 in japonica and indica rice was carried out using HMM based gene structure prediction software FGENESH tool (www.softberry.com) trained for monocot plant species (Salamov and Solovyer, 2000) ...


BMC Biotechnology
2011, 11:65 doi:10.1186/1472-6750-11-65

A novel subtilase with NaCl-activated and oxidant-stable activity from Virgibacillus sp. SK37

Ekkarat Phrommao 1, Jirawat Yongsawatdigul 1, Sureelak Rodtong 2 and Montarop Yamabhai 3
1 School of Food Technology, Institute of Agricultural Technology, Suranaree University of Technology, 111 University Avenue, Nakhon Ratchasima, 30000, Thailand 2 School of Microbiology, Institute of Science, Suranaree University of Technology, 111 University Avenue, Nakhon Ratchasima, 30000, Thailand

... AprX-SK37 lacks a canonical signal sequence for membrane translocation (signal peptide) at its N-terminus, indicating an intracellular location as suggested by sub-cellular prediction servers of SignalP 3.0 [24] and ProtCompB (Softberry Bioinformatics tools: http://linux1 ...


Biochemical Genetics
Volume 49, Issue 9-10 , pp 656-664 DOI: 10.1007/s10528-011-9440-x

Cloning and Expression of One Chloroplastic Ascorbate Peroxidase Gene from Nelumbo nucifera

Dong et al.,
1. Key Lab of the Ministry of Education for Plant Developmental Biology, College of Life Science, Wuhan University, Wuhan, 430072, China 2. Lotus Center, Wuhan University, Wuhan, 430072, China

... Subcellular APX was located using the Prot- Comp Version 6.1 program (http://linux1. softberry.com/cgi-bin/programs/proloc/ protcomppl.pl). The amino acid sequence of N. nucifera APX was compared with other species available in GenBank. ...


Biologia
Volume 66, Issue 5 , pp 828-832 DOI: 10.2478/s11756-011-0101-7

Expression analysis of nuclear W2-containing homologs of eukaryotic initiation factors in rice

Peipei Nie, Xiaoyu Li, Yaoguang Liu, Qunyu Zhang
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Sciences, South China Agricultural University, Wushan, Guangzhou, 510642, Guangdong, People’s Republic of China

... Subcellular localization of the rice W2 proteins was predicted in silico using the programs WoLF PSORT (Hor- ton et al. 2007) (http://www.genscript.com/psort/wolf psort.html) and ProtComp8.0 (http://linux1.softberry.com/ berry.phtml). ...


Enzyme and Microbial Technology
Volume 49, Issues 6–7, 10 December 2011, Pages 540–546 DOI: 10.1016/j.enzmictec.2011.06.002

Engineered tobacco and microalgae secreting the fungal laccase POXA1b reduce phenol content in olive oil mill wastewater

Zhang et al.,
a Department of Soil, Plant, Environmental and Animal Production Sciences, School of Biotechnological Sciences, University of Naples Federico II, Portici, Italy b Department of Biological Sciences, University of Naples Federico II, Naples, Italy

... 1 . 2.2. In silico analysis of cellular localisation. The computational prediction of subcellular localisation of POX A1b in plants was carried out by ProtComp 9.0 (http://www.softberry.com). 2.3. Expression vector construction. The ...


Biologia Plantarum
Volume 55, Issue 4 , pp 625-633 DOI: 10.1007/s10535-011-0160-1

Characterization and expression analysis of the SNF2 family genes in response to phytohormones and abiotic stresses in rice

X. -Y. Li et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of Life Sciences, South China Agricultural University, Wushan, Guangzhou, 510642, P.R. China

... Subcellular localization of the rice SNF2 proteins was predicted in silico using the programs WOLF PSORT (Horton et al. 2007), ProtComp8.0 (http://linux1. softberry.com/berry.phtml) and NUCLEO (Hawkins et al. 2007). The ...


African Journal of Microbiology Research
Vol. 5(18), pp. 2590-2595, 16 September, 2011 DOI: 10.5897/AJMR11.133

Cloning and characterization of a female gametophyte-specific gene in Gracilaria lemaneiformis (Gracilariales, Rhodophyte)

Peng Chen 1,4, HongBo Shao 1,2* and Di Xu 3
1The CAS/Shandong Provincial Key Laboratory of Coastal Environmental Processes, Yantai Institute of Costal Zone Research, Chinese Academy of Sciences (CAS), Yantai 264003, China. 2Institute for Life Sciences, Qingdao University of Science and Technology (QUST), Qingdao 266042, China.

... org/tools/protparam.html). Protein analysis was performed with ProtComp (www.softberry. com), TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and PSORT (http://psort.nibb. ac.jp/form2.html). RESULTS Screening of the SSH cDNA libraries ...


Plant Physiology and Biochemistry
Volume 49, Issue 9, September 2011, Pages 1064–1070 DOI: 10.1016/j.plaphy.2011.07.010,

Characterization of the sulfurtransferase family from Oryza sativa L

Sebastian Guretzki, Jutta Papenbrock
Institute for Botany, Leibniz University Hannover, Herrenhauserstr. 2, D-30419 Hannover, Germany

... number, the length (aa) and the mass (kDa) for 24 Str in Oryza are summarized [PSORT, WoLF PSORT, iPSORT, and TargetP (http://www.expasy.org/tools/); MultiLoc and TargetLoc (http://abi.inf.uni-tuebingen.de/Services/MultiLoc/) ProtComp (http://linux1.softberry.com/berry ...


Reproduction in Domestic Animals
(2011), 46: 980–989. doi: 10.1111/j.1439-0531.2011.01771.x

Molecular Cloning of Sheep and Cashmere Goat Pdia3 and Localization in Sheep Testis.

Lv, L., Ujisguleng, B., Orhontana, B., Lian, W. and Xing, W.
The key laboratory of mammalian reproduction biology and technology of ministry of education, School of Life Sciences, Inner Mongolia University, Hohhot, China

... smart.embl.de/smart/set_mode.cgi?NORMAL=1), InterProScan (http://www.ebi.ac.uk/Tools/pfa/ iprscan/), ExPASy-Compute pI/Mw tool (http://expasy.org/tools/pi_tool.html), ExPASy ScanProsite (http://expasy.org/tools/scanprosite), ProtComp v. 9.0 (http://linux1.softberry.com/berry ...


PLoS ONE
6(8): e23786. (2011) doi:10.1371/journal.pone.0023786

Identifying Schistosoma japonicum Excretory/Secretory Proteins and Their Interactions with Host Immune System.

Liao et al.,
Department of Parasitology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, People's Republic of China, Key Laboratory for Tropical Diseases Control, Ministry of Education, Sun Yat-sen University, Guangzhou, People's Republic of China, Bioinformatics Research Group, Key Laboratory of Intelligent Information Processing, Institute of Computing Technology, Chinese Academy of Sciences, Beijing, People's Republic of China

...By using the above strategy, the final precision to predict ES proteins was 100% for 8 groups of tested proteins and the average recall is 81.7%, which is much higher than state-of-art methods: SignalP [12], SecretomeP [13], Phobius [22] and ProtComp [23] (Table 1). ...


J. Antimicrob. Chemother.
(2011) 66 (1): 79-85. doi: 10.1093/jac/dkq418

Contribution of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni

Byeonghwa Jeon 1,†, Yang Wang 1,2, Haihong Hao 1,3, Yi-Wen Barton 1 and Qijing Zhang 1
1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, IA, USA 2Department of Pharmacology and Toxicology, College of Veterinary Medicine, China Agricultural University, Beijing, China

...CmeG is predicted to be an inner membrane protein by ProtComp Ver. 3.1 (http://linux1.softberry.com/berry.phtml) (data not shown) and transmembrane domain analysis (http://www.tcdb.org/progs/hydro.php) showed that CmeG possesses 12 TMs (see sequence alignment in Figure S1, available as Supplementary data at JAC Online). ...


Functional Plant Biology
38(6) 479-492 http://dx.doi.org/10.1071/FP10246

Analysis of differentially expressed genes in leaf rust infected bread wheat involving seedling resistance gene Lr28

Dhariwal et al.,
A Molecular Biology Laboratory, Department of Genetics and Plant Breeding, Ch. Charan Singh University, Meerut-250004, UP, India. B Interdisciplinary Centre for Plant Genomics and Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India.

... Motif and Prosite pattern identification was carried out using PPSearch program (Prosite Database, EMBL-EBI). Locations of proteins in tissue were predicted using ProtComp V. 9.0 program (available at http://www.softberry.com/berry.phtml, accessed 9 June 2009). ...


Genomics and Applied Biology
2011, Vol.2 No.1 doi: 10.5376/gab.2011.02.0001

Cloning of an Ascorbate Peroxidase Gene from Puccinellia tenuiflora and its Expression Analysis

Qingjie Guan 1,2 Lin Li 1 Takano Tetsuo 2 Shenkui Liu 1
1. Alkali Soil Natural Environmental Science Center (ASNESC), Northeast Forestry University, Harbin, 150040; 2. Asian Natural Environment Science Center (ANESC), The University of Tokyo, Tokyo, 1880002, Japan

... nph) by ProtParam soft. At last, the subcellular localization of PutAPx gene was analysed and predicted respectively by PSORT and ProtComp Version 611 softwares (http://www.softberry. Compberry.phtml). 3.6 Congstruction of ...


Plant Physiology and Biochemistry
Volume 49, Issue 7, July 2011, Pages 792–799 DOI: 10.1016/j.plaphy.2011.01.018

Molecular cloning, characterization, and expression of an alfalfa (Medicago sativa L.) heme oxygenase-1 gene, MsHO1, which is pro-oxidants-regulated

Fu et al.,
a College of Life Sciences, Cooperative Demonstration Laboratory of Centrifuge Technique, Nanjing Agricultural University, Nanjing 210095, PR China b Institute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Jiangsu Province Key Laboratory for Plant Ex-situ Conservation, Nanjing 210014, PR China

... HY1 in Arabidopsis is most likely localized in the plastids [21] and [22]. In this study, MsHO1 protein was predicted to be located in the mitochondrial, endoplasmic reticulum, and chloroplast by ProComp v9.0 (http:/linux1.softberry.com/berry). ...


Plant Science
Volume 181, Issue 3, September 2011, Pages 242–248 DOI: 10.1016/j.plantsci.2011.05.016,

Cellular localization of dual positional specific maize lipoxygenase-1 in transgenic rice and calcium-mediated membrane association

Cho et al.,
a Department of Molecular Biotechnology and Kumho Life Science Laboratory, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea b Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea

... v.1.03, SignalP 3.0, TargetP 1.1 and SIGFIND 2. However, none of these programs identified any potential targeting sequence except ProtComp 6.1 which predicted that ZmLOX1 is a cytoplasmic membrane-bound protein with ProtComp score of 11.1 (http://www.softberry.com/). ...


Journal of Theoretical Biology
Volume 262, Issue 4, 21 February 2010, Pages 750-756

Predict potential drug targets from the ion channel proteins based on SVM

Chen Huang et al.,
a College of Bioinformatics Science and Technology, Harbin Medical University, Harbin 150086, China b Biomedical Engineering Institute of CUMS, Beijing 100054, China

... In stage 2, we searched for potential ion channel targets based on known ion channel target protein characteristics. 2. Method. 2.1. Datasets. ... The ProtComp 8.0 program (ProtComp) was used to predict protein subcellular localization. ...


Molecular Oncology
Volume 4, Issue 6, Pages 496-510 (December 2010)

Cancer secretomics reveal pathophysiological pathways in cancer molecular oncology

George S. Karagiannis ab, Maria P. Pavlou ab, Eleftherios P. Diamandis abc
a Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, ON, Canada b Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada

... Protcomp algorithms (http://www.softberry.com) [Softberry ProtComp 6.0 [http://www.softberry. com/berry.phtml?topic=protcompan&group=help&subgroup=proloc]], SignalP (http://www.cbs. dtu.dk/services/SignalP/) ([Bendtsen et al., 2004a] and [Bendtsen et al., 2004b]), web ...


Mol Biol Rep.
2010 Feb;37(2):1081-8.

Molecular analysis of an actin gene, CarACT1, from chickpea (Cicer arietinum L.)

Peng et al.,
State Key Laboratory of Crop Genetics and Germplasm, Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, 210095 Nanjing, China

... The putative CarACT1 had 377 amino acids with the pre- dicted molecular mass of 41.96 kD and the isoelectric point of 5.16. Based on the analysis by the Softberry program (ProtComp v8.0; http://linux1.softberry.com/berry.phtml), CarACT1 was localized in the cytoplasm. ... 


BMC Genomics
2010, 11:225doi:10.1186/1471-2164-11-225

Differential transcript expression between the microfilariae of the filarial nematodes, Brugia malayi and B. pahangi

Michael M Kariuki 1, Leonard B Hearne 2 and Brenda T Beerntsen
1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri, Columbia, MO 65211, USA 2 Department of Statistics, College of Arts and Science, University of Missouri, Columbia, MO 65211, USA

... preferentially expressed transcripts were further analyzed by PSORTII [24] and ProtComp (http://www.softberry.com); two protein algorithm that give more detailed protein localization predictions. ... localization algorithm, ProtComp, from Softberry Inc (http://www.softberry.com/). ... 


Appl. Comput. Math.
V.9, Special Issue, 2010, pp. 19-33

POSSIBLE FUNCTIONAL AND EVOLUTIONARY ROLE OF PLASTID DNA INSERTIONS IN RICE GENOME

YAGUT YU. AKBAROVA 1,2, VICTOR V. SOLOVYEV 3, ILHAM A. SHAHMURADOV 1
1 Bioinformatics Laboratory, Institute of Botany, Baku AZ1073, Azerbaijan 2 College of Medicine and Health Sciences, Sultan Qaboos University, Muscat, Sultanate of Oman 3 Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20, UK

... of amino acid sequences has been carried out by BLAST program [1]. Search for statistically significant open reading frames (ORFs) and putative target compartments of proteins were done by BESTORF and ProtComp programs, respectively (http://www.softberry.com). ... 


Molecular Biotechnology
2010 Volume 44, Number 1, 30-40, DOI: 10.1007/s12033-009-9202-8

Cloning and Characterization of a Novel NAC Family Gene CarNAC1 from Chickpea (Cicer arietinum L.)

Peng et al.,

... CarNAC1 is a Nuclear Protein Transcription factor always functions in the nuclei, and numerous NACs have been located in the cell nucleus [3, 4, 20]. In this study, CarNAC1 was predicted to be located in the nucleus by ProComp v8.0 (http://linux1.softberry.com/ berry). ... 


Planta
2010 Volume 231, Number 6, 1425-1437, DOI: 10.1007/s00425-010-1143-8

Comparative molecular and biochemical characterization of segmentally duplicated 9-lipoxygenase genes ZmLOX4 and ZmLOX5 of maize

Yong-Soon Park, Susan Kunze, Xinzhi Ni, Ivo Feussner and Michael V. Kolomiets
(1) Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843-2132, ETATS-UNIS (2) Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August University, Justus-von-Liebig-Weg 11, 37077 Gottingen, ALLEMAGNE

... Four different pub- licly available programs, including ProtComp (http://linux1. softberry.com), TargetP (http://www.cbs.dtu.dk/services/ TargetP/), ChloroP (http://www.cbs.dtu.dk/services/ ChloroP/) and WolfPsort (http://wolfpsort.org) were utilized to pre- dict the subcellular ...


Biosci Rep.
2009 Oct 9;30(1):59-71, 1 p following 71

Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress

Daurelio LD, Checa SK, Barrio JM, Ottado J, Orellano EG
Molecular Biology Division, IBR (Instituto de Biologia Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cientificas y Tecnicas), Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina.

... services/SignalP/). Subcellular localization was analysed using ProtComp v6.0 (http://www.softberry.com, Protein location/patterns/Epitops, ProtComp) and TargetP (http://www.cbs.dtu.dk/services/TargetP/). Transcription and ... 


Biochimica et Biophysica Acta (BBA) - Bioenergetics
Volume 1787, Issue 3, March 2009, Pages 135-143

Cyanobacterial cytochrome cM: Probing its role as electron donor for CuA of cytochrome c oxidase

Bernroitner et al.,
aMetalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU – University of Natural Resources and Applied Life Sciences, Muthgasse 18, A-1190 Vienna, Austria

... role as either signal peptide or transmembrane helix several bioinformatic tools were used (selected organism group: gram negative prokaryotes): (i) SignalP, version 3.0 (http://www.cbs. dtu.dk/services/SignalP/) [30]; (ii) ProtCompB, version 3 (http://www.softberry.com/berry ...


Biosci Rep.
2009 Oct 9;30(1):59-71, 1 p following 71

Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress

Daurelio LD, Checa SK, Barrio JM, Ottado J, Orellano EG.
Molecular Biology Division, IBR (Instituto de Biologia Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cientificas y Tecnicas), Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina

... Subcellular localization was analysed using ProtComp v6.0 (http://www.softberry.com, Protein location/patterns/Epitops, ProtComp) and TargetP (http://www.cbs.dtu.dk/services/TargetP/). Transcription and translation initiation sites were inferred with ProScan ...


Plant Physiology and Biochemistry
Volume 47, Issues 11-12, November-December 2009, Pages 1037-1045

Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated

Hui Peng et al.,
aState Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, Nanjing 210095, China bKey Laboratory of Ecology of Rare and Endangered Species and Environmental Protection, Ministry of Education, Guangxi Normal University, Guilin 541004, China

... View Within Article. 2.4. CarNAC5 is a nuclear protein. Numerous NACs have been located in the nucleus [5], [6] and [18]. In this study, CarNAC5 protein was predicted to be located in the nucleus by ProtComp v8.0 (http://linux1.softberry.com/berry). ...


Current Genetics
Volume 55, Number 4 / August 2009 ,pp. 485-496

Functional analysis of an a-1,2-mannosidase from Magnaporthe oryzae

Jie Zhou et al.,
(1) The Ministry of Education Key Laboratory of Biopesticide and Chemical Biology, Fujian Agriculture and Forestry University, 350002 Fuzhou, China (2) Department of Plant Pathology and Microbiology, Texas A & M University, College Station, TX 77843-2132, USA

... al. 2004), and SignalP 3.0 (http://www.cbs.dtu.dk/services/) (Nielsen et al. 1997) and Protcomp v8.0 (Softberry.com) were applied to predict its cleavage site and its possible sub-cellular localiza- tion (Soderlund et al. 2006). The ...


Infection and Immunity
October 2009, p. 4356-4361, Vol. 77, No. 10 doi:10.1128/IAI.00242-09

High-Throughput Identification of New Protective Antigens from a Yersinia pestis Live Vaccine by Enzyme-Linked Immunospot Assay{triangledown}

Bei Li et al.,
Laboratory of Analytical Microbiology, State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and Epidemiology, Beijing 100071, China,1 Yunyang Medical College, Shiyan, Hubei Province, China2

... were subjected to computer analysis to identify genes potentially encoding surface-exposed, membrane-associated proteins by using PSORTb (http://www.psort.org/psortb/), SignalP (http://www.cbs.dtu.dk/services/SignalP/), and ProtcompB (http://linux1.softberry.com/berry.phtml ...


Plant Physiology Preview
Published on September 16, 2009; 10.1104/pp.109.144766

A Nuclear Factor Regulates Abscisic Acid Responses in Arabidopsis

Min Jung Kim , Ryoung Shin , and Daniel P. Schachtman
Donald Danforth Plant Science Center, St. Louis, MO 63132

... npx1-1 and wild type. NPX1 Is a Nuclear Protein We identified three putative nuclear localization sequences (NLS; softberry ProtComp6.0 http://www.softberry.com/berry. phtml?topic=protcompan&group=help& sub group =proloc ...


New Phytologist,
2008 Volume 177 Issue 1, Pages 77 - 89

Transcript profiles of the cytokinin response regulator gene family in Populus imply diverse roles in plant development

Gustavo A. Ramirez-Carvajal, Alison M. Morse and John M. Davis
1 Plant Molecular and Cellular Biology Program, University of Florida, PO Box 110690, Gainesville, FL 32611, USA; 2 School of Forest Resources and Conservation, University of Florida, PO Box 110410, Gainesville, FL 32611, USA

... silico using the software packages TargetP1.1 (http://www.cbs.dtu.dk), WoLF PSORT (http://www.wolfpsort.seq.cbrc.jp) and ProtComp 6.0 (http://www.softberry.com ...


Current Genetics
Volume 53, Number 4 / April, 2008 Page 217-224

Biochemical and molecular characterization of a putative endoglucanase in Magnaporthe grisea

Jie Zhou et al.,
(1) The Key Laboratory of Biopesticide and Chemistry Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002 Fuzhou, People’s Republic of China (2) The School of Life Sciences, Fujian Agriculture and Forestry University, 350002 Fuzhou, People’s Republic of China (3) Departmant of Plant Pathology and Microbiology, Texas A & M University, College Station, TX 77843-2132, USA

... cbs.dtu.dk/services/), and it was also predicted as being a secretory protein tar- geted at the extracellular compartment by ProtComp (http:/ /www.softberry.com ...


Planta
Volume 227, Number 2 / January, 2008 Pages 491-503

A novel plastidial lipoxygenase of maize ( Zea mays ) ZmLOX6 encodes for a fatty acid hydroperoxide lyase and is uniquely regulated by phytohormones and pathogen infection

Xiquan Gao, Michael Stumpe, Ivo Feussner and Michael Kolomiets
(1) Department of Plant Pathology and Microbiology, Texas A&M University, 2132 TAMU, College Station, TX 77843-2132, USA (2) Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August-University Goettingen, Justus-von-Liebig-Weg 11, 37077 Goettingen, Germany

... otherwise. Subcellular localization was predicted using four diVer- ent programs ProtComp (http://www.softberry.com/berry. phtml ...


Molecular Genetics and Genomics
Volume 279, Number 1 / January 2008 27-39

Identification and characterization of secreted and pathogenesis-related proteins in Ustilago maydis

Olaf Muller, Peter H. Schreier and Joachim F. Uhrig
(1) Max Planck Institute for Plant Breeding Research, Carl-von-Linne' Weg 10, 50829 Koeln, Germany (2) Present address: Department of Regine Kahmann, Max Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany

... ProtComp (v. 6.0; http://www.soft- berry.com) analyzes the entire protein sequence ... neu- ral network, NN, and hidden markov model, HM) and prot- comp (v. 6.0 ...


MPMI
December 2008, Volume 21, Number 12 Pages 1571-1581

Phases of Infection and Gene Expression of Fusarium graminearum During Crown Rot Disease of Wheat

Amber E. Stephens, Donald M. Gardiner, Rosemary G. White, Alan L. Munn, and John M. Manners
1CSIRO Plant Industry, Queensland Bioscience Precinct, 306 Carmody Road, St. Lucia, Brisbane, QLD 4067, Australia; 2The Institute for Molecular Bioscience, The University of Queensland, St Lucia, QLD, 4072, Australia 3CSIRO Plant Industry, PO Box 1600, Canberra ACT 2601, Australia

.. Of these, 19 are predicted to be extracellular secreted proteins (ProtComp 6.0; Softberry, Inc., Mount Kisco, NY, USA) and most, if not all, probably act as ...


Eukaryotic Cell
February 2008, p. 368-378, Vol. 7, No. 2

A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes

Gioti et al.
UMR1290 BIOGER-CPP, INRA, Route de St-Cyr, 78026 Versailles, France

... 4). BcPIE3 protein was predicted to locate at the endoplasmic reticulum membrane according to Protcomp version 6.0 software (http://www.softberry.com). ...


PLoS ONE.
2008; 3(6): e2300.

Comparative Genome Analysis of Filamentous Fungi Reveals Gene Family Expansions Associated with Fungal Pathogenesis

Darren M. Soanes et al.,
1School of Biosciences, Geoffrey Pope Building, University of Exeter, Exeter, United Kingdom 2School of Computer Science, University of Manchester, Manchester, United Kingdom

... For example, a similar analysis for M. grisea using SignalP and ProtComp (www.Softberry.com) predicted only 739 secreted proteins (out of a proteome of 11,109 ...


Insect Biochemistry and Molecular Biology
Volume 38, Issue 2, February 2008, Pages 166-175

Angiotensin-converting enzyme in Spodoptera littoralis: Molecular characterization, expression and activity profile during development

Els Lemeire, Bartel Vanholme, Thomas Van Leeuwen, John Van Camp and Guy Smagghe
Laboratory of Agrozoology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, B-9000 Ghent, Belgium bResearch Group of Applied Molecular Genetics, Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium cResearch Group of Food Chemistry and Human Nutrition, Department of Food Safety and Food Quality, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium

... Server (Nielsen et al., 1997; Bendtsen et al., 2004) and sub-cellular localization of the protein was predicted by Protcomp 6.0 (http://sun1.softberry.com/berry ...


Experimental Parasitology ,
Volume 117, Issue 2, October 2007, Pages 124-132

Toxocara canis: Molecular cloning, characterization, expression and comparison of the kinetics of cDNA-derived arginine kinase

Susiji Wickramasinghe et al.,
Department of Environmental Health Sciences, Kochi Medical School, Oko, Nankoku City, Kochi 783-8505, Japan

...... i Softberry (http://sun1.softberry.com/cgi-bin/programs/proloc/protcompan.pl). j ...


Trends in Plant Science ,
Volume 12, Issue 6, June 2007, Pages 239-244

The tify family previously known as ZIM

Bartel Vanholme, Wim Grunewald, Alex Bateman, Takayuki Kohchi and Godelieve Gheysen
Faculty of Bioscience Engineering, Department of Molecular Biotechnology, Ghent University, Coupure links 653, B-9000 Ghent, Belgium
2Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK
3Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan

...Subcellular localization as predicted by Protcomp 6.0 from Softberry. d ...


Nature Protocols,
2, 953 - 971 (01 Apr 2007)

Locating proteins in the cell using TargetP, SignalP and related tools

Olof Emanuelsson, SA,ren Brunak, Gunnar von Heijne, Henrik Nielsen

...SignalP 3.0, SignalP 2.0 and TargetP to PrediSi, Phobius and ProtComp 6.0 (a commercially available program from Softberry Inc.) on a set of exclusively mammalian proteins....


Journal of Biochemistry and Molecular Biology,
Vol. 40, No. 2, March 2007, pp. 247-260

Molecular Cloning of Two Genes Encoding Cinnamate 4-Hydroxylase (C4H) from Oilseed Rape (Brassica napus)

An-He Chen 1,2,, You-Rong Chai 1,, Jia-Na Li 1,,* and Li Chen 1
1Chongqing Rapeseed Technology Research Center; Chongqing Key Laboratory of Crop Quality Improvement; Key Lab of Biotechnology & Crop Quality Improvement of Ministry of Agriculture; College of Agronomy and Life Sciences, Southwest University, Beibei, Chongqing 400716, People’s Republic of China
2College of Bio-Information, Chongqing University of Posts and Telecommunications, Huang jueya, Nanan Zone, Chongqing 400065, People’s Republic of China

...respectively. Softberry- ProtComp 6.0 (http://www.softberry. com/berry.phtml) also definitely predicted them to be ER-membrane bound with scores of 3.1 and 3.0 respectively...


Journal of Experimental Botany
2006 57(14):3767-3779; doi:10.1093/jxb/erl137

Duplicate maize 13-lipoxygenase genes are differentially regulated by circadian rhythm, cold stress, wounding, pathogen infection, and hormonal treatments

Andriy Nemchenko1, Susan Kunze2, Ivo Feussner2 and Michael Kolomiets1,*
1Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843-2132, USA
2Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August University Gottingen, Justus-von-Liebig-Weg 11, D-37077 Gottingen, Germany

... Subcellular localization was predicted based on the identification of signal peptide sequences by four different programs ProtComp (www.softberry.com/berry ...


NATURE
444, 97-101 (2 November 2006)

Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis

Jorg Kamper et al.,
Department of Organismic Interactions, Max Planck Institute for Terrestrial Microbiology, Karl-von-Frisch Strasse, D-35043 Marburg, Germany

...Prediction of secreted proteins. For the prediction of amino-terminal secretion signals, SignalP 3.0 (ref. 26) was used. A total of 750 proteins were predicted to carry a signal peptide both by the hidden Markov and the neural network algorithms. These candidates were analysed with the integral prediction score of ProtComp 6.0 (http://www.softberry.com), yielding 426 candidate secreted proteins. ...


In Silico Biology
7, 0002 (2006)

In silico analysis of the Lateral Organ Junction (loj) gene and promoter of Arabidopsis thaliana

Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India

The probable organelle targeting signal sequence was detected using TargetP 1.1 (http://www.cbs.dtu.dk/services/TargetP/) [Emanuelsson et al., 2000], Mitoprot v1.0a4 (http://ihg.gsf.de/ihg/mitoprot.html) [Claros and Vincens, 1996], Predotar v1.03 (http://urgi.infobiogen.fr/predotar/) [Small et al., 2004], ProtComp v6.0 (SoftBerry Inc.) (http://www.softberry.com/) and Plant RNA Binding Protein Database (PlantRBP) (http://plantrbp.uoregon.edu/advsearch.php).


MPMI (Molecular plant-microbe interactions)
Vol. 19, No. 10, 2006, pp. 1055-1061 DOI: 10.1094/MPMI -19-1055.

TECHNICAL ADVANCE
MGOS: A Resource for Studying Magnaporthe grisea and Oryza sativa Interactions

Carol Soderlund et al.,
Arizona Genomics Computational Laboratory, Bio5 Institute, University of Arizona, Tucson 85721, U.S.A

Hence, the ESTs and genomic sequence for M. grisea were mined for putatively secreted proteins using SignalP (Bendtsen et al. 2004) to identify those containing likely signal sequence cleavage sites and PROTCOMP, available from Softberry, to predict cellular localization of the putative proteins, which resulted in 739 proteins.


Molecular Biology Reports
33 (2006), 4, 279-285

GmZFP1 encoding a single zinc finger protein is expressed with enhancement in reproductive organs and late seed development in soybean (Glycine max)

Fang Huang, Yingjun Chi, Qingchang Meng, Junyi Gai and Deyue Yu
National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China

... the ProtComp program (http://. www.softberry.com) still predicted that GmZFP1 pro- ..


Nucleic Acids Research
2006, Vol. 34, No. 17 4685-4701 doi:10.1093/nar/gkl588

Organization of chromosome ends in the rice blast fungus, Magnaporthe oryzae

Cathryn Rehmeyer et al.,
Department of Plant Pathology and 2Department of Biology, University of Kentucky, Lexington, KY 40546 USA

Cellular localization prediction for secreted proteins was performed with ProtComp version 6.0 for animal and fungi (www.softberry.com).


GENES & DEVELOPMENT
(2006) 20:1365-1377

The chicken talpid3 gene encodes a novel protein essential for Hedgehog signaling

Megan G. Davey et al.,
Division of Cell and Developmental Biology, Wellcome Trust Biocentre (WTB), University of Dundee, Dundee DD1 5EH, United Kingdom

Using the program ProtComp, the KIAA0586 protein was predicted to be cytoplasmic.


DNA Sequence - The Journal of Sequencing and Mapping
Volume 17, Number 1 / February 2006 pp. 41 - 48

Molecular cloning and characterization of a rice blast-inducible RING-H2 type Zinc finger gene

Xiang-Bing Meng, Wen-Sheng Zhao, Rui-Ming Lin, Min Wang, You-Liang Peng
China Agricultural University, Department of Plant Pathology, Beijing, 100094, People's Republic of China

... were identified in putative OsRING-1 protein. The ProtComp program (http://softberry. com) a putative nuclear localization motif ...


Journal of Lipid Research
, Vol. 47, 268-283, February 2006

Further characterization of mammalian ceramide kinase: substrate delivery and (stereo)specificity, tissue distribution, and subcellular localization studies

Helena Van Overloop, Sofie Gijsbers, and Paul P. Van Veldhoven
Katholieke Universiteit Leuven, Faculteit Geneeskunde, Departement Moleculaire Celbiologie, Afdeling Farmacologie, Leuven, Belgium

... as predicted by different algorithms [SignalP 3.0 (54), http://www.cbs.dtu.dk/services/ SignalP/#submission; ProtComp 6.0, http://sun1.softberry.com/berry.phtml ...


Microbiology
152 (2006), 547-554

MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur

Sascha Brunke and Bernhard Hube
Robert Koch-Institut, Nordufer 20, D-13353, Berlin, Germany

... 2.0 algorithm (Krogh et al., 2001 ) and TargetP 1.1 (Emanuelsson et al., 2000 ) at the CBS prediction server, or with ProtComp 6.0 at www.softberry.com, with ...


Genes and Immunity,
2005, 6, 319–331. doi:10.1038/sj.gene.6364173

Immune response in silico(IRIS): immune-specific genes identified from a compendium of microarray ...

AR Abbas, D Baldwin, Y Ma, W Ouyang, A Gurney, F ...
Department of Bioinformatics, Genentech, Inc., South San Francisco, CA, USA

... The ProtCompalgorithm (Softberry, Inc.) predicts for the 1589 IRIS genes with ORFs that 24% of the encoded proteins are in the plasma membrane, 13% are ...


Plant Molecular Biology
Volume 59, Number 2 / September, 2005, pp. 323-343

Genomic Analysis of the 12-oxo-phytodienoic Acid Reductase Gene Family of Zea mays

Zhang et al.,
1) Department of Plant Pathology and Microbiology, Department of Plant Pathology, Texas A&M University, 2132 TAMU, College Station, Texas 77843-2132, USA (2) Pioneer Hi-Bred International, Inc., 7250 NW 62nd Ave., Johnston, Iowa 50131-0552, USA

... nibb. ac.jp/), TargetP (http://www.cbs.dtu.dk/services/ TargetP/) and ProtComp (http://www.softberry. com/berry.phtml). Transcription ...


BMC Bioinformatics
2005, 6:256doi:10.1186/1471-2105-6-256

Evaluating eukaryotic secreted protein prediction

Eric W Klee and Lynda BM Ellis
Department of Laboratory Medicine and Pathology, University of Minnesota, Mayo Mail Code 609, 420 SE Delaware Street, Minneapolis, MN 55455, USA

... ProtComp 6.0, from Softberry, Inc., predicts protein localization, including extracellular proteins, using a combination of neural networks and sequence ...


Genetics and Molecular Biology
28, 3 (suppl), 529-538 (2005)

Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L

Felipe Karam Teixeira, Larissa Menezes-Benavente, Vinícius Costa Galvão and Marcia Margis-Pinheiro
Universidade Federal do Rio de Janeiro, Departamento de Genética, Laboratório de Genética Molecular Vegetal, Rio de Janeiro, RJ, Brazil.

.. Protein sorting and subcellular localization predictions were performed according to ProtComp program Version 5 (http://www.softberry.com/) ...


MPMI
Vol. 17, No. 7, 2004, pp. 789-797. Publication no. M-2004-0426-01R. © 2004 The American Phytopathological Society

Lotus japonicus LjKUP Is Induced Late During Nodule Development and Encodes a Potassium Transporter of the Plasma Membrane

Guilhem Desbrosses, Claudia Kopka, Thomas Ott, and Michael K. Udvardi
Max Planck Institute of Molecular Plant Physiology, Am Muhlenberg 1, 14476 Golm, Germany

...Both PSORT and ProtComppredicted a PM location for LjKUP...



Planta

Issue: Volume 218, Number 6 Date: April 2004 Pages: 965 - 975

Biochemical and immunological characterization of pea nuclear intermediate filament proteins

Sonal S. D. Blumenthal1, Gregory B. Clark1 and Stanley J. Roux1
(1) School of Biological Sciences, Section of Molecular Cell and Developmental Biology, The University of Texas, Austin, TX 78712, USA Stanley J. Roux Email: sroux@uts.cc.utexas.edu

... html), BCM Search Launcher (Protein structure prediction, http:// searchlauncher. bcm.tmc.edu/), SoftBerry (Protein subcellular. localization ...


Comparative and Functional Genomics
Volume 5, Issue 4 , Pages 342 - 353
Published Online: 20 May 2004

Research Paper
Investigation into the use of C- and N-terminal GFP fusion proteins for subcellular localization studies using reverse transfection microarrays
Ella Palmer, Tom Freeman *
MRC Rosalind Franklin Centre for Genomics Research (formerly the HGMP-Resource Centre), Genome Campus, Hinxton, Cambridge CB10 1SB, UK

... ProtCompversion 4 (Softberry) combines results with proteins of known subcellular localization and assumed subcellular localization (based on theoret- ical ...


Plant Physiol.
2004; 134: 286-295.

RHM2 Is Involved in Mucilage Pectin Synthesis and Is Required for the Development...

Usadel et al.

... Tentative subcellular localization prediction by TargetP (Emanuelsson et al., 2000 ) or ProtComp (http://www.softberry.com), a prediction software trained on ...


Journal of Cellular Biochemistry
Volume 90, Issue 2 , Pages 361 - 378
Published Online: 3 Sep 2003

A proteomic study of the arabidopsis nuclear matrix

Tomasz T. Calikowski 1 3, Tea Meulia 2, Iris Meier 1 *
1Department of Plant Biology and Plant Biotechnology Center, Ohio State University, Columbus, Ohio 43210

... For prediction of subcellular localization, ProtComp4 (Softberry, Inc., Mount Kisco, NY; http://www.softberry.com/berry.phtml?topic? proteinloc), PSORT v.6.4 ...


International Journal for Parasitology
Volume 33, Issue 11, 30 September 2003, Pages 1195-1206

Trehalose metabolism genes in Caenorhabditis elegans and filarial nematodes

Pellerone et al.,
a School of Biochemistry & Molecular Biology, Faculty of Science, Australian National University, Canberra, ACT 0200, Australia

... potential GPI anchors, membrane-spanning regions, signal peptides and predicted subcellular localisation using ProtComp ver.5 at http://www.softberry.com/berry ...


The Journal of Neuroscience
August 13, 2003, 23(19):7415-7425

Freud-1: A Neuronal Calcium-Regulated Repressor of the 5-HT1A Receptor Gene

Xiao-Ming Ou et al.,
Ottawa Health Research Institute, Neuroscience, University of Ottawa, Ottawa, Ontario, Canada K1H-8M5

... a consensus nuclear localization signal was not identified, Freud-1 localization is predicted to be nuclear (ProtComp program; http://www.softberry.com/berry ...


Cellular Molecular Life Sciences,
2003, in press

Automatic prediction of protein function

Burkhard Rost 1, 2, 3, *, Jinfeng Liu 1, 3, 4, Rajesh Nair 1, 5, Kazimierz O. Wrzeszczynski 1 and Yanay Ofran 1,6
1 CUBIC, Dept. of Biochemistry and Molecular Biophysics, Columbia University, 650 West 168th Street BB217, New York, NY 10032, USA

... genome/localize/. ProtComp, predict localization for plants, http://www.softberry.com/berry.phtml?topic=proteinloc. Predotar, predict ...


Genome Research
13:2265-2270, 2003

The Secreted Protein Discovery Initiative (SPDI), a Large-Scale Effort to Identify Novel Human Secreted and Transmembrane Proteins: A Bioinformatics Assessment

Hilary F. Clark1, et al.
Departments of Bioinformatics, Molecular Biology and Protein Chemistry, Genentech, Inc., South San Francisco, California 94080, USA

An automated computational strategy was utilized to query each protein translation with the Signal Sensor, Sighmm, Tmdetect (T. Wu, unpubl.), hmmpfam (Eddy 1998 ), and ProtComp (Softberry, Inc.) algorithms. ...The ProtCompalgorithm predicts the subcellular localization of a protein, on the basis of homology to well-annotated proteins, a neural net, and various protein motifs. .. In this case, the ProtCompsubcellular localization prediction was used to categorize these genes as "Other Secreted", "Other Transmembrane", or "Other Cytoplasmic or Nuclear".


Plant Physiol,
February 2002, Vol. 128, pp. 336-340

Gene prediction in eukaryota

Samuel P. Hazen, John S. Scott-Craig, and Jonathan D. Walton*
Department of Energy-Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824

... genome/localize/. ProtComp, predict localization for plants, http://www. softberry.com/berry.phtml?topic=proteinloc. Predotar, predict ...


Proc Natl Acad Sci U S A.
2001 April 24; 98(9): 5341-5346.

The Cia5 gene controls formation of the carbon concentrating mechanism in Chlamydomonas reinhardtii

Youbin Xiang, Jun Zhang, and Donald P. Weeks*
Department of Biochemistry and School of Biological Sciences, University of Nebraska, Lincoln, NE 68588-0664

...Computer-assisted analysis of the CIA5 aa sequence (PROTCOMP, version 4, http://www.softberry.com) predicted a nuclear localization of the protein.
...Finally, computer program predictions (e.g., PROTCOMP version 4, http://www.softberry.com) for a nuclear localization of CIA5 and the clear-cut nuclear localization of CIA5 in onion epidermal cells (Fig. 3) provide additional weight to the argument that CIA5 may be a transcription factor.


strong> Gene
2001 Dec 12;280(1-2):175-81.

A novel serine/threonine kinase gene, STK33, on human chromosome 11p15.3.

Mujica AO, Hankeln T, Schmidt ER.
Institut fur Molekulargenetik, Gentechnologische Sicherheitsforschung und Beratung, Johannes Gutenberg Universitat Mainz, J.J. Becherweg 32, D-55099 Mainz, Germany.

... localization prediction was performed with PSORT II (Nakai and Horton, 1999), SubLoc ( Hua and Sun, 2001) and ProtComp (http://www.softberry.com/protein.html). ...


PSITE

DNA and Cell Biology
2016 doi: 10.1089/dna.2015.3033

Focal Adhesion Kinase Directly Interacts with TSC2 Through its FAT Domain and Regulates Cell Proliferation in Cashmere Goat Fetal Fibroblasts.

Zheng, X. et al.,
1College of Life Sciences, Inner Mongolia University, Hohhot, People's Republic of China. 2Hulunbeier Municipal people's Hospital, Hailaer, People's Republic of China. 3Department of Oncology, Kailuan General Hospital, Tangshan, People's Republic of Chian.

... Protein prosite pattern analysis was identified by the Psite program (www.softberry.com). ...


Fish physiology and biochemistry
2016, 1-14. DOI: 10.1007/s10695-016-0238-y

Characterization, promoter analysis and expression of the interleukin-6 gene in blunt snout bream, Megalobrama amblycephala

Fu, X. et al.,
College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural UniversityFreshwater Aquaculture Collaborative Innovation Center of Hubei Province

... Posttranslational modifications were analyzed using SoftBerry-Psite (http://?linux1.?softberry. ?com/?berry.?phtml??topic=?psite&?group=?programs&?subgroup=?proloc) and Motif-Scan (http://?myhits.?isb-sib.?ch/?cgi-bin/?motif_?scan). ...


Asian-Australasian Journal of Animal Sciences (AJAS)
2013; 26(8): 1057-1064. DOI:10.5713/ajas.2012.12710

Molecular Characterization and Expression Analysis of S6K1 in Cashmere Goats (Capra hircus)

Manlin et al.,
College of Life Science, Inner Mongolia University, Hohhot, 010021, China

.... Protein domains were analyzed using the SMART program (http://smart.embl-heidelberg. de/). Protein prosite patterns were identified using Psite (http://www.softberry.com). ... All sites were determined using Psite (http://www.softberry.com). Figure 2. ...


Asian-Australasian Journal of Animal Sciences (AJAS)
2013; 26(11): 1644-1650. DOI: http://dx.doi.org/10.5713/ajas.2013.13157

Molecular Characterization and Expression Analysis of Ribosomal Protein S6 Gene in the Cashmere Goat (Capra hircus)

Wenlei et al.,
College of Life Science, Inner Mongolia University, Hohhot 010021, China

... isoelectric.ovh.org/. Protein domain analysis was identified by the SMART program (http://smart.embl-heidelberg.de/). Protein prosite patterns analysis were identified by the Psite program (http://www.softberry.com). The model of ...


Asian-Aust. J. Anim. Sci.
Vol. 25, No. 5 : 606 - 612 May 2012 http://dx.doi.org/10.5713/ajas.2011.11290

Molecular Characterization and Expression Pattern of Gene IGFBP-5 in the Cashmere Goat (Capra hircus)

X. J. Wang 1, a et al.,
1 College of Life Science, Inner Mongolia University, The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021, China

... Protein prosite patterns were identified by the Psite program (http://www.softberry.com). A phylogenetic tree was constructed by using the MEGA 4.1 program. RESULTS ... All these were determined using the Psite program (http://www.softberry.com). ...


Asian-Aust. J. Anim. Sci.
June 2012 Vol. 25, No. 6 : 758 - 763 http://dx.doi.org/10.5713/ajas.2011.11398

Molecular Characterization and Tissue-specific Expression of a Novel FKBP38 Gene in the Cashmere Goat (Capra hircus)

X. Zheng et al.,
1 College of Life Science, Inner Mongolia University, The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021, China

... Protein prosite patterns analysis was identified by the Psite program (http://www.softberry.com). The bands on gel were analyzed by Carestream MI software Page 3. Zheng et al. (2012) Asian-Aust. ... All these were determined using the Psite software (http://www.softberry.com). ...


DNA Cell Biol.
2012 May;31(5):839-44. Epub 2011 Dec 16.

Molecular characterization and functional analysis of Cashmere goat mammalian target of rapamycin

Liang Y et al.,
College of Life Science, Inner Mongolia University , The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot, People's Republic of China

... Based on the amino-acid sequence of mTOR, the active sites and domains were predicted using Psite (www.softberry.com) and InterProScan (www.ebi.ac.uk), respectively. ... All sites were determined using Psite (www.softberry.com). ...


Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1452–1458 DOI: 10.1016/S1671-2927(11)60138-7

Molecular Characterization and Expression Pattern of Rheb Gene in Inner Mongolia Cashmere Goat (Capra hircus)

Xu ZHENG et al.,
College of Life Science, Inner Mongolia University/Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021, P.R. China

... embl-heidelberg.de/) and NCBI CDD program (http:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi). Pro- tein prosite patterns analysis were identified by the Psite program (http://www.softberry. com). ... softberry.com). 1456 ZHENG Xu et al. 2011, CAAS. All rights reserved. ...


Plant Pathology
57(1):92-102, February 2008.

A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.

Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...


CTL epitope-Finder

Advanced Materials Research
2013, 647, 304-309 DOI: 10.4028/www.scientific.net/AMR.647.304

Bioinformatics Analysis of OmpA/MotB Protein Encoded by OmpA/MotB Gene(ORF 648bp) of Riemerella anatipestifer

Xu Pan et al.,

... Predicting AntigenicPeptides[17] (http://www.cbs.dtu.dk/services/BepiPred/), ProtScal[18] (http://www.expasy.org/cgi-bin/protscale.pl), CTL epitope-Finder 1.1 (http://linux1.softberry.com/berry.phtml), PSORTb (http://www.psort.org/psortb/), ...


FPROM

Fish physiology and biochemistry
2016, 1-20. DOI 10.1007/s10695-016-0199-1

Identification and characterization of kiss2 and kissr2 homologs in Paralichthys olivaceus

Song, H. et al.,
1. Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, 266003, People’s Republic of China

... The transcription start sites (TSSs) were predicted using Softberry (http://?linux1.?softberry.? com/?berry.?phtml??topic=?fprom&?group=?programs&?subgroup=?promoter), and transcription factor binding sites were analyzed with the help of TFSEARCH (http://?www.?cbrc ...


General and comparative endocrinology
2015, 214, 114-125. doi:10.1016/j.ygcen.2014.06.010

Characterisation of kisspeptin system genes in an ovoviviparous teleost: Sebastes schlegeli

Song, H. et al.,
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, PR China

... The tool of Promoter Scan (http://www-bimas.cit.nih.gov/molbio/proscan/), Softberry (http://linux1.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), and NNPP (http://www.fruitfly.org/seq_tools/promoter.html) were used to predict the transcription .


Scientific Reports
2015, 5, Article number: 14093 doi:10.1038/srep14093

Living without DAT: Loss and compensation of the dopamine transporter gene in sauropsids (birds and reptiles)

P. V. Lovell, B. Kasimi, J. Carleton, T. A. Velho & C. V. Mello
Department of Behavioral Neuroscience; Oregon Health & Science University; Portland, OR 97239-3098; USA Department of Biology; Portland State University; Portland, OR 97207-0751; USA

... In some cases we were able to refine, or computationally validate the location of the TSS by scanning each promoter region with algorithms available through Softberry (http://linux1.softberry. om/berry.phtml) that predict TSSs based on the position of TATA or non-TATA promoter sequences (FPROM41), or the location of CpG-rich islands (CpGFinder). ...


International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573

The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53

Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China

... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools: NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp. duke.edu/generegulation/McPromoterMMII/), and Softberry programs FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...


Scientia Horticulturae
Volume 154, 2 May 2013, Pages 96–101 DOI: 10.1016/j.scienta.2013.02.009

The intron from the 5?-UTR of the FBP11 gene in petunia displays promoter- and enhancer-like functions

Liao Liao 1, Guogui Ning 1, Caixian Liu, Wei Zhang, Manzhu Bao
Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, PR China

... 2.2. Sequence analysis. To predict the components of the FBP11 gene promoter and the first intron in the 5?-UTR, the sequence was analyzed using SoftBerry FPROM programs, available on the Softberry website (http://www.softberry.com) (Jens et al., 2008). ...


PloS one
September 12, 2013 DOI: 10.1371/journal.pone.0073920

Ets-2 Regulates Cell Apoptosis via the Akt Pathway, through the Regulation of Urothelial Cancer Associated 1, a Long Non-Coding RNA, in Bladder Cancer Cells

Wenjing Wu, Shuwan Zhang, Xu Li, Mei Xue, Sancheng Cao, Wei Chen
Clinical Laboratory, the First Affiliated Hospital, School of Medicine, Xi’an Jiaotong University, Xi’an, China School of Medicine, Xi’an Jiaotong University, Xi’an, China, Clinical Laboratory, Xi’an Children’s Hospital, Xi’an, China

... The promoter and TSS predict tools include the FPROM program from Softberry software (http://linux1.softberry.com/berry.phtml??topic=fprom&group=programs&subgroup=prom?oter) and PromoterInspector program from genomatix (http://www.genomatix.de/online_help/help ...


Breast Cancer Research and Treatment
Volume 137, Issue 2 , pp 383-396 DOI:10.1007/s10549-012-2353-5

Vimentin DNA methylation predicts survival in breast cancer

Ulirsch et al.,
4. The University of North Carolina at Chapel Hill School of Nursing, Lab 013, Carrington Hall, CB #7460, Chapel Hill, NC, 27599-7460, USA 2. Lineberger Comprehensive Cancer Center, University of North Carolina, 450 West Drive, Chapel Hill, 27599, USA

... We first custom designed the primers for an amplicon that included the core Vimentin promoter (Fig. 1), as predicted by http://linux1.softberry.com/berry.phtml?topic=fprom& group=programs&subgroup=promoter and http://www.cbs. ...


Hum. Mol. Genet.
(2013) doi: 10.1093/hmg/ddt116

Meta-Analysis of Genome-wide Association Studies in 5 cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error

Stambolian et al.,
1Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, USA 2Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health and National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, USA

... Promoter/enhancer prediction tools used included FPROM from Softberry (http://linux1.softberry. com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), FirstEF from Cold Spring Harbor Laboratory (http://rulai.cshl.org/tools/FirstEF/), Promoter 2.0 ...


Matrix Biology
Volume 31, Issues 7–8, September–October 2012, Pages 412–420 DOI: 10.1016/j.matbio.2012.08.002

Quantification of type II procollagen splice forms using alternative transcript-qPCR (AT-qPCR)

McAlinden et al.,
a Department of Orthopaedic Surgery, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States b Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States

... Analysis of the Col2a1 gene for alternative promoter sequences with FPROM (http://linux1.softberry. com/berry.phtml) revealed 12 potential alternative promoter sites, including a TATA box (TATAAAGA) within exon 2, which could also contribute to transcript diversity. ...


BMC Evolutionary Biology
2012, 12:125 http://www.biomedcentral.com/1471-2148/12/125

Molecular evolution of a-kinase anchoring protein (AKAP)-7: implications in comparative PKA compartmentalization

Keven R Johnson 1 , Jessie Nicodemus-Johnson 2, Graeme K Carnegie 3 and Robert S Danziger1,4,5
1 Department of Medicine, University of Illinois at Chicago, Chicago, IL, USA 4 Jesse Brown VA Medical Center, Chicago, IL, USA

... To determine AKAP7 splice variant exon positions and gene structures, the AKAP7 genes of human, rat, dog, opossum, zebrafish, lamprey, and ciona were analyzed using GENESCAN [58] and Promoter 2.0 Prediction Server [59] FPROM (Softberry, Inc., Mt Kisco, NY) programs ...


Stem Cells Trans Med March
2012 vol. 1 no. 3 188-199 doi: 10.5966/sctm.2011-0005

Human Muller Glia with Stem Cell Characteristics Differentiate into Retinal Ganglion Cell (RGC) Precursors In Vitro and Partially Restore RGC Function In Vivo Following Transplantation

Shweta Singhal et al.,
Divisions of aOcular Biology and Therapeutics and bVisual Neurosciences, NIHR BRC University College London Institute of Ophthalmology and Moorfields Eye Hospital, London, United Kingdom

.. species in this region were used to ascribe a 1.6-kb sequence upstream of the coding region as a putative promoter region for the gene (supplemental online Table 1). This sequence was then analyzed using the FPROM Human promoter prediction software (Softberry, Inc., Mt. ...


Gene Expression Patterns
Volume 11, Issues 1–2, January–February 2011, Pages 118–121 DOI: 10.1016/j.gep.2010.10.002,

Transgenic labeling of the zebrafish pronephric duct and tubules using a promoter from the enpep gene

Christoph Seiler a, Michael Pack a, b,
a Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA b Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA

... We used the softberry FPROM program (http://softberry.com) to identify possible transcription start sites. ... For promotor prediction we used softberry fprom (http://www.softberry.com/berry. phtml?topic = fprom&group = programs&subgroup = promoter). ...


Gene
Volume 492, Issue 1, 15 January 2012, Pages 148–159 DOI: 10.1016/j.gene.2011.10.034

Identification and functional characterization of the human EXT1 promoter region

Jennes et al.,
a Department of Medical Genetics, University of Antwerp, Belgium b Department of Medical Genetics and Skeletal Rare Diseases, Rizzoli Orthopedic Institute, Bologna, Italy

... In silico analysis of the 10 kb upstream region of the EXT1 start codon (region [-10,000_- 1]) (transcript NM_000127.2) was performed with several promoter prediction programs using different algorithms: BDGP (http://www.fruitfly.org/), FPROM (http://softberry.com/), Promoter ...


Archives of Virology
Volume 156, Issue 6 , pp 1097-1100 DOI: 10.1007/s00705-011-0971-6

Discovery of a genome of a distant relative of chicken anemia virus reveals a new member of the genus Gyrovirus

Rijsewijk et al.,
1. Virology Laboratory, Microbiology Department, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul (UFRGS), Av. Sarmento Leite 500, Porto Alegre, Rio Grande do Sul (RS), CEP 90050-170, Brazil 2. Institute for Veterinary Research “Desiderio Finamor” (IPVDF), Estrada do Conde 6000, Eldorado do Sul, Rio Grande do Sul (RS), CEP 92990-000, Brazil

... Cold Spring Harbour Laboratory Press, New York 18. Schat KA (2009) Chicken anemia virus. Curr Top Microbiol Immunol 331:151–183 19. SoftBerry FPROM program. http://www.softberry. ru/berry.phtml? group=programs&subgroup=promoter&topic=fprom 20. ...


Archiv Tierzucht
54 (2011) 4, 430-438, ISSN 0003-9438

Polymorphic sites in the 5?-region of the porcine C8A gene

D? Vo Anh Khoa 1,2, Siriluck Ponsuksili 1 , Eduard Murani 1 and Klaus Wimmers 1
1 Research Unit »Molecular Biology« Leibniz Institute for Farm Animals Biology (FBN), Dummerstorf, Germany, 2 Department of Animal Sciences, College of Agriculture and Applied Biology, Cantho University, Cantho City, Vietnam

... In silico analysis software The Neural Network Promoter Prediction http://www.fruitfly.org/ seq_ tools/promoter.html and the FPROM software http://www.softberry.com were used to identify the transcription start site (TSS) and TATA-box, respectively. ...


BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51

Identification of a novel temperature sensitive promoter in cho cells

Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria 2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria

... Computational analysis of this region was performed using several freely available online prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/ berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...


Journal of Virology
December 2009, p. 12769-12778, Vol. 83, No. 24

The 5' Leader of the mRNA Encoding the Marek's Disease Virus Serotype 1 pp14 Protein Contains an Intronic Internal Ribosome Entry Site with Allosteric Properties

Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, United Kingdom,1 Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037

... Promoter prediction and validation. We used different web-based programs for promoter predictions. These included the FPROM program (Softberry, Inc., Mt. Kisco, NY) and the Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...


J. Virol.
2009 doi:10.1128/JVI.01010-09

The 5' Leader of the mRNA encoding the MDV-1 pp14 protein contains an intronic IRES with allosteric properties

Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, UK; Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037, USA

... Promoter prediction and validation. We have used different web-based programs for promoter predictions. 20 These included the FPROM program (http://www.softberry.ru/berry) and the Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...


Molecular Biotechnology
Volume 39, Number 2 / June 2008 pp. 135-139

Identification of CHO Endogenous Promoter Elements Based on a Genomic Library Approach

Jens Pontiller, Stefan Gross, Haruthai Thaisuchat, Friedemann Hesse and Wolfgang Ernst
... http://www. softberry.co m/berry.pht ml?topic=fprom&group =programs &subgroup =promoter http://www .softberry. ... http://www .softberry. ...


Entomological Research
2008 Volume 38 Issue 1, Pages 77 - 86 On page(s): 50-53

Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella

Wael GAD, Jae Young CHOI, Yeon Ho JE and Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea 2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea

... Promoter components were predicted using SoftBerry fprom (http://softberry.com/berry. phtml?topic=fpromgroup=helpsubgroup=promoter). Southern hybridization. ...


Bioinformatics and Biomedical Engineering, 2008. ICBBE 2008. The 2nd International Conference
Publication Date: 16-18 May 2008 On page(s): 50-53

Sequence Analysis in Vicinity of Type 2 Diabetes Related SNP rs7903146

Jiao Chuan-zhen et al.,
... C. Promoter predication and transcription binding sites identification The FPROM program for Human promoter prediction on http://www.softberry.com server was ...


BMC Genomics
2007, 8:374doi:10.1186/1471-2164-8-374

MetaProm: a neural network based meta-predictor for alternative human promoter prediction

Junwen Wang, Lyle H Ungar, Hung Tseng and Sridhar Hannenhalli
Center for Bioinformatics, University of Pennsylvania, Philadelphia, PA 19104, USA
Department of Genetics, University of Pennsylvania, Philadelphia, PA 19104, USA

... In this paper, we evaluate the performances of current major promoter prediction programs (i.e., PSPA, FirstEF, McPromoter, DragonGSF, DragonPF, and FProm) using 42,536 distinct human gene promoters on a genome-wide scale, and with emphasis on alternative promoters. ... FProm: Human Promoter Prediction. [http://www.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter.] ...


Genome Biology
2006, 7(Suppl 1):S10

Automatic annotation of eukaryotic genes, pseudogenes and promoters

Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA

... The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. ...


Genome Biology
2006, 7(Suppl 1):S3

Performance assessment of promoter predictions on ENCODE regions in the EGASP experimen

Bajic et al.,
South African National Bioinformatics Institute (SANBI), University of the Western Cape, Bellville 7535, South Africa

... threshold of +0.005. The program can be found at [45]. Fprom: Softberry Pol-II promoter recognition approach. The task of finding ...


CpGFinder

Molecular Ecology
(2016) 25, 1801–1811 doi: 10.1111/mec.13519

Evidence from pyrosequencing indicates that natural variation in animal personality is associated with DRD4 DNA methylation

Verhulst, E. C. et al.,
*Department of Animal Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands, †Department of Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands

... A CGI motif was searched in the DRD4 genomic region (GenBank accession DQ006802) using CpGFinder (Softberry, USA) with the base pair numbering set to 1 on the transcription start site. ... 2016). This indirectly supports the interpretation that ...


Gene
2014, 544(2), 165-176. DOI: 10.1016/j.gene.2014.04.062

Identification and characterization of a Sox2 homolog in the Japanese flounder Paralichthys olivaceus

Gao J. et al.,
a College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, China b College of Marine Life Science, Ocean University of China, Laboratory of Biochemistry and Biomaterials, 5 Yushan Road, Qingdao 266003, China

... The presence of a CpG-rich region within the upstream region was analyzed using the Softberry CpGFinder program (http://linux1.softberry.com/berry.phtml?topic= cpgfinder&group=programs&subgroup=promoter). 2.5. Bisulfite sequencing. ...


Cellular and molecular neurobiology
2014, 34(5), 715-725. DOI:10.1007/s10571-014-0053-x

Identification, Cloning, and Functional Analysis of the TATA-Less Mouse FNDC5 Promoter During Neural Differentiation

Seifi T. et al.,
1. Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran 5. Department of Biology, Payame Noor University, P.O. Box 19395-4697, Tehran, Iran 2. Department of Cellular Biotechnology at Cell Science Research Center, ACECR, Royan Institute for Biotechnology, 816513-1378, Isfahan, Iran

... www.genomatix.de) (Sobocki et al. 2007). CG content was predicted and calculated by CpG Island finder (http://linux1.softberry.com), CpG plot (http://www. ebi.ac.uk/Tools/emboss/cpgplot). Approximately, 2 9 104 bp upstream ...


Biochemical and Biophysical Research Communications
Volume 438, Issue 1, 16 August 2013, Pages 54–60 DOI:10.1016/j.bbrc.2013.07.023

Differential DNA methylation patterns in the CD86 gene controls its constitutive expression in keratinocytes

M.A. Romero-Tlalolini, P. Chavez Olmos, Efrain Garrido
Department of Genetics and Molecular Biology, CINVESTAV-IPN, Mexico City, Mexico

... human CD86 genomic region (GenBank ID: 942) including the coding sequence, the promoter and the upstream intergenic region was analyzed in silico using three different software programs: Methyl Primer Express Software v1.0 (Applied Biosystems), Softberry CpG Finder ...


Gene
Volume 529, Issue 2, 25 October 2013, Pages 238–244 DOI:10.1016/j.gene.2013.07.102

Core promoter analysis of porcine Six1 gene and its regulation of the promoter activity by CpG methylation

Wu et al.,
a Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China b Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science, Huazhong Agricultural University, Wuhan, Hubei 430070, China

... sites. While, possible CpG islands were predicted using the program CpG finder on Softberry (http://www.softberry.com/berry.phtml) and MethPrimer (http://www. urogene.org/methprimer/index1.html). 2.3. Plasmids. To produce ...


Fish Physiology and Biochemistry
Volume 39, Issue 5 , pp 1153-1163 DOI:10.1007/s10695-013-9771-0

Identification of HIF-1a promoter and expression regulation of HIF-1a gene by LPS and hypoxia in zebrafish

Shasha Liu, Kecheng Zhu, Nan Chen, Weimin Wang, Huanling Wang
1. Key Lab of Freshwater Animal Breeding, Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Fishery, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... 72 °C for 8 min. The PCR product was cloned into pGEM-T Easy vector (Promega, Germany) and sequenced. The CpG island was predicted by CpG finder (http://linux1.softberry.com/berry.phtml). To identify putative cis-acting ...


Molecular Biology Reports
June 2012, Volume 39, Issue 6, pp 6449-6465 doi: 10.3389/fmicb.2012.00185

Molecular analysis of a sunflower gene encoding an homologous of the B subunit of a CAAT binding factor

Salvini et al.,
1. Scuola Normale Superiore, Piazza dei Cavalieri 7, 56126, Pisa, Italy 2. Dipartimento di Biologia delle Piante Agrarie, Sezione di Genetica, Universita di Pisa, Via Matteotti 1B, 56124, Pisa, Italy

... The sequence of the intergenic DNA fragment spanning from the start codon of the HaL1L coding region back to the stop codon of the upstream gene was examined with ''CpG- finder'' software available at the site http://www.softberry. com to look for CpG isles. ...


PLoS ONE
7(3): e32154. doi:10.1371/journal.pone.0032154

Isolation of a 97-kb Minimal Essential MHC B Locus from a New Reverse-4D BAC Library of the Golden Pheasant.

Ye Q, He K, Wu S-Y, Wan Q-H
The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education and State Conservation Center for Gene Resources of Endangered Wildlife, College of Life Sciences, Zhejiang University, Hangzhou, China

... CpG islands were elicited with Softberry CpGfinder (http://linux1.softberry.com/all.html),...


Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002

Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes

M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico

... Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc.). ... Search for genomic islands was made using CpG finger program from Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...


Asian-Aust. J. Anim. Sci.
Vol. 24, No. 4 : 463 - 470 April 2011

Single Nucleotide Polymorphisms of the GnRHR Gene Associated with Reproductive Traits of Japanese Flounder (Paralichthys olivaceus)

He et al.,
Fisheries College, Ocean University of China, Qingdao 266003, China

... 2001). In this study, the consensus GnRHR sequence was analyzed for the presence of a CpG Island using Soft berry CpG Finder (http://www.softberry.com/berry.phtml? topic=cpgfinder&gr oup=programs&subgroup=promoter). It ...


Molecular Biology Reports
Volume 38, Issue 4 , pp 2619-2632 DOI: 10.1007/s11033-010-0403-9

Molecular characterization, expression patterns and polymorphism analysis of porcine Six1 gene

W.Wu et al.,
1. Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture and Key Lab of Agriculture Animal Genetics, Breeding and Reproduction, Ministry of Education, Beijing, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... Proscan software, version 1.7 was used to predict the putative promoter and transcription factor binding sites (http:// www-bimas.cit.nih.gov/molbio/proscan/). Possible CpG islands were searched with the program CpG finder on Softberry (http://www.softberry.com/berry.phtml). ...


FEMS Microbiology Ecology
Volume 71, Issue 1, pages 23–33, January 2010

Phylogenetic and metagenomic analysis of Verrucomicrobia in former agricultural grassland soil

Kielak et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands 2 Arlington Department of Biology, University of Texas, Arlington, TX, USA

... Searches for GC islands were performed using CPGFINDER (SoftBerry, http://linux1.softberry. com). For identification of potential HGT regions, the method described by Tamames & Moya (2008) was applied to examine tetranu- cleotide frequencies. ... 


Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10

Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6

Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2

...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC islands were performed using CpGFinder (http://linux1.softberry.com). ... .


BMC Cancer
2008, 8:253 doi:10.1186/1471-2407-8-253

Promoter methylation inhibits BRD 7 expression in human nasopharyngeal carcinoma cells

H Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Changsha, Hunan, 410078, PR China

... CpGplot and Softberry CpGFinder, respectively. ... http://www.ebi.ac.uk/emboss/cpgplot) program CpGplot and Softberry CpGFinder program Page 6. 5 ...


Molecular and Cellular Neuroscience
Volume 37, Issue 3, March 2008, Pages 537-547

Identification and characterization of the promoter region of the Nav1.7 voltage-gated sodium channel gene (SCN9A)

Diss et al.,
aMedical Molecular Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK bMolecular Haematology and Cancer Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK

... This is not within a CpG island (EMBOSS CpG Plot, http://www.ebi.ac.uk/emboss/cpgplot/; Softberry-CpGFinder, http://www.softberry.com/berry.phtml topic ...


Gene
Volume 384, 15 December 2006, Pages 62-72

Isolation and molecular characterization of the porcine transforming growth factor beta type I receptor (TGFBR1) gene

Kefei Chen, Laurie A. Rund, Jonathan E. Beever and Lawrence B. Schooka
Department of Animal Sciences, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
Institute for Genomic Biology, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... com). Possible CpG islands were searched with the program CpGfinder on Softberry (http://www.softberry.com/berry.phtml). Protein ...


Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology
Volume 141, Issue 4, August 2005, Pages 406-411

Analysis of CpG methylation in the killifish CYP1A promoter

Alicia R. Timme-Laragy a, Joel N. Meyer a, Robert A. Waterland b and Richard T. Di Giulio
aNicholas School of the Environment and Earth Sciences/Integrated Toxicology Program, Box 90328, Duke University, Durham, NC, USA bDepartments of Pediatrics and Molecular and Human Genetics, Baylor College of Medicine, USDA Children's Nutrition Research Center, Houston, TX, USA

... The consensus CYP1A promoter sequence was analyzed for the presence of a CpG Island using Softberry CpGFinder (http://www.softberry.com/berry.phtml?topic ...


Gene
Volume 340, Issue 1, 29 September 2004, Pages 19-30

Isolation and molecular characterization of the porcine stearoyl-CoA desaturase gene

Jun Ren a, b, Christoph Knorr a, Lusheng Huang b and Bertram Brenig
a Institute of Veterinary Medicine, Georg-August-University of Go"ttingen, Groner Landstrasse 2, Go"ttingen 37073, Germany b Jiangxi Provincial Key Laboratory for Animal Biotechnology, Jiangxi Agricultural University, Nanchang 330045, PR China

... com). Possible CpG islands were searched with the program CpGfinder on Softberry (http://www.softberry.com/berry.phtml). Repetitive ...


NSITE

Biosci. Rep.
(2016) / 36 / art:e00293 / doi 10.1042/BSR20150290

Interrupted E2F1-miR-34c-SCF negative feedback loop by hyper-methylation promotes colorectal cancer cell proliferation

Yang S. et al.,
*Department of Histology and Embryology, School of Basic Medical Sciences, Capital Medical University, Beijing 100069, P.R. China †Beijing Key Laboratory of Cancer Invasion and Metastasis Research, Beijing 100069, P.R. China

... Prediction of transcription factors for miR-34c was conducted using TFSearch (http:// www.cbrc.jp/research/db/TFSEARCH.html), NSite (http:// linux1.softberry.com/) and Alggen (http://alggen.lsi.upc. edu/). CpG island was predicted by EMBOSS Cpgplot (http://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/). ...


Journal of cellular physiology
2016 DOI: 10.1002/jcp.25391

Atp2c2 Is Transcribed From a Unique Transcriptional Start Site in Mouse Pancreatic Acinar Cells

Fenech, M. A. et al.,
1 Children''s Health Research Institute, London, Ontario, Canada 2 Department of Pediatrics, University of Western Ontario, London, Ontario, Canada

... In all cases, n = 3. Download figure to PowerPoint. The region upstream of the Atp2c2c TSS was examined for putative transcription factor binding motifs using the Alibaba-Gene Regulation Data Base and Nsite—softberry (http://www.softberry.com). ...


Journal of Thoracic Oncology
2016 DOI: http://dx.doi.org/10.1016/j.jtho.2016.05.010

ITPKA gene body methylation regulates gene expression and serves as an early diagnostic marker in lung and other cancers

Wang, Y. W. et al.,
Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX, USA The Center for Systems Biology, Department of Molecular and Cell Biology, The University of Texas at Dallas, Richardson, TX, USA

... binding motifs present in both ITPKA promoter and CpG island-2 regions. Using the Softberry NSITE Program (http://www.softberry.com), we identified putative binding motifs for SP1 in the promoter (nts -89 to -140) as well as CpG island-2 (motif 1 nts ...


Bioinformatics
2015, btv404. doi: 10.1093/bioinformatics/btv404

Nsite, NsiteH and NsiteM computer tools for studying transcription regulatory elements

Shahmuradov, I. A., & Solovyev, V. V.
1Computer, Electrical and Mathematical Sciences and Engineering Division, KAUST, Thuwal 23955-6900, KSA, 2Bioinformatics laboratory, Institute of Botany, ANAS, Baku AZ1073, Azerbaijan and 3Bioinformatics Division, Softberry Inc., Mount Kisco, NY 10549, USA

... Availability and implementation: Pre-compiled executables built under commonly used operating systems are available for download by visiting http://www.molquest.kaust.edu. sa and http://www.softberry.com. Contact: solovictor{at}gmail.com. ...


Brain Pathology
2015 DOI: 10.1111/bpa.12294

Role of microRNAs Located on Chromosome Arm 10q in Malignant Gliomas

Wolter, M., Werner, T., Malzkorn, B., Reifenberger, G.
1 Department of Neuropathology, Heinrich Heine University, Dusseldorf, Germany 2 German Cancer Consortium (DKTK), Partner Site Essen/Dusseldorf, German Cancer Research Center (DKFZ), Heidelberg, Germany

... In the 5'genomic region of miR-146b-5p, we investigated methylation patterns in and around three putative SP1 transcription factor-binding sites predicted by the NSITE program (Version 2.2004, Softberry Inc., http://linux1.softberry.com/cgi-bin/programs/promoter/nsite.pl). ...


Physiology and Molecular Biology of Plants
2015, Volume 21, Issue 4 , pp 465-478 DOI: 10.1007/s12298-015-0325-z

Identification and expression analyses of MYB and WRKY transcription factor genes in Papaver somniferum L

Tayebeh Kakeshpour, Shadi Nayebi, Sajad Rashidi Monfared , Ahmad Moieni, Ghasem Karimzadeh
1. Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran

... 1999) and Soft Berry (NSITE) (Solovyev et al. ... As a result of TFBSs identification obtained using the TRANSFAC, PLACE and SoftBerry databases, multiple unique TFBSs of many known TFs in the promoter regions of these 10 co-expressed genes were found (Table 4). WRKY ...


Am J Respir Crit Care Med
2014 , 189, A2026. DOI:

Redox Regulation Of Ap-1 At Three Response Elements Is Required For Transforming Growth Factor-b Gene Expression

Ryan, A. J., Carter, A. B., & Khan, M. T.

... Four potential AP-1 recognition sites in the 3' region of the TGF-? promoter were identified with the Softberry NSITE: M1 (-407 -> -405), M2 (-369 -> -367), M3 (+160 -> +162), M4 (+256 -> +258) with respect to transcription start site. ...


Virus genes
2014, 1-9. DOI: 10.1007/s11262-014-1081-9

Molecular characteristics of the complete genome of a J-subgroup avian leukosis virus strain isolated from Eurasian teal in China

Zeng X et al.,
1. College of Wildlife Resources, Northeast Forestry University, Harbin, 150040, China 2. Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute Chinese Academy of Agricultural Sciences, No. 427 Maduan St., Harbin, 150001, China

... Transcriptional regulatory elements in the U3 were analyzed with NSITE (Recognition of Regulatory motifs) which is an online service of Soft Berry (http://?linux1.?softberry.?com/?berry.? phtml). The sequences obtained in this study have been submitted to GenBank. ...


Small Ruminant Research.
Volume 120, Issue 1, July 2014, Pages 20–26 DOI: 10.1016/j.smallrumres.2014.03.014

Genetic diversity of GH1 and LEP genes in Argentine llama ( Lama glama) populations

Daverio, M. S., Lorenzo, Y., Rigalt, F., Vidal-Rioja, L., Di Rocco, F.
a Laboratorio de Genetica Molecular, Instituto Multidisciplinario de Biologia Celular (IMBICE), CCT-CONICET-La Plata, CICPBA, Calle 526 e/10 y 11, PO Box 403, La Plata 1900, Buenos Aires, Argentina b INTA-Estacion Experimental Agropecuaria Catamarca, Ruta Provincial N° 33km 4 (4705), Sumalao, Valle Viejo, Catamarca, Argentina

... impact of amino acid substitutions on protein function was performed by using SIFT software (http://sift.jcvi.org/) whereas the analysis of putative Transcription Factor Binding Sites (TFBS) within the GH1 promoter gene was done with the NSITE program at Softberry site (http ...


Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
2014, 169, 16-24. DOI: 10.1016/j.cbpb.2013.12.002

Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, Oncorhynchus mykiss

Mennigen J. A. et al.,
INRA, UR 1067, Nutrition, Metabolisme, Aquaculture, Aquapole, F-64310 Saint-Pee-sur-Nivelle, France

... Target sequences including a 2000 bp upstream sequence were retrieved and transcription factor binding sites predicted using the NSITE software package Version 2.2004 (www.http://linux1.softberry.com/berry.phtml, Softberry Inc.). ...


PloS one
November 11, 2013DOI: 10.1371/journal.pone.0079307

Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds

Yang et al.,
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China, Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs(http://www.softberry.ru/berry. phtml?topi?c=nsite&group=programs&subgroup=promoter). ...


Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI:10.1007/s11010-012-1522-5

Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene

Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml? topic=nsite and group = programs and subgroup = promoter), and Promoter Scan (http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...


Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019

Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress

Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium

... software. The cis-acting elements were determined with the use of TSSP, NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol- tools.ca/Promoters.htm). Measurements of ethylene production. The ...


PloS one
December 31, 2013DOI: 10.1371/journal.pone.0083392

UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

Kraemer et al.,
Institute of Radiation Biology, Helmholtz Center Munich, Neuherberg, Germany Department Molecular Cell Biology, Center of Dermatology, Elbekliniken Stade/Buxtehude, Buxtehude, Germany

... Primers used are given in Table S2. Prediction of potential regulatory elements using the NSITE program. Potential regulatory elements in the promoter region (1500 bp) of the miRNAs commonly regulated by UVA and UVB were identified using the NSITE program (Softberry,. ...


The Plant Cell
September 2013 vol. 25 no. 9 3389-3404 DOI:10.?1105/?tpc.?113.?114736

Arabidopsis KINETOCHORE NULL2 Is an Upstream Component for Centromeric Histone H3 Variant cenH3 Deposition at Centromeres[

Lermontova et al.,
aLeibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany bInterdisciplinary Center for Crop Plant Research, Martin Luther University Halle-Wittenberg, D\x{2013}06120 Halle (Saale), Germany

... To see whether KNL2 is similarly regulated, the KNL2 promoter region was studied in silico using the NSITE program (available through www.softberry.com/berry.phtml?topic=promoter). A potential E2F binding site (CCCGCCAAA) was found at ?148 bp upstream of ATG. ...


PloS pathogenes
August 29, 2013DOI: 10.1371/journal.ppat.1003571

Schistosoma mansoni Mucin Gene (SmPoMuc) Expression: Epigenetic Control to Shape Adaptation to a New Host

Perrin et al.,
Universite de Perpignan Via Domitia, Perpignan, France, CNRS, UMR 5244, Ecologie et Evolution des Interactions (2EI), Perpignan, France Center for Infection and Immunity of Lille, Inserm U1019, CNRS UMR 8204, Institut Pasteur de Lille, University Lille Nord de France, Lille, France

...We scanned the promoter sequences for putative regulator binding sites using the web based interface Program NSITE (Softberry Inc.) (http://linux1.softberry.com/berry.phtml??topic=nsite&group=programs&subgroup=prom?oter).þþþ


Scientific Reports
3, Article number: 2178 doi:10.1038/srep02178

Hox genes are involved in vascular wall-resident multipotent stem cell differentiation into smooth muscle cells

Diana Klein, Mohamed Benchellal, Veronika Kleff, Heinz Gunther Jakob & Suleyman Ergun
Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany Institute of Anatomy, University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany

...Chromosome 11: 117,070,037-117,075,503 forward strand) was analyzed for promoter prediction sites using the Promotor 2.0 prediction server (www.cbs.dtu.dk/services/Promoter/) and SoftBerry NSITE (http://linux1.softberry.com)...


Forest Pathology
6 NOV 2012 DOI: 10.1111/efp.12011 Early View (Online Version of Record published before inclusion in an issue)

Characterization and expression of daf-9 and daf-12 genes in the pinewood nematode, Bursaphelenchus xylophilus

D.-D. Wang 1,2, X.-Y. Cheng 3,*, Y.-S. Wang 2, H.-Y. Pan 1, B.-Y. Xie 2
1 College of Plant Science, Jilin university, Changchun, China 2 Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing, China

... nested PCR. The PCR products were purified, cloned and sequenced. The sequences were analysed using NSITE (http://linux1.softberry.com/berry.phtml?topic=nsite&group= programs&subgroup=promoter). 2.5 Gene expression ...


JCB
March 19, 2012 vol. 196 no. 6 689-698 DOI: 10.1083/jcb.201201077

MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response

Andrew E. Byrd, Ileana V. Aragon, and Joseph W. Brewer
Department of Microbiology and Immunology, College of Medicine, University of South Alabama, Mobile, AL 36688

... Potential transcription factor binding sites upstream of the miR-30c-2* chromosomal location were identified using the NSITE program (Softberry) and the University of California, Santa Cruz Genome browser. Reporter and expression vectors. ...


Molecular Genetics and Metabolism
Volume 106, Issue 3, July 2012, Pages 281–286 DOI: 10.1016/j.ymgme.2012.04.013,

Algorithm for Pompe disease newborn screening: Results from the Taiwan screening program

Shu-Chuan Chiang a, Wuh-Liang Hwu a, b, Ni-Chung Lee a, b, Li-Wen Hsu a, Yin-Hsiu Chien a, b
a Department of Medical Genetics, National Taiwan University Hospital, Taipei, Taiwan b Department of Pediatrics, National Taiwan University Hospital and National Taiwan University School of Medicine, Taipei, Taiwan

... upon request). The promoter regions (? 500 bp) of the GAA and neutral ?-glucosidase C (GANC) genes were analyzed by the NSITE program (available at http://www. softberry.com/berry.phtml). 2.3. Statistical analysis. A single ...


PLoS ONE
7(10): e48097. doi:10.1371/journal.pone.0048097

How Peroxisomes Affect Aflatoxin Biosynthesis in Aspergillus Flavus

Reverberi et al.,
Dipartimento di Biologia Ambientale, Universita Sapienza, Roma, Italy Oklahoma State University, Oklahoma City, Oklahoma, United States of America

... present in the 2.0 Kb 5' Flanking sequence (upstream) of AFLA099000, retrieved from http://fungi.ensembl.org/Aspergillus_fla?vus/Info/Index, was performed with the genomic tools in the aspergillusflavus.org website and through the NSITE tool in the softberry.com website and ...


Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI: 10.1007/s11010-012-1522-5

Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene

Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml? topic=nsite and group = programs and subgroup = promoter), and Promoter Scan (http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...


African Journal of Biotechnology
Vol. 11 (31), pp. 7864-7874, 17 April, 2012 DOI: 10.5897/AJB11.1229

The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome

Handeng Liu 1,2, Guoqing Pan 1*, Tian Li 1, Wei Huang 1 and Zeyang Zhou 1,3,
1Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, P.R. China. 2Experimental Teaching Center, Chongqing Medical University, Chongqing 400016, P.R. China.

... from the initiation site of the predicted transcription start site (TSS, +1). The regions 500 bps upstream from the transcription initiation site were used for analyzing the potential binding sites for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...


Plant Science
Volumes 193–194, September 2012, Pages 39–47 http://dx.doi.org/10.1016/j.plantsci.2012.05.005

The regulation of the SARK promoter activity by hormones and environmental signals

Carla A. Delatorre a, b, 1, Yuval Cohen a, c, 1, Li Liu a, 1, Zvi Peleg a, 2,
a Department of Plant Sciences, University of California, Davis, CA 95616, USA b Department of Crop Science, Agronomy School, Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS, 91501970, Brazil

... To identify cis-regulatory elements in the promoter, cis-element search programs at PLACE (http://www.dna.affrc.go.jp/PLACE/info.html, PlantCARE (http://bioinformatics.psb.ugent.be/ webtools/plantcare/html/), and NSITE (http://linux1.softberry.com/cgi-bin/programs/promoter ...


Sci. Signal.
18 January 2011 Vol. 4, Issue 156, p. ra2 [DOI: 10.1126/scisignal.2001211]

The Kinase SGK1 in the Endoderm and Mesoderm Promotes Ectodermal Survival by Down-Regulating Components of the Death-Inducing Signaling Complex. Sci. Signal. 4, ra2 (2011).

T. Endo, M. Kusakabe, K. Sunadome, T. Yamamoto, E. Nishida

... Cis-regulatory elements in the promoter regions were searched with TRANSFAC (41) and NSITE (http://linux1.softberry.com/berry.phtml). ChIP. ChIP was performed as described (42). Fifty embryos were injected with HA-xRelA mRNA at four-cell stage. ...


Virology Journal
2011, 8:158 http://www.virologyj.com/content/8/1/158

Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3’UTR

Shi et al.,
1 College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, Sichuan, 625014, China

... DNASTAR package. Transcriptional regulatory elements in U3 were analyzed by the online service system of NSITE (Recog- nition of Regulatory motifs) of SoftBerry (http://linux1. softberry.com/berry.phtml). Phylogenetic analysis ...


Virology Journal
2011, 8:552 http://www.virologyj.com/content/8/1/552

Novel sequences of subgroup J avian leukosis viruses associated with hemangioma in Chinese layer hens

Pan et al.,
1 Division of Avian Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, PR China

... Bootstrap values were calculated using 500 or 1000 replicates of the alignment. Transcriptional regulatory elements in the U3 were ana- lyzed by NSITE (Recognition of Regulatory motifs), an online service of Soft Berry (http://linux1.softberry.com/ berry.phtml). ...


Genetics and Molecular Research
10 (3): 1777-1786 (2011) DOI: 10.4238/vol10-3gmr1466.

Molecular cloning, characterization and association analysis of the promoter region of the bovine CDK6 gene

Liu YF, Zan LS, Cui WT, Xin YP, Jiao Y, Li K.
College of Animal Science and Technology, Northwest Agriculture and Forestry University, Yangling Shaanxi, PR China.

... were analyzed using Cat- tle dbSNP (http://www.ncbi.nlm.nih.gov/snp/limits), Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), Promoter Scan (http://www.bimas. cit.nih.gov/ molbio/proscan), and the NSITE program (Softberry, http://linux1 ...


Mol Cancer Res
April 2011 9; 497 doi: 10.1158/1541-7786.MCR-10-0556

Expression Regulation of the Metastasis-Promoting Protein InsP3-Kinase-A in Tumor Cells

Chang et al.,
1Institut fur Biochemie und Molekularbiologie I: Zellulare Signaltransduktion; 2Institut fur Tumorbiologie, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany

... transcription factors was investigated. Therefore, transcription factor binding sites in ITPKA-1250 were analyzed by a Softberry NSITE motif search (core similarity 0.8, significance level 0.95) motif search. Potential binding sites ...


Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126–3137 DOI: 10.1016/j.biortech.2010.10.079

Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes

Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


Journal of Hazardous Materials
Volume 192, Issue 2, 30 August 2011, Pages 855–873 DOI: 10.1016/j.jhazmat.2011.05.106,

Decolorization of different dyes by a newly isolated white-rot fungi strain Ganoderma sp.En3 and cloning and functional analysis of its laccase gene

Rui Zhuo et al.,
a Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


Cellular and Molecular Life Sciences
Volume 68, Issue 24 , pp 4115-4132 DOI: 10.1007/s00018-011-0785-4

Functional diversity of melanopsins and their global expression in the teleost retina

Davies et al.,
1. Nuffield Laboratory of Ophthalmology, Nuffield Department of Clinical Neurosciences, Levels 5-6 West Wing, John Radcliffe Hospital, University of Oxford, Headley Way, Oxford, OX3 9DU, UK 2. Department of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, 21 University Street, London, WC1E 6DE, UK

... gene were performed by using the MatrixTM Version 1.0 database (with a cut- off filter to minimize false positives) (http://www.gene- regulation.com/cgi-bin/pub/programs/match/bin/match.cgi) and NSITE: Animal TFD from Ghosh database (http:// linux1.softberry.com/berry.phtml ...


Applied Microbiology and Biotechnology
2011, Volume 91, Issue 4 , pp 1107-1119 DOI: 10.1007/s00253-011-3355-7

PdCYP51B, a new putative sterol 14?-demethylase gene of Penicillium digitatum involved in resistance to imazalil and other fungicides inhibiting ergosterol synthesis

Xuepeng Sun, Jiye Wang, Dan Feng, Zhonghua Ma, Hongye Li
1. Institute of Biotechnology, Zhejiang University, Hangzhou, Zhejiang, 310029, China 2. Key Laboratory of Molecular Biology for Crop Pathogens and Insect Pests of Ministry of Agriculture, Zhejiang University, Hangzhou, Zhejiang, 310029, China

... The NSITE program (www.softberry.com) and the eukaryotic promoter predictor (Berkeley Drosophila Genome Project, http://www.fruitfly.org/seq_tools/promoter.html) were used to analyze the sequence of PdCYP51B gene. The protein ... softberry.com). ...


Scandinavian Journal of Rheumatology
May 2010, Vol. 39, No. 3 , Pages 254-258 (doi:10.3109/03009740903347983)

Association of TBX21 gene haplotypes in a Chinese population with systemic lupus erythematosus

You et al.,
1Department of Dermatology 2Department of Paediatrics 3Department of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing, P. R. China

... (A) Computer analysis of sequences covering -1993 bp, by using NSITE (http://linux1.softberry. com/berry.phtml?topic = nsite&group =programs&subgroup = promoter), indicated that the -1993T>C SNP is located on a putative binding site for the Sp1 transcription factor. ... 


Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126-3137, doi:10.1016/j.biortech.2010.10.079

Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes

Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


The Journal of Physiological Sciences
Volume 59, Number 2 / March, 2009, pp. 81-86

Association of Ala589Ser polymorphism of WNK4 gene with essential hypertension in a high-risk Chinese population

Sun et al.,
(1) Department of Medical Genetics, China Medical University, Shenyang, 110001, China (2) Department of Cardiology, Shengjing Hospital, China Medical University, Shenyang, 110004, China

... 2). Using software including TRANSFAC 4.0 (avail- able at http://transfac.gbf.de/TRANSFAC/), TSSG/TSSH (available at http://www.cbs.dtu.dk/services/Promoter/) and NSITE (available at http://www.softberry.com/berry.phtml), a number of cis-acting elements, eg, AP1, SP1, GRE ...


Gene
Volume 435, Issues 1-2, 15 April 2009, Pages 63-71

Characterization of porcine MMP-2 and its association with immune traits

Honggang Huang et al.,
aKey Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, PR China

... The 5?-?anking DNA sequences were analyzed using the Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), the NSITE program (http://linux1.softberry.com/berry. phtml?topic=nsite and group=programs and subgroup=promoter), and the ...


Meat Science
Volume 82, Issue 2, June 2009, Pages 278-283

Identification of the new polymorphisms in the promoter region of the CAST gene in cattle

E. Juszczuk-Kubiak a, E, K. Flisikowski b, K. Wicin'ska a, J. Po?oszynowicza and S. Rosochacki a, c
aInstitute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrze;biec, 05-552 Wo'lka Kosowska, Poland bLehrstuhl fuer Tierzucht Technische Universitat in Muenchen, 85354 Hochfeldweg 1, Freising, Germany

... Sequences with 100% identity to TF-binding sites were searched in the NSITE program (Softberry, Inc., USA, http://www.softberry.com) and TESS software (Schug J & Overton, Ch.G.; http://www.cbil.upenn.edu/tess). 3. Results and discussion. ...


Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90

Characterization of the murine Dfna5 promoter and regulatory regions

Karen Vrijens a, Guy Van Camp a and Lut Van Laer a
aDepartment of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium

... Transcription factor (TF) binding sites were scored using three programs, MatInspector (www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www-bimas.cit.nih.gov/ molbio/proscan/). 2.2. 5?- and 3?-rapid amplification of cDNA ends (RACE). ...


BMC Molecular Biology
2008, 9:104 doi:10.1186/1471-2199-9-104

The artiodactyl APOBEC3 innate immune repertoire shows evidence for a multi-functional domain organization that existed in the ancestor of placental mammals

LaRue et al.,
Department of Biochemistry, Molecular Biology and Biophysics, Institute for Molecular Virology,BeckmanCenter for Genome Engineering,University of Minnesota,Minneapolis, Minnesota 55455,USA

... were identified and compared using the TransFac and Biobase databases through the softberry NSITE portal (www.softberry.com). The ...


Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90

Characterization of the murine Dfna5 promoter and regulatory regions

Karen Vrijens, Guy Van Camp and Lut Van Laer
Department of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium

... Transcription factor (TF) binding sites were scored using three programs, MatInspector (www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www ...


Eukaryotic Cell
June 2008, p. 988-1000, Vol. 7, No. 6 doi:10.1128/EC.00228-07

Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA Gene{triangledown}

Reverberi, M et al.,
... This analysis was performed using the NSITE tool in the Softberry software package, which allowed us to reveal all of the putative regulatory elements present ...


International Journal of Plant Sciences
169(6):701–707. 2008.

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

Sabina Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana, Slovenia

... Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ... Signal Scan program and the REGSITE database with the NSITE program, several ...


DNA and Cell Biology
June 1, 2008, 27(6): 307-314. doi:10.1089/dna.2007.0692

Identification and Characterization of the Human Testes-Specific Protease 50 Gene Promoter

M. Wang et al.,
Institute of Genetics and Cytology, Northeast Normal University, ChangChun, China.

.. MatInspector(Carthariusetal.,2005) (http:==www.genomatix.de=cgi-bin=matinspector_prof), and NSITE (Solovyev and Shahmuradov, 2006) (http:==www .softberry.com). ..


Plant Pathology
57(1):92-102, February 2008.

A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.

Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW" ... 1999–2005, www.softberry.com); ...


J Appl Genet
48(4), 2007, pp. 371–374

Polymorphisms in intron 1 of the porcine POU1F1 gene

Cheng-Yi Song et al.,
College of Animal Science & Technology, Yangzhou University, Jiangsu, China; Division of Biological Sciences, University of Missouri-Columbia, Columbia, MO, USA

... the potential functional importance of the 313-bp indel, the insertion sequences were analysed in silico and by the use of NSITE pro- gram (Softberry, Inc, USA ...


Molecular Microbiology
(2007), 66 (2), 534–551

Transcriptional control of nmrA by the bZIP transcription factor MeaB reveals a new level of nitrogen regulation in Aspergillus nidulans

Koon Ho Wong, Michael J. Hynes, Richard B. Todd, Meryl A. Davis
Department of Genetics, The University of Melbourne, Melbourne, Vic. 3010, Australia

... Analysis using the NSITE algorithm (http://www.softberry.com) matched both element A and B sequences independently to the binding site of the mammalian bZIP ...


Epilepsy Research
Volume 75, Issue 2-3, Pages 145-153

Linkage and mutational analysis of CLCN2 in childhood absence epilepsy

K Everett et al.,

... using the prediction program ESEfinder version 2.0 (Cartegni et al., 2003) and the TransFac and Biobase GmbH databases via NSITE (http://www.softberry.com). ...


RNA
(2007), 13:1988-1999

Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing

Moti Alberstein et al.,
Department of Human Molecular Genetics and Biochemistry, Sackler Faculty of Medicine, Tel-Aviv University, Tel Aviv 69978, Israel

... programs: TRANSPLORER (http://www.developmentontheedge.com/transplorer.shtml); Genomatix (http://www.genomatix.de/); NSITE (http://www.softberry.com/berry.phtml ...


European Journal of Human Genetics
15, 463 - 472 (01 Apr 2007)

Linkage and association analysis of CACNG3 in childhood absence epilepsy

KV Everett et al.,

... identified variants was assessed by searching for predicted regulatory motifs contained within the TransFac and Biobase databases via the Softberry NSITE portal ...


Insect Science
Volume 14 Issue 1 Page 5-14, February 2007

Analysis of the structure and expression of the 30K protein genes in silkworm, Bombyx mori

QUAN SUN et al.,
The Key Laboratory of Sericulture of Agriculture Ministry, College of Sericulture and Biotechnology, Southwest University, Chongqing, China

... initiation site were used for analyzing the potential binding sites for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...


Mammalian Genome
Volume 17, Number 8 / August, 2006 pp. 892-901

Identification of genetic variation and putative regulatory regions in bovine CARD15
Kristen H. Taylor, Jeremy F. Taylor, Stephen N. White and James E. Womack
Department of Veterinary Pathobiology, Texas A&M University, College Station, Texas, 77843-4467, USA

... These motifs were analyzed using NSITE (available through SoftBerry, http://www. softberry.com/berry.phtml?topic=pro- moter) to determine homology to previously ...


Human Genetics
Volume 117, Number 1 / June 2005 pp. 16-26

Functional promoter polymorphism in the TBX21 gene associated with aspirin-induced asthma
Mitsuteru Akahoshi et al.,
Laboratory for Genetics of Allergic Diseases, SNP Research Center, RIKEN Yokohama Institute, Institute of Physical and Chemical Research (RIKEN), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama Kanagawa, 230-0045, Japan

... shown). Computer analysis of sequences covering A1993 bp, by using NSITE, available at http://www.softberry.com/berry.phtml? topic ...


NSITE-PL

Plant Gene
2016, 5, 78-86. doi:10.1016/j.plgene.2016.01.001

Molecular cloning and transcriptional analysis of WRKY and solavetivone biosynthetic genes in the hairy roots of Hyoscyamus albus

Kawauchi, M., Arima, T. H., Kuroyanagi, M.
Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan

.. PLACE (http://www.dna.affrc.go.jp/PLACE/index.html) and NSITE-PL (http://www.softberry.com/berry.phtml?topic=nsitep&group=programs&subgroup ...


Plant Physiology
September 2013 vol. 163 no. 1 431-440 DOI:10.?1104/?pp.?113.?221713

Histone Deacetylase AtHDA7 Is Required for Female Gametophyte and Embryo Development in Arabidopsis

Cigliano et al.,
National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, 80055 Portici, Italy (R.A.C., G.C., R.P., P.T., G.P., M.F.C., C.C.); and Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, 1030 Vienna, Austria (R.G.)

... An area 1,000 bp upstream of the predicted start codon of HDA7 was analyzed with NSITE-PL (http://linux1.softberry.com) and Akiyama's TFSEARCHv1.3 (http://molsun1.cbrc.aist.go.jp/research/ db/TFSEARCH.html) with default setting to detect putative regulatory motifs. ...


Plant Growth Regulation
Volume 71, Issue 1 , pp 77-92 DOI:10.1007/s10725-013-9814-7

A novel GRAS protein gene MtSymSCL1 plays a role in regulating nodule number in Medicago truncatula

Goon-Bo Kim, Young-Woo Nam
Sta1. Department of Life Science, Sogang University, Seoul, 121-742, Koreate

... 2008 ). The 5? upstream flanking region of MtSymSCL1 was analyzed by using the PLACE database (Higo et al. 1999 ) or the RegSite database of plant regulatory elements (NSITE-PL program, http://www.softberry.com). Construction of reporter fusion and RNAi plasmids. ...


Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019

Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress

Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium

... software. The cis-acting elements were determined with the use of TSSP, NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol- tools.ca/Promoters.htm). Measurements of ethylene production. The ...


Plant, Cell & Environment
2013, 36: 1171–1191. doi: 10.1111/pce.12051

Two closely linked tomato HKT coding genes are positional candidates for the major tomato QTL involved in Na+/K+ homeostasis

ASINS et al.,
1Plant Protection and Biotechnology Center, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain 2Department of Biochemistry, Molecular and Cellular Biology of Plants, Estacion Experimental del Zaidin, Consejo Superior de Investigaciones Cientificas (CSIC), Granada, Spain 3Center for Plant Biotechnology and Genomics (UPM-INIA), Universidad Politecnica de Madrid, Madrid, Spain

... 1999) and PlantCARE (Lescot et al. 2002) and NSITE-PL (http://linux1.softberry.com) databases and tools. The presence of CpG islands was checked by the CpG Islands Searcher web tool using the program's default settings (Takai & Jones 2002). ...


Plant Molecular Biology
Volume 82, Issue 1-2 , pp 51-58 DOI:10.1007/s11103-013-0034-3

Sugarcane Loading Stem Gene promoters drive transgene expression preferentially in the stem

Richard L. Moyle, Robert G. Birch
1. Hines Plant Science Building, The University of Queensland, Brisbane, 4072, Australia

... ScLSG promoters, by searching PLACE (Higo et al. 1999), PlantCARE (Lescot et al. 2002), Athena (O'Connor et al. 2005) and NSITE-PL (www.softberry.com/berry. phtml) databases. ScLSG5 Apex IN3 IN4 IN5 IN6 IN7 IN8 IN9 ...


Journal of Integrative Plant Biology
Volume 54, Issue 6, pages 400–411, June 2012 DOI: 10.1111/j.1744-7909.2012.01126.x

Characterization of Two Putative Protein Phosphatase Genes and Their Involvement in Phosphorus Efficiency in Phaseolus vulgaris

Cui-Yue Liang 1,2, Zhi-Jian Chen 1, Zhu-Fang Yao 1, Jiang Tian 1,*, Hong Liao 1
1 State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Root Biology Center, South China Agricultural University, Guangzhou 510642, China 2 Robert Holley Center for Agriculture and Health, United States Department of Agriculture, Agricultural Research Service, Cornell University, Ithaca, New York 14853, USA

... genomewalker DNA library derived from G19833 genomic DNA. Putative motifs regulated by environmental stresses were identified by using the software NSITE-PL (www.softberry.com) and PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan) in silico. Among them, two 8-bp ...


Plant Cell Reports
Volume 31, Issue 2 , pp 271-279 DOI 10.1007/s00299-011-1161-4

Native polyubiquitin promoter of rice provides increased constitutive expression in stable transgenic rice plants

Jagannath Bhattacharyya et al.,
1. Advanced Laboratory for Plant Genetic Engineering, Indian Institute of Technology, Kharagpur, 721302, India

... 2002; http://www.bioinformatics.psls.ugent.be/webtools/ PlantCARE/html/); Athena (O'Connor et al. 2005; http://www.bioinformatics2.wsu.edu/Athena); NSITE-PL (Soft berry, http://www.softberry.com/berry.phtml). Results Generation of transgenic rice lines ..


African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040

Isolation and characterization of a candidate gene for resistance to cereal cyst nematode from Aegilops variabilis in China

D. L. Xu et al.,
1 Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China. 2 Graduate University of the Chinese Academy of Sciences, Beijing, China.

... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...


The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x

A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.

Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China

... accession number FJ461673). In silico analysis of the promoter sequence was performed using the software programs tssp-tcm (Shahmuradov et al., 2005), nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...


Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24

Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar

Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.

... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb. ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry, http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ... 


Plant Cell Rep.
2009 May;28(5):851-60. Epub 2009 Mar 21.

43-bp A/T-rich element upstream of the kinesin gene AtKP1 promoter functions as a silencer in Arabidopsis

Lai C, Xiong J, Li X, Qin X.
College of Biological Sciences, China Agricultural University, Beijing, China

... 1999) and NSITE-PL (www.softberry.com) to ascertain whether the 180-bp sequence has sequence similarity to other regulatory elements. We found that multiple previously reported cis- elements were present in this region (Fig. ...


BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271

The evolution of Brassica napus FLOWERING LOCUST paralogues in the context of inverted chromosomal duplication blocks

Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted Research, Harpenden, Herts, AL5 2JQ, UK

... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ... "Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...


Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394

Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar

Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China

... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...


Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065

Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)

Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece

... elements was performed using the database available at: http://softberry.com. TSSs were determined using the TSSP program available at the site. NSITE-PL was ...


Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


Plant Physiology
144:1786-1796 (2007)

Exclusion of Na+ via Sodium ATPase (PpENA1) Ensures Normal Growth of Physcomitrella patens under Moderate Salt Stress

Christina Lunde, Damian P. Drew, Andrew K. Jacobs and Mark Tester
Plant Biochemistry Laboratory, Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark (C.L.,); and Australian Centre for Plant Functional Genomics, University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia (D.P.D., A.K.J., M.T.)

... obtained from the eight templates were aligned using Contig Express (Vector NTI 8). The promoter sequence was analyzed using NSITE-PL (www.softberry.com) and ...


Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 2, February 2007, Pages 139-148

Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis

Nitima Suttipantaa, Sitakanta Pattanaika, Samir Gunjanc, Claire H. Xiea,John Littletonb, and Ling Yuana
Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546, USA

... 1). Sequence analysis using PLACE (www.dna.affrc.go.jp/PLACE) [14] and the NSITE-PL program (www.softberry.com) reveals that the G10H promoter contains several ...


In Silico Biology
Volume 7, Number 1 / 2007 pp. 7-19

In silico analysis of the Lateral Organ Junction (loj) gene and promoter of Arabidopsis thaliana

Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India

...The software programs used were AtcisDB (http://arabidopsis.med.ohio-state.edu/AtcisDB/index.jsp) [Davuluri et al., 2003] PLACE (http://www.dna.affrc.go.jp/PLACE/) [Higo et al., 1999], PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [Lescot et al., 2002], and NSITE-PL (Softberry; http://www.softberry.com/berry.phtml). Similarly NSITE-PL of Softberry Inc. and PLACE database identified a large number of cis-elements, except few the majority of which may not be relevant for the function of this promoter. ...


Plant Molecular Biology
(2006) 60, 2, 259-275

Gene Structure and Expression Pattern Analysis of Three Monodehydroascorbate Reductase (Mdhar) Genes in Physcomitrella patens: Implications for the Evolution of the MDHAR Family in Plants*

Christina Lunde , Ute Baumann, Neil J. Shirley, Damian P. Drew and Geoffrey B. Fincher
Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, Waite Campus, Glen Osmond, 5064, SA, Australia

... The promoter sequence was analysed using NSITE-PL (www.softberry.com), PLACE ...


The Plant Cell
Volume18 Number 10 October 2006 2443-2451

Loading of Arabidopsis Centromeric Histone CENH3 Occurs Mainly during G2 and Requires the Presence of the Histone Fold Domain

Inna Lermontova et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany

... Computer analysis of the presumed promoter region of A. thaliana CENH3, using the NSITE program (available through SoftBerry, http://www.softberry.com/berry ...


NSITEM

Genes and Immunity
07 Aug 2008, doi: 10.1038/gene.2008.63,

Expression levels of FAS are regulated through an evolutionary conserved element in intron 2, which modulates cystic fibrosis disease severity

V Kumar et al.,
# 1Department of Pediatric Pneumology and Neonatology, Hannover Medical School, Hannover, Germany # 2Institute for Medical Biometry, Informatics and Epidemiology, University of Bonn, Bonn, Germany

... Webthermodyn. 17 The program NSITEM at www.softberry.com was used to search for conserved functional motifs within the CNS. Possible ...


BMC Genetics
2008, 9:50 doi:10.1186/1471-2156-9-50

Bovine CD14 gene characterization and relationship between polymorphisms and surface expression on monocytes and polymorphonuclear neutrophils

Eveline M Ibeagha-Awemu1 Jai-Wei Lee, Aloysius E Ibeagha1 and Xin Zhao
1Department of Animal Science, McGill University, Ste-Anne-de-Bellevue, Quebec H9X 3V9, Canada and 2Department of Tropical Agriculture and International Cooperation, National Pingtung University of Science and Technology, Neipu, Pingtung 912, Taiwan

... of the CD14 genes of different species (cattle, human, mouse, rat and pig) through a query in the NSITEM data base http:/ / linux1.softberry.com/ berry.phtml


Journal of Investigative Dermatology
2006 126, 325–335. doi:10.1038/sj.jid.5700065

Transcriptional Regulation and Characterization of the Promoter Region of the Human ABCC6 Gene

Qiujie Jiang1, Yasushi Matsuzaki1, Kehua Li and Jouni Uitto
# Department of Dermatology and Cutaneous Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania, USA # 2Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania, USA

... putative cis-acting elements using transcription factor databases (TFSEARCH, Kyoto University, version 1.3) and ConSite (nsiteM, Softberry, Inc., version 2.2004 ...


Plant Molecular Biology
Volume 58, Number 2 / May 2005 pp. 193-212

Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana

Rachel Clifton et al.,
Plant Molecular Biology Group, School of Biomedical and Chemical Sciences,, The University of Western Australia, 35 Stirling Highway, 6009 Crawley, Western Australia, Australia

... jsp). Pre- viously described motifs were identified using Softberry nsiteM (Shahmuradov et al., 2003), PlantCARE (Lescot et al., 2002), PLACE (Higo et al., 1999 ...


PATTERN

PloS one
2014, 9(1), e84692. DOI: 10.1371/journal.pone.0084692

Isolation and Characterization of Three Cassava Elongation Factor 1 Alpha (MeEF1A) Promoters

Suhandono, S., Apriyanto, A., Ihsani, N.
School of Life Sciences and Technology, Institut Teknologi Bandung, Bandung, Jawa Barat, Indonesia

... www.cbs.dtu.dk/services/NetGene2/) [51]. Conserved cis-acting regulatory was carried out using the PATTERN search from Softberry website (http://www.softberry. com/berry.phtml). PLACE [52] and PlantCARE [53] software ...


Nature and Science,
4(3), 2006

An In Silico Investigation into the Discovery of Novel Cis-acting Elements within the Intronic Regions of Human PAX7

Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center), New York City, New York 10021, USA

The names and functions of the programs used are: ...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) - This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) - TSSG is the most accurate mammalian cis element prediction program.


POLYAH

Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6

DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic

Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland 2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA

... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry), 3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...


Gene
Volume 529, Issue 2, 25 October 2013, Pages 228–237 DOI:10.1016/j.gene.2013.07.103

Splicing variants of the porcine betaine–homocysteine S-methyltransferase gene: Implications for mammalian metabolism

Radhika Ganu a, Timothy Garrow b, Markos Koutmos c, Laurie Rund d, Lawrence B. Schook a, d,
a Division of Nutritional Sciences, University of Illinois, Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois, Urbana, IL 61801, USA

... The mRNA secondary structures and free energy values were predicted using the MFOLD software program (version 3.2; http://www.bioinfo.rpi.edu/applications/mfold)(Zuker, 2003). PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect poly A signal sites. ...


Journal of Investigative Dermatology
(6 December 2012) | doi:10.1038/jid.2012.458

A Genome-Wide Association Study in Caucasian Women Points Out a Putative Role of the STXBP5L Gene in Facial Photoaging

Clerc et al.,

... exploration we tried to look for modifications in mRNA expression levels (Yang et al., 2010; Nica et al., 2011; Dixon et al., 2007; Zeller et al., 2010), splicing (NetGene2, http://www.cbs.dtu.dk/ services/NetGene2/), polyadenylation regions (polyAH, http://linux1.softberry.com/berry ...


PLoS ONE
7(5): e36151. doi:10.1371/journal.pone.0036151

3D Profile-Based Approach to Proteome-Wide Discovery of Novel Human Chemokines

Tomczak et al.,
Structural Bioinformatics, BIOTEC TU Dresden, Germany Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany

... Exon organization, chromosomal location and proximity to known chemokine genes, presence of a PolyA site (using Ensembl, Polyah.pl (softberry) and Polyadq ...


Biologia Plantarum
December 2012, Volume 56, Issue 4, pp 641-647 DOI 10.1007/s10535-012-0255-3

Identification and characterization of a novel gene encoding myb-box binding zinc finger protein in Gossypium arboreum

M. Zahur et al.,
1. Department of Biochemistry and Molecular Biology, University of Gujrat, Gujrat, 50700, Pakistan

... 1990). To find out the untranslated regions (UTRs), and Poly-A tail softberry server was used (http://www.softberry.com/berry.phtml). The conceptual translation of nucleotide sequence was made using the open reading frame finder program (ORF; ...


Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015

Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes

Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/ proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...


Gene
Volume 483, Issues 1–2, 1 September 2011, Pages 49–53 DOI: 10.1016/j.gene.2011.05.014

Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid

Pardeep Kumar Bhardwaj a, b, 1, Jagdeep Kaur b, Ranbir Chander Sobti b, Paramvir Singh Ahuja a, Sanjay Kumar a
a Biotechnology Division, Institute of Himalayan Bioresource Technology, Council of Scientific and Industrial Research, P.O. Box 6, Palampur-176061, Himachal Pradesh, India b Department of Biotechnology, Panjab University, Chandigarh-160014, India

... Secondary structure of deduced amino acids sequences was predicted by SOPMA (Self Optimized Prediction Method with Alignment; http://npsa-pbil.ibcp.fr/). The polyadenylation signal was identified using POLYAH server (http://linux1.softberry.com/berry.phtml). ...


J Acquir Immune Defic Syndr.
2011 March; 56(3): 279–284. DOI: 10.1097/QAI.0b013e318204982b

SCREENING LOW FREQUENCY SNPS FROM GENOME WIDE ASSOCIATION STUDY REVEALS A NEW RISK ALLELE FOR PROGRESSION TO AIDS

Le Clerc et al.,
1 Chaire de Bioinformatique, Conservatoire National des Arts et Metiers, Paris, France 2 Universite Paris 12, INSERM U955, Creteil, France

... we tried to identify putative modifications in mRNA expression as shown in Genevar 26 and Dixon 27 databases, in splicing (FastSNP 28 , http://fastsnp.ibms.sinica.edu.tw/pages/ input_CandidateGeneSearch.jsp/), in polyadenylation (polyAH, http://linux1.softberry.com/berry ...


African Journal of Biotechnology
Vol. 8 (24), pp. 7116-7124, 15 December, 2009

Cloning and characterization of peptidylprolyl isomerase B in the silkworm, Bombyx mori

Hengchuan Xia et al.,
1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China

... Corporation. Bioinformatic analysis The DNAstar software was used to locate the open reading frame (ORF) for B. mori PPIB. Poly-A signal was predicted by POLYAH (http://www.softberry.com/cgi-bin/programs/promoter/polyah.pl). In ...


Genetics
Vol. 176, 2541-2549, August 2007

The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus

Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China and Key Biotechnology Laboratory of State Ethnic Affairs Commission, College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China

... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH, respectively (http://www.softberry.com/berry.html). ...


PROMH

PLoS ONE
5(9): e12599. doi:10.1371/journal.pone.0012599

The CC-NB-LRR-Type Rdg2a Resistance Gene Confers Immunity to the Seed-Borne Barley Leaf Stripe Pathogen in the Absence of Hypersensitive Cell Death

Bulgarelli et al.,
1 Genomic Research Center, CRA-GPG, Fiorenzuola d'Arda, Italy, 2 Department of Plant Microbe Interactions, Max Planck Institute fur Zuchtungsforschung, Koln, Germany

... The PromH program for the prediction of plant promoters (http://www.softberry.ru/berry.phtml? group=programs&subgroup=promoter&topic=tssp , [47]) identified potential transcription factor binding sites, a TATA box, and a likely promoter within the MITE sequence (data not ...


Nucleic Acids Research,
2003, Vol. 31, No. 13 3540-3545

PromH: promoters identification using orthologous genomic sequences

V. V. Solovyev* and I. A. Shahmuradov1
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com
Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Received February 15, 2003; Revised and Accepted March 21, 2003


PlantProm

Plant Biotechnology Reports
2016, 10(4), 241-255. doi:10.1007/s11816-016-0400-0

Functional analysis of a cryptic promoter from Arabidopsis thaliana reveals bidirectionality

Parvathy, S. T., Srinivasan, R.
ICAR-National Research Centre on Plant BiotechnologyIndian Agricultural Research Institute ICAR-Indian Institute of Oilseeds Research

... 2000; http://www.genomatix.de/), Gene2 Promoter (http://www.genomatix.de/), McPromoter (Ohler et al. 2001; http://tools.genome.duke.edu/generegulation/McPromoter/) and PlantProm DB of SoftBerry Inc. (Shahmuradov et al. 2002; http://www.softberry.com/). ...


Journal of Biotechnology
174 (2014) 49–56 DOI: 10.1016/j.jbiotec.2014.01.027

Strong seed-specific protein expression from the Vigna radiata storage protein 8SG promoter in transgenic Arabidopsis seeds

Chen M. X. et al.,
aCollege of Life Science and Technology, Jinan University, Guangzhou 510632, ChinabSchool of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, Chinaa

... HQ214071, Chen et al., 2013) and the 661-bp 5 -flanking sequence of 8SG? (GenBank accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.com) was uti- lized to predict the transcription start site (TSS) and the TATA box. ...


Journal of biotechnology
2014, 174, 49-56. DOI: 10.1016/j.jbiotec.2014.01.027

Strong seed-specific protein expression from the Vigna radiata storage protein 8SG? promoter in transgenic Arabidopsis seeds.

Chen M. X. et al.,
a College of Life Science and Technology, Jinan University, Guangzhou 510632, China b School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China

... HQ214071, Chen et al., 2013) and the 661-bp 5?-flanking sequence of 8SG? (GenBank accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry. com) was utilized to predict the transcription start site (TSS) and the TATA box. ...


Functional & integrative genomics
2014, 14(1), 111-125. DOI: 10.1007/s10142-013-0354-z

The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance

Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China 2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China

... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1. softberry.com/berry.phtml). Promoter motifs were analyzed ...


Plant Molecular Biology Reporter
2014, 32(3), 664-678. DOI: 10.1007/s11105-013-0681-1

Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses

Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China 2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China

... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD) (http://linux1.softberry.com/ berry.phtml). The promoter ...


Plant Molecular Biology Reporter
2014, 32(1), 198-208. DOI: 10.1007/s11105-013-0641-9

Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa

Rodriguez-Valentin R. et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico 2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico

... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/ berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...


Journal of Molecular Biology Research
Vol 3, No 1 (2013) DOI:10.5539/jmbr.v3n1p23

Characterization of Structure, Divergence and Regulation Patterns of Plant Promoters

Liu et al.,

... less often than transcribed gene sequences. A total of 3922 plant promoters in the Plant Promoter Database (PlantProm DB; http://linux1.softberry.com/berry.phtml) have been collected to date. Knowledge of the basic structural ...


Functional & Integrative Genomics
December 2013 DOI:10.1007/s10142-013-0354-z

The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance

Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China 2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China

... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1. softberry.com/berry.phtml). Promoter motifs were analyzed ...


Plant Molecular Biology Reporter
November 2013 DOI:10.1007/s11105-013-0681-1

Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses

Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China 2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China

... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD) (http://linux1.softberry.com/ berry.phtml). The promoter ...


Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 198-208 DOI:10.1007/s11105-013-0641-9

Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa

Rodriguez-Valentin, et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico 2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico

... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/ berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...


Australian Journal of Grape and Wine Research
19: 238–248. doi: 10.1111/ajgw.12023

Anthocyanin profile and gene expression in berry skin of two red Vitis vinifera grape cultivars that are sunlight dependent versus sunlight independent.

Zheng et al.,
1Beijing Key Laboratory of Grape Sciences and Enology, CAS Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China 2University of Chinese Academy of Sciences, Beijing, China 3Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China

... figure. There was no difference in the isolated promoter regions of VvMYBAb1 between Jingxiu and Jingyan (Figure 5). Via a homology search of the isolated promoter regions using the PlantProm (Plant Promoters database http://linux1.softberry.com/berry.phtml) and PlantDB ...


J. Exp. Bot.
(2012) 63 (8): 2985-3000. doi: 10.1093/jxb/ers009

The gene encoding Arabidopsis acyl-CoA-binding protein 3 is pathogen inducible and subject to circadian regulation

Shu-Xiao Zheng, Shi Xiao* and Mee-Len Chye†
School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China

... Results using SoftBerry PlantProm DB (http://www.softberry.com) (Shahmuradov et al., 2003) and PlantCare (http://sphinx.rug.ac.be:8080/PlantCARE/) (Rombauts et al., 1999) revealed that the putative transcription start site of ACBP3 maps 93 bp 5? to the translation initiation ...


Algorithms for Molecular Biology
2011, 6:19 http://www.almob.org/content/6/1/19

Prediction of plant promoters based on hexamers and random triplet pair analysis

A K M Azad1 , Saima Shahid2 , Nasimul Noman 3* and Hyunju Lee 1
1 Department of Information and Communications, Gwangju Institute of Science and Technology, South Korea 3 Department of Electrical Engineering & Info Systems, Graduate School of Engineering, University of Tokyo, Japan

... validated TSSs. This dataset was downloaded from the recent release (2009.02) of PlantProm database http://linux1.softberry.com/berry. phtml?topic=plantprom&group= data&subgroup=plant- prom on January 2nd, 2011. Additional ...


Genetics and Molecular Research
9 (4): 2349-2356 (2010)

Molecular and functional analysis of the poly-b- hydroxybutyrate biosynthesis operon of Pseudomonas sp BJ-1

S.W. Zhu, Z.Y. Fang, H.Y. Jiang and B.J. Cheng
School of Life Science, Anhui Agricultural University, Hefei, China

... Predicted operons, promoters, and terminators were identified with the tools at Softberry (http://www.softberry. com/berry.phtml). ... SW Zhu et al. Promoter analysis The promoter prediction used the promoter database and the Softberry Plant Regula- tory motifs database. ...


Plant Physiology and Biochemistry
Volume 48, Issue 12, December 2010, Pages 945-951, doi:10.1016/j.plaphy.2010.09.005

Characterization and expression of the maize b-carbonic anhydrase gene repeat regions

Ursula Tems, James N. Burnell
Department of Biochemistry and Molecular Biology, James Cook University, Townsville, Queensland 4811, Australia

... gov). Nucleotide sequence up to 1,500 bp in the 5 flanking sequence of the CA2 gene was analyzed using a transcription factor database (PlantProm DB at www.softberry.com) in conjunction with MacVectorTM software. 4.3. ...


BMC Plant Biol.
2009 Jul 17;9:93.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.

Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.

... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih. gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...


Journal of Cereal Science
Volume 50, Issue 3, November 2009, Pages 324-331

Isolation and characterisation of a xylanase inhibitor Xip-II gene from durum wheat

Elliott et al.,
aInstitute of Food Research (IFR), Norwich Research Park, Colney, Norwich NR4 7UA, UK bUniversita degli Studi della Tuscia, Dipartimento di Agrobiologia e Agrochimica, via San Camillo de Lallis, 01100 Viterbo, Italy

... Analysis of the 3'UTR by PlantProm DB (Shahmuradov et al., 2003) (http://www.softberry. com) revealed the presence of a single putative polyadenylation sequence (AATAAAA), starting 55 bp downstream of the TGA termination codon (Fig. S1). ...


Nucleic Acids Research
2006 34(19):e126; doi:10.1093/nar/gkl522

Robust analysis of 5'-transcript ends (5'-RATE): a novel technique for transcriptome analysis and genome annotation

Malali Gowda, Haumeng Li, Joe Alessi1, Feng Chen1, Richard Pratt2 and Guo-Liang Wang*
Department of Plant Pathology, The Ohio State University Columbus, OH 43210, USA 1 US DOE Joint Genome Institute, Walnut Creek CA 94598, USA 2 Department of Horticulture and Crop Science, Ohio Agricultural Research and Development Center, The Ohio State University Wooster, OH 44691, USA

... such as the TATA box and other cis-acting elements were predicted using a PlantProm DB program (http://mendel.cs.rhul.ac.uk and http://www.softberry.com) (20). ...


Genetics:
Published Articles Ahead of Print, published on September 19, 2005 as 10.1534/genetics.105.044727

Molecular characterization of the major wheat domestication gene Q

Kristin J. Simons*, John P. Fellers‡, Harold N. Trick*, Zengcui Zhang§, Yin-Shan Tai, Bikram S. Gill*, and Justin D. Faris
*Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, KS 66506

... searches of plant promoter databases PlantCARE (http://intra.psb.ugent.be:8080/ PlantCARE/index.html), PlantProm (http://www.softberry.com), ...


Annals of Botany
2005 96(4):669-681; doi:10.1093/aob/mci219

Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species

BIJAYALAXMI MOHANTY1,*, S. P. T. KRISHNAN1, SANJAY SWARUP2 and VLADIMIR B. BAJIC1
1 Knowledge Extraction Laboratory, Institute for Infocomm Research, 21 Heng Mui Keng Terrace, Singapore 119613 and 2 Department of Biological Sciences, National University of Singapore, Singapore

... Promoter sequences Plant promoter sequences were extracted from SoftBerry's Plant Promoter Database (PPD) (Shahmuradov et al., 2003 Go ), the Eukaryotic ...


Surgery Today
Volume 34, Number 12 / December, 2004 pp. 981-986

Role of Hypermethylation on Carcinogenesis in the Pancreas

Tamotsu Kuroki 1 Yoshitsugu Tajima 1 and Takashi Kanematsu 1
(1) Department of Surgery, Nagasaki University, Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki 852-8501, Japan

... of Bioinformatics and http://www.isrec.isb-sib.ch/ssa Swiss Institute for Experimental Cancer Research, Eukaryotic Promoter Database Softberry, Promoter and ...


Nucleic Acids Research
2003, Vol. 31, No. 1 114-117

PlantProm: a database of plant promoter sequences

Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. ...


RegSite

Plant Molecular Biology Reporter
2014, 32(2), 372-381. DOI: 10.1007/s11105-013-0657-1

Initiation of Flowering in Protea compacta x Protea neriifolia Hybrid ‘Carnival’Coincides with Expression of the FLOWERING LOCUS THomologue

Smart M., Roden L. C.
1. Department of Molecular and Cell Biology, University of Cape Town, Private Bag, Rondebosch, 7701, Cape Town, South Africa 2. Institute for Microbial Biotechnology and Metagenomics, Department of Biotechnology, University of the Western Cape, Bellville, 7535, Cape Town, South Africa

... In silico analyses of the 5? upstream region of ProFT were performed using the RegSite Plant database (SoftBerry, Inc., NY, USA), to predict the transcrip- tion start site (TSS) and promoter position, and the PlantCARE database (Lescot et al. 2002) and PLACEDB (Higo et al. ...


Plant Molecular Biology Reporter
Volume 30, Issue 1 , pp 131-138 DOI 10.1007/s11105-011-0319-0

Isolation and Partial Characterization of an R2R3MYB Transcription Factor from the Bamboo Species Fargesia fungosa

Juan Wang (1) Jing Wang (1) Huaibi Zhang (2) Yuming Yang (1) Kevin M. Davies (2)
1. Southwest Forestry University, Bailongsi 300, Kunming, Yunnan, China 2. New Zealand Institute for Plant & Food Research Limited, Private Bag, 11600, Palmerston North, New Zealand

... PLANTCARE (Lescot et al. 2002, with additional data from El-Shehawi et al. 2011) and RegSite Plant DB (www. softberry.com) databases. The proximal 1 kb region contained several notable sequence motifs (Fig. 2 and Table 1 ...


Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x

Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)

Xia YANG 1, Hong CUI 2, Zu-Li YUAN 2, Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China 2 Henan Agricultural University, Zhengzhou 450002, China

... To predict the promoter regions and the transcription start sites, genomic regions upstream of the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ... 


SCIENCE CHINA Life Sciences
Volume 53, Number 11, 1315-1321, DOI: 10.1007/s11427-010-4079-0

Expression pattern and core region analysis of AtMPK3 promoter in response to environmental stresses

Fei Gao, Qi Su, YunLiu Fan and Lei Wang

... There are several plant-specific promoter databases with information on cis-acting elements, which control the initia- tion of transcription by binding corresponding nuclear fac- tors. These databases include PlantCARE [23], RegSite (http://softberry. ...


Methods Mol Biol.
2010;674:57-83

Identification of promoter regions and regulatory sites

Solovyev VV, Shahmuradov IA, Salamov AA.
Department of Computer Science, Royal Holloway, London, UK.

... Over 7,900 sequences of transcrip- tional elements have been described in TRANSFAC database (21, 22). The other collections of functional motifs are TRRD (23), PlantCARE (24), PLACE (25), RegSite (http://softberry. com ... 


Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821

Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines

Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China

... was based on program of ScanWM-PL and accession numbers of regula- tion factors were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...


Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia

... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...


Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007

Molecular and cytological responses of Medicago truncatula to Erysiphe pisi

DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA

... groups of promoters using (1) > 20 published motifs associated with plant defence, (2) 803 regulatory motifs present in the Softberry RegSite PlantDB database ...


Cell Res.
2006 Aug;16(8):731-9.

Tissue differential expression of lycopene beta-cyclase gene in papaya.

Skelton RL, Yu Q, Srinivasan R, Manshardt R, Moore PH, Ming R.
1Hawaii Agriculture Research Center, Aiea, HI 96701, USA.

... upstream sequence. Two possible sites of the cpLCY-B promoter were predicted using RegSite Plant DB (www.softberry.com). The first ...


ScanWM-PL

PLOS ONE
July 30, 2013DOI: 10.1371/journal.pone.0069124

The LuWD40-1 Gene Encoding WD Repeat Protein Regulates Growth and Pollen Viability in Flax (Linum Usitatissimum L.)

Santosh Kumar, Mark C. Jordan, Raju Datla, Sylvie Cloutier
Department of Plant Science, University of Manitoba, Winnipeg, Manitoba, Canada, Cereal Research Centre, Agriculture and Agri-Food Canada, Winnipeg, Manitoba, Canada

... Promoter analysis was performed with PLAnt Cis-acting regulatory DNA Elements (PLACE) [42], PLANT Promoter Analysis Navigator (PlantPAN) and Weight Matrix patterns of PLant regulatory sequences (ScanWM-PL) available on the Softberry web portal (http://linux1.softberry ...


Journal of Integrative Plant Biology
Volume 54, Issue 1, pages 15–32, January 2012 DOI: 10.1111/j.1744-7909.2011.01084.x

Characterization of the Tomato Prosystemin Promoter: Organ-specific Expression, Hormone Specificity and Methyl Jasmonate Responsiveness by Deletion Analysis in Transgenic Tobacco Plants

Hamlet Aviles-Arnaut, John Paul Delano-Frier
Center of Research and Advanced Studies (Cinvestav) at Irapuato: Unit for Plant Biotechnology and Genetic Engineering, Irapuato, Gto., Mexico, PO Box 36821 Mexico

... (www.dna.affrc.go.jp/PLACE/), PlantCARE (http://bioinformatics.SlPSb.ugent.be/wetools/ plantcare/html/), the RegSite Plant Database (www.softberry.com) and the Genomatix ... compared against known cis-regulatory elements with the ScanWM-P software (www.softberry.com). ...


Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24

Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar

Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.

... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb. ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry, http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ... 


Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394

Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar

Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China

... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...


Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821

Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines

Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China

... was based on program of ScanWM-PL and accession numbers of regula- tion factors were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...


ScanWM-P

Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


TSSP

Organ Cult
(2016) 126: 469. doi:10.1007/s11240-016-1015-4

Characterization of a trichome-specific promoter of the aldehyde dehydrogenase 1 (ALDH1) gene in Artemisia annua

Liu, M. et al.,
Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D CenterShanghai Jiao Tong University Department of Chemistry and Biomedical SciencesLinnaeus University

... The cis-acting elements and ATG start codon are in box. We used the TSSP software (http://?linux1.?softberry.?com/?berry.?phtml??topic=?tssp&?group=?programs&? subgroup=?promoter) to search more information about this promoter. ...


Biotechnology and Applied Biochemistry.
2016 DOI: 10.1002/bab.1520

Molecular cloning and characterization of the promoter of aldehyde dehydrogenase gene from Artemisia annua

Wang, H. et al.,
Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing, China School of Chemistry and Chemical Engineering, Chongqing University of Science and Technology, Chongqing, China

... element of the ALDH1 promoter was analyzed by the TSSP software (http:// http://linux1.softberry. com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) [24], the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and the PLACE ...


Genes & Genomics
2016, 38(4), 377-387. DOI: 10.1007/s13258-015-0378-y

Genomic identification of microRNA promoters and their cis-acting elements in Populus

Chen, M., Wei, M., Dong, Z., Bao, H., Wang, Y.
1. National Engineering Laboratory for Tree Breeding, Beijing Forestry University, Beijing, 100083, People’s Republic of China 2. Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, People’s Republic of China

... Prediction and characterization of TSSs, TATA box- like sequences With the obtained sequences, TSSs and TATA box-like sequences were predicted using the plant promoter identifi- cation program, TSSP (http://linux1.softberry.com/berry. ...


Plant Physiology
2016 Vol. 162, No. 2 (June 2013), pp. 885-896 http://www.jstor.org/stable/41943270

The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear

Wang Z. et al.,

... name proPcMYBlO (JX403962). It contained a core promoter at position -60 bp and an enhancer promoter at position -675 bp (as analyzed by TSSP software on softberry; http:/ /linuxl. softberry.com/berry.phtml). Be- sides the ...


Molecular Genetics and Genomics
2016, Volume 291, Issue 2 , pp 935-941 DOI 10.1007/s00438-015-1159-7

Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes

Ranade, S. S., Garcia-Gil, M. R., Rossello, J. A.
1. Department of Forest Genetics and Plant Physiology, Umea Plant Science Centre, Swedish University of Agricultural Sciences, 901 83, Umea, Sweden 2. Jardi Botanic, Universidad de Valencia, c/Quart 80, 46008, Valencia, Spain

... Upstream regions were also screened for the pres- ence of promoters, TATA boxes and enhancers using the TSSP/Prediction of Plant Promoters (TSSP: Transcription Start Sites in Plants, SoftBerry: http://www.softberry.com, Shahmuradov et al. 2003) web interface. Results ...


Journal of Zhejiang University SCIENCE B
2014, 15(2), 125-132. DOI:10.1631/jzus.B1300179

Analysis of promoters of microRNAs from a Glycine max degradome library

Han, Y. Q. et al.,
1. College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, 163319, China 2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... Promoters were predicted by the plant promoter identification pro- gram TSSP (http://www.softberry.com), which is designed for predicting plant Pol II promoters (Shahmuradov et al., 2005). The predictions were obtained at the default TSSP settings. ...


Biochemical and biophysical research communications
2014, 444(4), 676-681. DOI: 10.1016/j.bbrc.2014.01.171

MicroRNA mediates DNA methylation of target genes

Hu, W., Wang, T., Xu, J., Li, H.
a College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, China b Zhejiang-California International Nanosystems Institute, Zhejiang University, Hangzhou, Zhejiang 310058, China

... 0). 2.2. DNA methylation pattern of MIRs. 1 or 2 kb upstream and downstream sequences of pre-miRNA were retrieved from rice genome. Promoters of MIRs were predicted by TSSP (http://linux1.softberry.com/berry.phtml). Then ...


Euphytica
2014, 196(3), 365-374. DOI: 10.1007/s10681-013-1038-4

Variation in GmAOS1 promoter is associated with soybean defense against insect attack

Wang H. et al.,
1. Soybean Research Institute, Nanjing Agricultural University, National Center for Soybean Improvement, Ministry of Agriculture, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing, 210095, Jiangsu, China

... 1997 ). SoftBerry-TSSP (http://?linux1.?softberry.?com/?berry.?phtml) was used to predict the position of promoter (Shahmuradov et al. 2003 ) and PlantCARE was used to predict the cis-regulating elements for GmAOS1 (Lescot et al. 2002 ). ...


Biologia Plantarum
2014, 58(2), 247-255. DOI: 10.1007/s10535-014-0393-x

Structural and expression analyses of three PmCBFs from Prunus mume

Guo C. et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, 430070, P.R. China

... The promoter region of PmCBFb was identified by the prediction of plant promoters (TSSP) analysis in softberry database (http:// linux1.softberry. com/berry.phtml). The cis-element analysis was performed by signal scan searching in the PLACE ...


Plant Molecular Biology Reporter
2014, 32(1), 82-91. DOI: 10.1007/s11105-013-0603-2

Jiang, W., Lu, X., Qiu, B., Zhang, F., Shen, Q., Lv, Z., ... & Tang, K. (2014). Molecular cloning and characterization of a trichome-specific promoter of artemisinic aldehyde ?11 (13) reductase (DBR2) in Artemisia annua.

Jiang W. et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China

... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...


Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020

Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles

da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil 2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil

...On the other hand, the same TA repeat block displays a predicted potential to function as a TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ... ...Finally, there is at least one predicted pre-miRNA (Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...


Gene
2014, 545(1), 45-55. Volume DOI: 10.1016/j.gene.2014.05.008

Characterization of the promoter and 5?-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus

Xiao G. et al.,
a Key Laboratory of Oil Crop Biology of Ministry of Agriculture, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, Hubei 430062, China b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, PR China

... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. html) web servers; the known cis-acting elements were analyzed through a web ...


Scientia Horticulturae
2014, 175, 16-26. DOI: 10.1016/j.scienta.2014.05.032

Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3? H1 sequences between Tulipa fosteriana‘Albert heijn’and its reddish sport

Yuan, Y., Ma, X., Tang, D., Shi, Y.
School of Agriculture & Biology, Shanghai Jiao Tong University, Shanghai 200240, China

... The putative transcriptional start site (TSS) and cis-elements in the 5?flanking region of TfF3?H1AH were predicted by the Softberry database (http://linux1.softberry.com/berry.phtml? topic=tsssp&group=programs&subgroup=promoter) and the PLACE database (http://www.dna ...


Planta
Volume 237, Issue 4 , pp 1149-1161 DOI:10.1007/s00425-012-1833-5

Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum)

Vitthal T. Barvkar et al.,
1. Biochemical Sciences Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Plant Biotechnology Institute, NRC, 110 Gymnasium Place, Saskatoon, SK, S7N 0W9, Canada

... This sequence was used for prediction of transcription start sites (TSS) using the TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) program from the softberry package (Solovyev and Salamov 1997 ). ...


Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6

DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic

Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland 2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA

... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry), 3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...


Tree Genetics & Genomes
October 2013, Volume 9, Issue 5, pp 1369-1381 DOI:10.1007/s11295-013-0640-x

Nucleotide sequence analysis of two lignin genes in Acacia auriculiformis ? Acacia mangium hybrid for enhancement of wood pulp quality

A. Sukganah, C. Y. Choong, J. Russell, D. Neale, R. Wickneswari
1. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia 2. The James Hutton Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK

... The promoter regions were analysed using Softberry-TSSP (http://linux1.softberry.com/ berry.phtml) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/ html) programmes to predict the core ele- ments in the promoters. ...


Plant Molecular Biology Reporter
May 2013 DOI: 10.1007/s11105-013-0603-2

Molecular Cloning and Characterization of a Trichome-Specific Promoter of Artemisinic Aldehyde ?11(13) Reductase (DBR2) in Artemisia annua

Jiang et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China

... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...


Protoplasma
Volume 250, Issue 2 , pp 565-576 DOI:10.1007/s00709-012-0442-2

Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum

Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Further the upstream flanking region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml? Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...


Protoplasma
Volume 250, Issue 1 , pp 333-345 DOI:10.1007/s00709-012-0417-3

Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera

Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml? topic0tssp&group0 programs&subgroup0promoter) database. ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 114, Issue 3 , pp 373-383 DOI:10.1007/s11240-013-0332-0

Petal-specific activity of the promoter of an anthocyanidin synthase gene of tobacco (Nicotiana tabacum L.)

Lim et al.,
1. National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Republic of Korea 2. Department of Genetic Engineering and Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Republic of Korea

... The 5?-upstream region was analyzed using the PLACE (http://www.dna.affrc.go.jp/PLACE/ signalscan.html), PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and Softberry (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup ...


Functional & Integrative Genomics
Volume 13, Issue 2 , pp 167-177 DOI:10.1007/s10142-013-0310-y

A root-specific wall-associated kinase gene, HvWAK1, regulates root growth and is highly divergent in barley and other cereals

Ravneet Kaur, Kashmir Singh, Jaswinder Singh
1. Plant Science Department, McGill University, 21 111 Rue lakeshore, Ste Anne de Bellevue, QC, H9X 3V9, Canada

... 1999) and TSSP program (prediction of plant promoters, RegSite Plant DB, Softberry Inc.). ... 1). Various motifs and transcriptional factor binding sites were predicted using both the programs against the Softberry Regsite-Plant and PLACE databases. ...


Plant Physiology
June 2013 vol. 162 no. 2 885-896 DOI:10.?1104/?pp.?113.?214700

The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear

Wang et al.,
Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China (Z.W., D.M., TZ.L.) Research Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.) Shenyang Agricultural University, Shenyang 110866, China (A.W., TL.L.); and Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Germplasm Resources Utilization), Ministry of Agriculture, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)

... name proPcMYB10 (JX403962). It contained a core promoter at position ?60 bp and an enhancer promoter at position ?675 bp (as analyzed by TSSP software on softberry; http://linux1.softberry.com/berry.phtml). Besides the ...


Gene
Volume 531, Issue 1, 15 November 2013, Pages 15–22 DOI:10.1016/j.gene.2013.08.060

Identification of abiotic stress miRNA transcription factor binding motifs (TFBMs) in rice

Rama Devi et al.,
a Crop Improvement section, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India b Department of Statistics, Acharya N. G. Ranga Agricultural University, Rajendranagar, Hyderabad 500030, India

... org/gb2/gbrowse/maize_v2/). The TSS and TATA-box predictions were made using TSSP web tool (http://linux1.softberry.com/berry.phtml? topic = tssp& group = programs&subgroup = promoter). Putative promoter sequences ...


Journal of Integrative Agriculture
Volume 12, Issue 6, June 2013, Pages 962–970 DOI:10.1016/S2095-3119(13)60473-6

Molecular Cloning and Characterization of a Novel Gene Involved in Fatty Acid Synthesis in Brassica napus L

XIAO et al.,
a The Oil Crops Research Institute/National Oil Crops Improvement Center, Changsha 410128, P.R. China b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, P.R. China

... pI and MW were predicted using the DNAMAN program. Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry. com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. ...


J. Agric. Food Chem.
2013, 61 (18), pp 4396–4405 DOI: 10.1021/jf400776m

Differential Expression of Genes Encoding Acid Invertases in Multiple Shoots of Bamboo in Response to Various Phytohormones and Environmental Factors

Shu-Chien Liao †, Choun-Sea Lin ‡, Ai-Yu Wang *†, and Hsien-Yi Sung *†
† Department of Biochemical Science and Technology, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan ‡ Agricultural Biotechnology Research Center, Academia Sinica, No. 128, Sec. 2, Academia Road, Nankang, Taipei 115, Taiwan

... Sequence Analysis The potential transcription initiation site and the putative regulatory cis-elements and conserved motifs were analyzed using the online TSSP program (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) and ...


PloS one
August 08, 2013DOI: 10.1371/journal.pone.0071435

Characterization and Evolution of Conserved MicroRNA through Duplication Events in Date Palm (Phoenix dactylifera)

Xiao et al.,
Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan, China School of Agriculture and Food Sciences and Centre for Integrative Legume Research, The University of Queensland, Brisbane, Australia

... Similarities between duplicated pre-miRNA sequences were analyzed by Blast2. Promoters (TATA box) and enhancers of miRNA genes were predicted from regions 1 kb upstream of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...


J. Exp. Bot.
(2013) 64 (11): 3299-3312. doi: 10.1093/jxb/ert183

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

Wen et al.,
The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Center, and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095 Jiangsu, China

... Positive clones were sequenced at Takara Bio, Inc., Dalian, China. Basic sequence analysis was conducted with Macvector 10.0 (Accelrys, Oxford, USA). The transcription start site (TSS) was predicted with the plant promoter prediction program TSSP (http://www.softberry.com). ...


Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1089-1099 DOI:10.1007/s11105-013-0578-z

LtuCAD1 Is a Cinnamyl Alcohol Dehydrogenase Ortholog Involved in Lignin Biosynthesis in Liriodendron tulipifera L., a Basal Angiosperm Timber Species

Xu et al.,
1. Department of Genetics and Biochemistry, Clemson University, 130 McGinty Court, Robert F. Poole Agricultural Center, Room 153, Clemson, SC, 29634, USA 2. Bioenergy Systems Research Institute, University of Georgia, Athens, GA, 30602, USA

... The TSSP/Prediction of Plant Promoters (Solovyev and Shahmuradov 2003) (http:// softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) was used to predict the potential Plant Mol Biol Rep Page 4. transcription start site. ...


Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0656-2

Characterization of the Promoter of Artemisia annua Amorpha-4,11-diene Synthase (ADS) Gene Using Homologous and Heterologous Expression as well as Deletion Analysis

Zhu et al.,
1. Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Laboratory of Plant Biotechnology, College of Life and Environment Sciences, Shanghai Normal University, Shanghai, 200234, People’s Republic of China

... As TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup= promoter) predicted, three promoter/enhancer(s) are located at 2868 LDF-, 1247 LDF-, and 774 LDF-, respectively; the 2868 LDF- site is then considered as the transcription start site (+1 ...


Plant Pathology
doi: 10.1111/ppa.12155

Construction of a cassava PR protein-interacting network during Xanthomonas axonopodis pv. manihotis infection.

Roman et al.,
Manihot-Biotec Group, Department of Biology, Universidad Nacional de Colombia, Bogota D.C, Colombia

... For analysis of the promoter regions, 2 kp of upstream sequence of the HEV, CHI, SiR genes, 18 HEV interactors, five CHI interactors and a SiR interactor, were used in the tssp program (http://linux1.softberry.com/berry.phtml). Results. ...


Planta
Volume 237, Issue 6 , pp 1495-1508 DOI:10.1007/s00425-013-1860-x

Polymorphism of TaSAP1-A1 and its association with agronomic traits in wheat

Chang et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... A putative transcription start site (TSS) was identified at ?1,030 bp using the TSSP software available at site http://www.softberry.com (Fig. 1b). Fig. 1 a Isolation of the sequence surrounding TaSAP1 using primer pair Sap2F and Sap2R. ...


PloS one
November 22, 2013DOI: 10.1371/journal.pone.0080643

Studies on the Expression of Sesquiterpene Synthases Using Promoter-b-Glucuronidase Fusions in Transgenic Artemisia annua L

Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
Department of Chemistry and Biomedicine, Linnaeus University, Kalmar, Sweden

... The transcription start site (TSS) (labeled +1) of the cloned promoters was predicted using the TSSP software (http://linux1.soft-berry.com/berry.phtml) as summarized in Table 2. Using the PLACE (http://www.dna.affrc.go.jp/PLACE/) and PlantCARE (http://bioinformatics.psb.ugent ...


New Phytologist
198: 1191–1202. doi: 10.1111/nph.12207

AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea

Lu et al.,
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China

... To examine the expression pattern of AaORA in detail, we cloned an 1193-bp promoter sequence (JQ797714) of AaORA by genomic walking. The transcription start site (TSS) of the cloned promoter was predicted using TSSP software (http://linux1.softberry.com/berry.phtml). ...


Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI:10.1007/s11033-012-2169-8

Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree

Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter) program pre- dicted promoter position has been numbered ?1 and the upstream sequences have been numbered from -1 whereas the downstream nucleotides have been ...


Journal of Genetics,
Vol. 91, No. 3, December 2012

Genomewide analysis of intronic microRNAs in rice and Arabidopsis

G. D. YANG, et al.,
State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an, Shandong 271018, People’s Republic of China

... The upstream sequences were anal- ysed by two popular promoter prediction tools for plant genes: TSSP (http://linux1.softberry.com/) and Promoter Scan (http://www- bimas.cit.nih.gov/molbio/proscan/) with the default parameters. ...


J. Exp. Bot.
(2012) 63 (17): 6267-6281. doi: 10.1093/jxb/ers278

GbTCP, a cotton TCP transcription factor, confers fibre elongation and root hair development by a complex regulating system

Juan Hao et al.,
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China

... Gene-specific primers were designed for genome walking (Supplementary Table S1), and promoter prediction software TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group= programs&subgroup=promoter) was used to predict the GbTCP transcription initiation site. ...


Functional & Integrative Genomics
November 2012, Volume 12, Issue 4, pp 649-658 DOI: 10.1007/s10142-012-0282-3

Novel miRNAs in the control of arsenite levels in rice

Qingpo Liu
1. College of Agriculture and Food Science, Zhejiang A & F University, Lin’an, Hangzhou, 311300, People’s Republic of China

... al. (2007). If the pre-miRNAs were located in intronic or exonic regions, the upstream sequences of the host genes were adopted. The software TSSP (http://linux1.softberry. com/berry.phtml? topic0tssp&group0programs&subgroup0promoter ...


Molecular Biotechnology
10.1007/s12033-012-9583-y

Efficient Regeneration Potential is Closely Related to Auxin Exposure Time and Catalase Metabolism During the Somatic Embryogenesis of Immature Embryos in Triticum aestivum L

She et al.,
1. Key Laboratory of Crop Genetics and Breeding, Ministry of Agriculture, National Key Facility of Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China 2. National Key Facility of Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Zhong Guan Cun South St, Haidian District, Beijing, 100081, China

... ugent.be/webtools/plantcare/html/, Lescot et al. [36]). TSSP software was used to predict TATA-box and transcriptional start site (TSS) (http://linux1.softberry.com/berry.phtml? topic= tssp&group=programs&subgroup=promoter). Results ...


BMC Plant Biology
2012, 12:155 doi:10.1186/1471-2229-12-155

Intraspecific sequence comparisons reveal similar rates of non-collinear gene insertion in the B and D genomes of bread wheat

Bartos et al.,
1 Centre of the Region Hana for Biotechnological and Agricultural Research, Institute of Experimental Botany, Sokolovska 6, Olomouc, CZ-77200, Czech Republic 2 Institute of Molecular Genetics, Videnska 1083, Praha, CZ-14220, Czech Republic

... We extracted 1 kb sequence upstream to start codon for each coding sequence found at 3DS- and 3B-specific loci. We predicted polymerase II promoters, transcription start sites and TATA-box positions using TSSP [31] at http://linux1.softberry.com/berry.phtml webcite. ...


Plant Molecular Biology
Volume 81, Issue 1-2 , pp 119-138 DOI: 10.1007/s11103-012-9986-y

Trichome-specific expression of the amorpha-4,11-diene 12-hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisinin biosynthesis in Artemisia annua, as reported by a promoter-GUS fusion

Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
1. School of Natural Sciences, Linnaeus University, 39182, Kalmar, Sweden

... At present, we cannot conclude if the four cyp71av1 genes encode proteins of different length. Attempts to predict the transcription start site (TSS) of the cyp71av1 promoters using the TSSP software (http://linux1.softberry.com/berry.phtml) failed. ...


Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI: 10.1007/s11033-012-2169-8

Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree

Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter) program pre- dicted promoter position has been numbered ?1 and the upstream sequences have been numbered from -1 whereas the downstream nucleotides have been ...


PLoS ONE
7(9): e46021. doi:10.1371/journal.pone.0046021

A Candidate-Gene Association Study for Berry Colour and Anthocyanin Content in Vitis vinifera L.

Cardoso S, Lau W, Eiras Dias J, Fevereiro P, Maniatis N
1 Laboratory of Plant Cell Biotechnology, Instituto de Tecnologia Quimica e Biologica, Oeiras, Portugal, 2 Department of Genetics, Evolution and Environment, University College London, London, United Kingdom,

... promoter region. According to the TSSP promoter prediction program for plant genes available on SoftBerry network server (http://www.softberry.com), s90 is located only 4 bp upstream of the transcription start site (TSS). Two ...


Protoplasma
May 2012 DOI 10.1007/s00709-012-0417-3

Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera

Himanshu Tak hsjtak@barc.gov.in (1) Minal Mhatre minalmhatre@yahoo.com (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml? topic0tssp&group0 programs&subgroup0promoter) database. ...


Biologia Plantarum
Volume 56, Issue 4 , pp 699-704 DOI 10.1007/s10535-012-0132-0

Salt- and osmotic stress-induced choline monooxygenase expression in Kochia scoparia is ABA-independent

E. B. Kalinina (1) B. K. Keith (1) A. J. Kern (2) W. E. Dyer (1)
1. Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT, 59717, USA 2. Department of Biology, Northland College, Ashland, WI, 54806, USA

... was conducted by Geneway Company (Hayward, CA, USA) using lambda forward and reverse primers (Promega) and sequence-specific primers designed using Primer3 software (Table 1). Canonical promoter sequences were identified using the Softberry TSSP package ...


Protoplasma
August 2012 DOI 10.1007/s00709-012-0442-2

Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum

Himanshu Tak (1) Minal Mhatre (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Further the upstream flanking region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml? Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...


BMC Plant Biology
2012, 12:166 doi:10.1186/1471-2229-12-166

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

Aliki Kapazoglou et al.,
1 Institute of Agrobiotechnology (INA), CERTH, Thermi-Thessaloniki GR- 57001, Greece 2 Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki GR-54124, Greece

... The prediction of the putative cis acting elements was accomplished using the TSSP /Prediction of PLANT Promoters algorithm (Using RegSite Plant DB, Softberry Inc.) in the SoftBerry database (http://linux1.softberry.com/cgi-bin/programs/promoter/tssp.pl) and PlantCARE ...


Plant Molecular Biology Reporter
June 2012, Volume 30, Issue 3, pp 556-565 DOI 10.1007/s11105-011-0364-8

The Role of a Gibberellin 20-Oxidase Gene in Fruit Development in Pepper (Capsicum annuum)

Aphrodite Tsaballa (1) Konstantinos Pasentsis (2) Athanasios S. Tsaftaris (1) (2)
1. Department of Genetics and Plant Breeding, School of Agriculture, Aristotle University of Thessaloniki, Thessaloniki, 541 24, Greece 2. Institute of Agrobiotechnology (INA), CERTH, 6th km Charilaou-Thermis Road, Thermi, 570 01, Greece

... quenced several times with diverse primer sets. The analysis of the 5? upstream sequences was done using the TSSP/ Prediction of PLANT Promoters application at Softberry (http://linux1.softberry.com/berry.phtml). Based ...


African Journal of Biotechnology
Vol.10 . (55), pp. 11477-11482, 21 September, 2011 DOI:

Characterization of upstream sequences from the 8S globulin gene of Vigna radiata

Yue-Ning Yang et al.,
Department of Biotechnology, Jinan University, Guangzhou 510632, China.

... PLACE (http://www.dna.affrc.go.jp/database/) was used for transcription elements prediction; while transcription start site and TATA box were predicted with software TSSP (prediction of start of transcription sequences) of Softberry (http://www.softberry.com). ...


PLoS ONE
(2011), 6(12): e28073. doi:10.1371/journal.pone.0028073

Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model.

Zhang Y, Jiang W-k, Gao L-z
Plant Germplasm and Genomics Center, Kunming Institute of Botany, The Chinese Academy of Sciences, Kunming, China, Graduate School, Chinese Academy of Science, Beijing, China

... Promoters (TATA box) and enhancers of miRNA genes were identified from upstream 1 kb regions of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...


Plant Cell Rep.
2011 Apr;30(4):539-49. doi: 10.1007/s00299-010-0964-z.

Isolation and characterization of a rice glutathione S-transferase gene promoter regulated by herbicides and hormones

Hu et al.,
Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, 400044 Chongqing, People's Republic of China

... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http:// www.fruitfly.org/seq_tools/promoter. html) web servers. Construction of OsGSTL2 promoter::GUS fusions ...


Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1336–1345

In silico Detection of Novel MicroRNAs Genes in Soybean Genome

Yong-xin LIU a, *, , , Wei CHANG a, *, Ying-peng HAN a, Quan ZOU b, Mao-zu GUO c, Wen-bin LI a
a Key Laboratory of Soybean Biology, Chinese Ministry of Education/Soybean Research Institute, Northeast Agricultural University, Harbin 150030, P.R.China b School of Information Science and Technology, Xiamen University, Xiamen 361005, P.R.China

. al. 2005). TSSP of Softberry was adopted for supplemental predictions (http://www. Softberry.com, Solovyev and Shahmuradov 2003). The distribution of novel miRNAs was analyzed by Mapchart 2.1 (Voorrips 2002). Furthermore ...


Theoretical and Applied Genetics
Volume 122, Issue 1 , pp 211-223 DOI: 10.1007/s00122-010-1437-z

Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.)

Zhenqi Su, Chenyang Hao, Lanfen Wang, Yuchen Dong, Xueyong Zhang
1. Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, Chinese Academy of Agricultural Sciences, Beijing, 100081, China 2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... The promoter elements were identified using the TSSP program (http://www.softberry. com). ... The core elements of the promoter were predicted with the TSSP program (http:// www.softberry.com), and the TATA box was identified at ...


Plant Cell Reports
Volume 30, Issue 12 , pp 2187-2194 DOI: 10.1007/s00299-011-1124-9

Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential ‘Sorbonne’

Liu et al.,
1. College of Forestry, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China 3. Key Laboratory of Horticulture Plant Germplasm Utilization in Northwest China of Ministry of Agriculture, Yangling, 712100, Shaanxi, People’s Republic of China

... DQ471951). The putative transcription start site (TSS), predicted by the Softberry database (http://linux1. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter), is located at 46 bp upstream of the ATG translation start codon. ...


Journal of Integrative Plant Biology
53: 814–823. doi: 10.1111/j.1744-7909.2011.01070.x

Induced Pib Expression and Resistance to Magnaporthe grisea are Compromised by Cytosine Demethylation at Critical Promoter Regions in Rice.

Li et al.,
1 Key Laboratory of Molecular Epigenetics of MOE and The Institute of Genetics & Cytology, Northeast Normal University, Changchun 130024, China 2 Department of Agronomy, Jilin Agricultural University, Changchun 130118, China

... By a computational program Softberry-TSSP (http://www.softberry.com), two TATA boxes at positions 1 995 nt and 3 496 nt respectively, and two putative enhancers at positions 1 350 nt and 3 630 nt respectively, were identified (Figure 2, upper panel), further verifying its identity ...


The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x

A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.

Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China

... accession number FJ461673). In silico analysis of the promoter sequence was performed using the software programs tssp-tcm (Shahmuradov et al., 2005), nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...


American Journal of Plant Sciences
Volume 2 Issue 4 Pages: 619-628 2011 DOI: 10.4236/ajps.2011.24073

Trichome-Specific Expression of Amorpha-4,11-Diene Synthase, a Key Enzyme of Artemisinin Biosynthesis in Artemisia annua L., as Reported by a Promoter-GUS Fusion

H Wang, L Olofsson, A Lundgren
Linnaeus University, Faculty of Science and Engineering, School of Natural Sciences

... The transcription start site (TSS) of the cloned promoter was predicted using the TSSP software (http://linux1. softberry.com/berry.phtml). A putative TSS of ADS (la- beled +1 in Figure 1) was predicted 51 bp upstream of the translation initiation ATG-codon. ...


Mol. Plant
(2011) 4 (2): 300-309. doi: 10.1093/mp/ssq076

Characterization of Xanthomonas oryzae-Responsive cis-Acting Element in the Promoter of Rice Race-Specific Susceptibility Gene Xa13

Ting Yuan, Xianghua Li, Jinghua Xiao and Shiping Wang 1
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... Promoter Sequence Analysis. The TATA boxes of promoters P Xa13 and P xa13 were predicted using the computer programs TSSP provided at the Softberry website (www.softberry.com) and PROSCAN (http://bimas.dcrt.nih.gov/molbio/proscan). Statistical Analysis. ...


Molecular Biology Reports
2011, Volume 38, Issue 6 , pp 4023-4035 DOI: 10.1007/s11033-010-0521-4

Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells

Upendra K. Singh Shekhawat, Thumballi R. Ganapathi, Lingam Srinivas
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Also, a 76 nucleotide long 50 UTR has been pre- dicted based on the sequence of 50 end of the EST DN239172 and the analysis of 50 proximal sequence (obtained using TAIL-PCR) by TSSP program hosted at www.softberry.ru. ...


Journal of Plant Physiology
Volume 167, Issue 12, 15 August 2010, Pages 1003-1008 doi:10.1016/j.jplph.2010.01.021

Expression of the 26S proteasome subunit RPN10 is upregulated by salt stress in Dunaliella viridis

Xiaobin Sun a, 1, Xiangzong Meng b, 1, Zhengkai Xu a, b and Rentao Song a
a Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, Shanghai 200444, China b Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China

... gov/BLAST/). Gene prediction was carried out using SoftBerry TSSP (http://www. softberry.com/berry.phtml?topic=ann2) and GENSCAN (http://genes.mit.edu/ GENSCAN.html) (Burge and Karlin, 1997). Sequence alignments ... 


Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x

Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)

Xia YANG 1, Hong CUI 2, Zu-Li YUAN 2, Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China 2 Henan Agricultural University, Zhengzhou 450002, China

... To predict the promoter regions and the transcription start sites, genomic regions upstream of the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ... 


Plant Physiology
153:1239-1249 (2010) First published online May 3, 2010; 10.1104/pp.110.157123

Identification and Application of a Rice Senescence-Associated Promoter

Liu et al.,
National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, People's Republic of China (L.L., Y.Z., X.L., Y.L.); Department of Plant Sciences, University of California, Davis, California 95616 (L.L., M.W.S.)

... sativa sp. japonica). The promoter region of this gene was predicted using the software TSSP, provided at the Softberry Web site (http://linux1.softberry.com/berry.phtml?topic% 810%867=case_study_plants). The regulatory elements ... 


Gene
Volume 459, Issues 1-2, 1 July 2010, Pages 24-31 doi:10.1016/j.gene.2010.03.009

Molecular characterization and methylation study of matrix gla protein in articular cartilage from pig with osteochondrosis

Helga Sauerwein, Karl Schellander
a Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Germany b Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand

... was performed by the CEQ8000 sequencer system (Beckman Coulter). A sequence of transcription start site (TSS) was predicted using TSSP (http://www.softberry.ru). The published sequences (NC_010447) of the 5?-flanking ... 


Genome
Volume 53, Number 7, 1 July 2010 , pp. 533-544(12)

Comparison of gene order of GIGANTEA loci in yellow-poplar, monocots, and eudicots

Liang Haiying; et al.,

... 2006). Exon–intron splice sites, start codons, and transcription start sites were predicted by NetPlantGene (Hebsgaard et al. 1996), NetStart 1.0 (Ped- ersen and Nielsen 1997), and the TSSP engine developed by SoftBerry (Solovyev and Shahmuradov 2003), respec- tively. ... 


Plant Science
Volume 179, Issue 4, October 2010, Pages 390-398 doi:10.1016/j.plantsci.2010.06.018

Comparison of gene order in the chromosome region containing a TERMINAL FLOWER 1 homolog in apricot and peach reveals microsynteny across angiosperms

Haiying Liang et al.,
a Department of Genetics and Biochemistry, Clemson University, Clemson, SC 29634, United States b Department of Horticulture, University of Georgia, Athens, GA 30602, United States

... Exon/intron splicing sites were determined by aligning with a full-length coding sequence obtained from the peach cultivar Springprince . Transcription start sites were predicted by TSSP engine developed by SoftBerry [39]. ... 


Planta
2010 Apr;231(5):1211-27. Epub 2010 Mar 6 DOI: 10.1007/s00425-010-1127-8

Identification and organization of chloroplastic and cytosolic L-myo-inositol 1-phosphate synthase coding gene(s) in Oryza sativa: comparison with the wild halophytic rice, Porteresia coarctata

Ray et al.,
Plant Molecular and Cellular Genetics, Bose Institute (Centenary Campus), Kolkata, India

... 1999) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/html/). Predictions of eukaryotic promoter and transcription initiation sites were performed using the TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc.). ... 


J. Exp. Bot.
2010 61 (11): 2991-3002. doi: 10.1093/jxb/erq124

Cold acclimation and low temperature resistance in cotton: Gossypium hirsutum phospholipase Da isoforms are differentially regulated by temperature and light

Kargiotidou A, Kappas I, Tsaftaris A, Galanopoulou D, Farmaki T.
1Institute of Agrobiotechnology, Centre for Research and Technology, 6th km Charilaou - Thermi Rd. 570 01, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki 54006, Greece

... Promoter prediction of GrPLD and GaPLD The TSSP (promoter prediction program for plant genes), http://linux1.softberry.com/berry.phtml (Shahmuradov et al., 2005) was used. A promoter was predicted for GrPLD and GaPLD . ... 


Methods Mol Biol.
2010;592:149-61

MicroRNA promoter analysis

Megraw M, Hatzigeorgiou AG
Department of Genetics, Center for Bioinformatics, School of Medicine, University of Pennsylvania, Philadelphia, PA, USA

... events. 3. The first cited source provides a web-based interface that accepts regions of sequence for promoter prediction (http:// softberry.com/berry.phtml?topic = tssp&group = programs& subgroup = promoter). The second


The Plant Cell
22:349-363 (2010) 10.1105/tpc.108.064816

The Arabidopsis thaliana STYLISH1 Protein Acts as a Transcriptional Activator Regulating Auxin Biosynthesis

Eklund et al.,
a Department of Plant Biology and Forest Genetics, Uppsala BioCenter Swedish University of Agricultural Sciences, 750 07 Uppsala, Sweden b Research Institute of Genome-Based Biofactory, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8562, Japan

... The yeast one-hybrid analysis showed the ability of STY1 to bind a 207-bp region directly upstream of a predicted TATA box (YUC4-1; TSSP at http://www.softberry.com/berry.phtml) but not to DNA from the more proximal promoter region or the presumptive 5' untranslated ...


Planta
Volume 230, Number 5 / October, 2009, pp. Volume 230, Number 5 / October, 2009

Genome-wide survey of rice microRNAs and microRNA–target pairs in the root of a novel auxin-resistant mutant

Meng et al.,
(1) State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China (2) Department of Bioinformatics, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China

... Both the transcription start site (TSS) and the TATA-box in miRNA promoters were searched by using TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group= programs& subgroup=promoter) (Shahmuradov et al. 2003). ...


Plant Production Science
Vol. 12 (2009) , No. 3 341-344

Genetic Transformation of a High Molecular Weight Glutenin (Glu-1Dx5) to Rice cv. Fatmawati

Yoshiharu Wada 2), Nono Carsono 1), Anas 1), Ly Tong 2) and Tomohiko Yoshida 2)
1) Faculty of Agriculture, Padjadjaran University 2) Faculty of Agriculture, Utsunomiya University

... To confirm the existence of the promoter in the full-length of 8.2 kb Glu- 1Dx5, we examined the DNA sequence with TSSP- Prediction of Plant Promoter Software (Softberry Inc.), and found at least 4 promoters or enhancers on the basis of TATA box prediction, suggesting that ...


BMC Plant Biol.
2009 Jul 17;9:93.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.

Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.

... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih. gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...


BMC Plant Biology
2009, 9:126 doi:10.1186/1471-2229-9-126

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Francois Fauteux, Martina V Stromvik
1 Department of Plant Science, McGill University, Ste-Anne-de-Bellevue, Canada 2 McGill Centre for Bioinformatics, McGill University, Montre'al, Canada

... literature [20, 35, 60-77]. The transcription start sites were predicted in 13 promoters for which transcriptional start data was unavailable in GenBank or literature, using the TSSP software from Softberry Inc. (http://www.softberry.ru). One representative ...


Plant Tissue Cult. & Biotech.
18(2): 123-130, 2008 (December)

Identification of Drosophila Promoter Using Positional Differential Matrix and Support Vector Machine from Sequence Data

Azizul Haque et al.,
Institute of Information Technology, University of Dhaka, Dhaka-1000, Bangladesh

... Program used (%) NNPP threshold (0.8) SoftBerry (TSSP) ProScan Vers. 1.7 Dragon Pro?moter Finder Vers. 1.4 Promoter 2.0 Pred. Server ... The proposed method exhibits better accuracy compared to other two methods NNPP (Reese et al. 1996) and SoftBerry(TSSP). ...


Plant Biotechnology
25, 000–000 (2008)

Genome-wide comparative analysis of Oryza sativa (japonica) and Arabidopsis thaliana 5 -UTR sequences for translational regulatory signals

M. Shashikanth, A. R. Krishna, G. Ramya, Geeta Devi, K. Ulaganathan
Center for Plant Molecular Biology, Osmania University, Hyderabad-500007, A. P., India

... 5 -UTR-genomic sequences longer than 150 base pairs were submitted to the promoter finding tool, TSSP (Softberry), available online at http://www.softberry.com ...


Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065

Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)

Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece

... elements was performed using the database available at: http://softberry.com. TSSs were determined using the TSSP program available at the site. NSITE-PL was ...


New Phytologist
2008 Volume 179 Issue 3, Pages 722 - 737

Comparative analysis of orthologous cellulose synthase promoters from Arabidopsis, Populus and Eucalyptus: evidence of conserved regulatory elements in angiosperms

Nicole Marie Creux, Martin Ranik, David Kenneth Berger and Alexander Andrew Myburg
1 Department of Genetics , 2 Department of Plant Science, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South Africa

... The transcriptional start site (TSS) prediction program, TSSP (Shahmuradov et al., 2005, available at http://www.softberry.com), is trained on plant promoters ...


BMC Bioinformatics
2008, 9:414 doi:10.1186/1471-2105-9-414

Pol II promoter prediction using characteristic 4-mer motifs: a machine learning approach

Firoz Anwar et al.,
Department of Computer Science and Engineering, East West University, Bangladesh, 2Department of Genetic Engineering and Biotechnology, University of Dhaka, Bang

... Other prominent promoter prediction tools use either a statistical approach or Neural Network such as SoftBerry (TSSP). However, ...


Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia

... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...


Gene
Volume 409, Issues 1-2, 15 February 2008, Pages 1-10

Molecular evolution of the MLO gene family in Oryza sativa and their functional divergence

Qingpo Liua and Huiqin Zhu
School of Agriculture and Food Science, Zhejiang Forestry University, Hangzhou, Lin'an 311300, PR China bDepartment of Agronomy, Zhejiang University, Hangzhou 310029, PR China cDepartment of Agronomy, Qinghai University, Xining 810003, PR China

... Further, we have identified promoters for OsMLOs using the plant promoter prediction program TSSP that was developed by Softberry Inc. ...


TAG Theoretical and Applied Genetics
Volume 116, Number 2 / January, 2008 Pages 179-192

Does sequence polymorphism of FLC paralogues underlie flowering time QTL in Brassica oleracea?

H. Razi, E. C. Howell, H. J. Newbury and M. J. Kearsey
(1) School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK (2) Department of Crop Production and Plant Breeding, College of Agriculture, Shiraz University, Shiraz, 71441-65186, Iran

... Higo et al. 1999), the TSSP (Softberry, http://www.soft- berry.com) and the TSSP-TCM (Shahmuradov et al. 2005). Results The B. oleracea ...


Plant, Cell & Environment
Volume 31 Issue 1 Page 86-96, January 2008

Identification of novel pathogen-responsive cis-elements and their binding proteins in the promoter of OsWRKY13, a gene regulating rice disease resistance

MENG CAI et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... The promoter region of OsWRKY13 was predicted with the computer programs TSSP provided at the Softberry website (http://www.softberry.com), and PROSCAN (http ...


Genetics
Vol. 176, 2541-2549, August 2007

The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus

Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China and Key Biotechnology Laboratory of State Ethnic Affairs Commission, College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China

... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH, respectively (http://www.softberry.com/berry.html). ...


PLoS Comput Biol
2007, 3(3): e37 doi:10.1371/journal.pcbi.0030037

Characterization and Identification of MicroRNA Core Promoters in Four Model Species

Zhou X, Ruan J, Wang G, Zhang W
Department of Computer Science and Engineering, Washington University in Saint Louis, Saint Louis, Missouri, United States of America, Department of Genetics, Washington University in Saint Louis, Saint Louis, Missouri, United States of America

... In comparison, TSSP (SoftBerry, http: / /www.softberry.com), which is one of the best promoter prediction methods for plants, only identified 39 (60 ...


Plant Biotechnology Journal
5 (5), 664–674

A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific gene expression in transgenic plants

Meng Cai, Jun Wei, Xianghua Li, Caiguo Xu, Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Centre of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... The promoter region of D54O was predicted using the computer programs TSSP, provided at the Softberry website (http://www.softberry.com), and PROSCAN (http ...


Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


Journal of Zhejiang University - Science B
August 27, 2007 pp. 661-665

Cloning, sequencing and expression analysis of the NAR promoter activated during hyphal stage of Magnaporthe grisea

Lu Jian-ping Contact Information, Duan Zhi-bing , Liu Tong-bao and Lin Fu-cheng
Department of Biology, School of Life Sciences, Zhejiang University, Hangzhou, 310058, China
Biotechnology Institute, Zhejiang University, Hangzhou, 310029, China

... fruitfly.org/seq_tools/promoter.html, version 2.2), TSSP (http://www.softberry.com/ berry.phtml, pre- diction of plant promoters), and TFSCAN (http:// bioweb ...


Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)

Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene

Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming

... 2002; Takai and Jones 2003) for CpG island prediction; TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) for plant ...


The Plant Cell
18:2929-2945 (2006)

The Balance between the MIR164A and CUC2 Genes Controls Leaf Margin Serration in Arabidopsis

Krisztina Nikovicsa et al.,
Laboratoire de Biologie Cellulaire, Institut Jean Pierre Bourgin, Institut National de la Recherche Agronomique, 78026 Versailles Cedex, France

...Analysis of the pri-miRNAs We performed 3' and 5' RACE for each gene with the GeneRacer cDNA amplification kit (Invitrogen). We used two or three rounds of nested PCR to amplify the 3' and 5' ends of the three pri-miR164s. The miR164A-15, miR164A-17, and miR164A-18 primers were used for the 3' end of pri-miR164A, and miR164A-16 and miR164A-7 were used for the 5' end. The miR164B-13, miR164B-15, and miR164B-16 primers were used for the 3' end of pri-miR164B, and miR164B-5 and miR164B-14 were used for the 5' end. We used miR164A-15 and miR164C-1 for the 3' end of pri-miR164A and miR164C-3 and miR164C-5 for the 5' end. Following gel electrophoresis, RACE reaction products were inserted into the pGEM-T Easy vector (Promega), and the two strands were sequenced. Two to four independent 5' clones and 5 to 10 independent 3' clones were analyzed for each gene. Promoter and transcription start sites were predicted by the TSSP program ( http://www.softberry.com/berry.phtml?topic=tsspandgroup=programsandsubgroup=promoter). The pri-miRNA secondary structure was determined with the Mfold program (Mathews et al., 1999; Zuker, 2003) ( http://www.bioinfo.rpi.edu/applications/mfold/old/rna/)....


Genetica
(2006), 128, 395-407

Isolation and characterization of a novel semi-lethal Arabidopsis thaliana mutant of gene for pentatricopeptide (PPR) repeat-containing protein

Tomas Kocabek, Jana Repkova, Marketa Dudova, Klara Hoyerova and Lukas Vrba
Institute of Plant Molecular Biology, Biological Centre of the Academy of Sciences of the Czech Republic, Branisovska 31, CZ-370 05 Ceske Budejovice, Czech Republic

Applied TSSP software... TSSP-TCM software suitable for plant pro-. moters searching (Shahmuradov et al. ...


Plant Science
Volume 168, Issue 6, June 2005, Pages 1571-1579

Functional analysis of GUS expression patterns and T-DNA integration characteristics in rice enhancer trap lines

Peng et al.,
Biotechnology Research Institute, The Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... promoter systems, rice genomic sequences located upstream the GAL4/VP16-UAS apparatus were used for promoter prediction analysis (TSSP, http://www.softberry.com


Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1731, Issue 3, 20 December 2005, Pages 202-208

T-DNA tagging and characterization of a cryptic root-specific promoter in Arabidopsis

C. Sivanandan, T.P. Sujatha, Anand Mohan Prasad, R. Resminath, Dhiraj R. Thakare, S.R. Bhat and Srinivasan
National Research Center on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110012, India

... using a web-based program, Plant Cis-Acting Regulatory Elements (Plant CARE) [21] and TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc ...


BMC Bioinformatics
2005 6:114 doi:10.1186/1471-2105-6-114

CAGER: classification analysis of gene expression regulation using multiple information sources

Jianhua Ruan and Weixiong Zhang
1Department of Computer Science and Engineering, Washington University, St. Louis, MO 63130, USA and Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110, USA

... For Arabidopsis ORFs, the upstream sequences were used as inputs to a promoter prediction program, TSSP [63], to predict transcription start sites (TSSs). ...


Bioinformatics
2005 21(14):3074-3081

Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana

Weixiong Zhang et al.,
Department of Computer Science and Engineering, Washington University in Saint Louis Saint Louis, MO 63130, USA

... sites (TSSs). To predict TSSs, we combined an A.thaliana cDNA database and a software, TSSP (SoftBerry, http://www.softberry.com). As ...


Acta Biochimica Polonica
Vol. 52 No. 1/2005 117-128

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits

Frantz Liszewska, Dali Gaganidze and Agnieszka Sirko
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warszawa, Poland

... ments production. Location of the potential plant promoter was computed by the TSSP program [http://www. softberry.com]. Phylo- genies ...


Nucleic Acids Research
2005, Vol. 33, No. 3 1069–1076

Plant promoter prediction with confidence estimation

I. A. Shahmuradov(1), V. V. Solovyev(1,2,*) and A. J. Gammerman(1)
(1)Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK and (2)Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

Accurate prediction of promoters is fundamental to understanding gene expression patterns, where confidence estimation is one of the main requirements. Using recently developed transductive confidence machine (TCM) techniques, we developed a new program TSSP-TCM for the prediction of plant promoters that also provides confidence of the prediction.


The Plant Journal
(2004) 37 (4), 517-527

Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein

X Sun et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China

.... Promoter regions of the Xa26 family members were analyzed with the promoter prediction programs tssp (http://www.softberry.com/berry.phtml), nnpp (http://www ...


Plant Physiology
136:3023-3033 (2004)

Utility of Different Gene Enrichment Approaches Toward Identifying and Sequencing the Maize Gene Space

Nathan Michael Springer, Xiequn Xu and W. Brad Barbazuk
Center for Plant and Microbial Genomics, Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108 (N.M.S.); and Donald Danforth Plant Sciences Center, St. Louis, Missouri 63132 (X.X., W.B.B.)

...upstream sequence, 10 of the 33 genes had at least 1 kb of upstream sequence, and the longest extension was 2.2 kb. This sequence is likely to contain 5# UTRs and promoters. We attempted to determine how often a putative PolII promoter recognition sequences could be found using the Softberry TSSP package (Mount Kisco, NY; http://www.softberry.com; Shahmuradov et al., 2003), which uses characteristics of known factor binding sites to predict potential transcription start sites in plant DNA sequence. Putative promoters were predicted in 13 of the 26 upstream sequences assayed, and putative TATA boxes were identified in 9 (70%) of...


Nucleic Acids Research
2003, Vol. 31, No. 1 114-117

PlantProm: a database of plant promoter sequences

Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. ...


TSSG

Journal of Biochemical Technology,
Vol 4, No 1 (2012)

Analysis of diabetic retinopathy biomarker VEGF gene by computational approaches

Jayashree Sadasivam, N Ramesh, K Vijayalakshmi, Vinni Viridi, Shiva prasad

... Gene promoters TSSG www.softberry.com/berry.tssp& group=programs&subgroup=pro moter Proteins Data PDB www.rcsb.org Tandem repeats TRF finder http://tandem.bu.edu/trf/trf.sub mit.options.html Docking Clusproprotei n-protein dock. Cluspro.bu.edu Page 3. ...


Nature Communications
4, Article number: 2739 doi:10.1038/ncomms3739

Genome-wide association study implicates NDST3 in schizophrenia and bipolar disorder

Lencz et al.,
Division of Research, Department of Psychiatry, The Zucker Hillside Hospital Division of the North Shore—Long Island Jewish Health System, Glen Oaks, New York 11004, USA Center for Psychiatric Neuroscience, The Feinstein Institute for Medical Research, Manhasset, New York 11030, USA

... TATA boxes were predicted by TSSG (Softberry Inc) and the predicted TATA box locations were depicted with vertical arrows (red on plus strand and blue on minus strand of chromosome 4). In cross-species genomic sequence alignment, high sequence similarity was depicted ...


Gene
Volume 527, Issue 2, 25 September 2013, Pages 606–615 DOI:10.1016/j.gene.2013.05.078

Novel polymorphisms in UTR and coding region of inducible heat shock protein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus) and riverine buffalo (Bubalus bubalis)

M. Sodhi, M. Mukesh, A. Kishore, B.P. Mishra 1, R.S. Kataria, B.K. Joshi
National Bureau of Animal Genetic resources, Karnal 132001, India

... Microsatellite repeats were identified using Gramene software (http://www.gramene.org/db/markers/ ssrtool).The promoter region was predicted using Proscan software (http://www-bimas.cit.nih. gov/molbio/proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ...


J Biol Chem.
2012 Dec 19. [Epub ahead of print] DOI: 10.1074/jbc.M112.419168

MiR-125b Functions as a Key Mediator for Snail-Induced Stem Cell Propagation and Chemoresistance

Zixing Liu et al.,
1 University of South Alabama, United States; 2 Central South University, China;

... Western blotting. Luciferase Reporter Assay — The miR-125b promoter pGL3 basic luciferase vector was constructed according to the literature and TSSG prediction (http://linux1.softberry.com/berry.phtml? topic=products). pGL3 ...


Plant Biology,
14: 714–724. doi: 10.1111/j.1438-8677.2011.00556.x

Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula

Bucsenez, M., Ruping, B., Behrens, S., Twyman, R. M., Noll, G. A. and Prufer, D.
1 Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Aachen, Germany 2 Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat Munster, Munster, Germany

... MATERIAL AND METHODS In silico identification of the transcriptional start site and TATA box The putative transcriptional start site and TATA box of the MtSEO-F1 promoter were predicted using the Transcriptional Start Site Prediction (TSSP) tool from Softberry (http:// www ...


Mol Biol Rep.
2011 Aug;38(6):4153-7. doi: 10.1007/s11033-010-0535-y. Epub 2010 Nov 24.

Identification of the transcriptional promoters in the proximal regions of human microRNA genes

Long et al.,
Key Laboratory of Neurogenetics and Channelopathies of Guangdong Province and the Ministry of Education of China, Institute of Neuroscience and the Second Affiliated Hospital of Guangzhou Medical University, 250 Chang-gang-dong Road, Guangzhou, 510260, China

... It is shown that TSSG (http://www.softberry.ru/berry.phtml, Softberry) is a good promoter prediction program with few false positive pre- dictions comparing to other promoter finding programs [17, 20]. Therefore, we used this program to predict the promoter regions and TSSs. ...


Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015

Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes

Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/ proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...


BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51

Identification of a novel temperature sensitive promoter in cho cells

Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria 2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria

... Computational analysis of this region was performed using several freely available online prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/ berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...


Hum Genet.
2010 Jan 12. [Epub ahead of print]

PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis

Ishizaki et al.,
Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, 812-8582, Japan

... 2004). The values from three separate assays were compared between constructs. The putative promoter region of PD1 gene was predi- cated using the TSSG (http://www.softberry. com/berry. phtml?topic=tssg&group=programs&subgroup=promoter). ... 


Glycobiology
Advance Access published November 22, 2010

Conservation of the ST6Gal I gene and its expression in the mammary gland

Jovana Maksimovic, Julie A. Sharp, Kevin R. Nicholas, Benjamin G. Cocks, Keith Savin
Centre for Reproduction and Development, Monash Institute of Medical Research, Clayton 3168 Australia Biosciences Research Division, Department of Primary Industries, Bundoora 3083 Australia Institute for Technology Research and Innovation, Deakin University, Geelong 3214 Australia

... TRANSCOMPEL (Kel-Margoulis, OV, Kel, AE, et al. 2002) database, as well as mononucleotide position weight matrices for individual TFBS collected in TRANSFAC. Transcription start sites were predicted using TSSG (Softberry). Page 24. 24 Acknowledgments ...


Acta Biochim Biophys Sin (Shanghai).
2009 Apr;41(4):309-15.

Identification and characterization of the minimal promoter of Mipu1: the role of GC boxes in the regulation of basal transcription

Lv B et al.,
Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha 410078, China.

... rat/). The Mipu1 gene transcription start site was predicted using Dragon GC + Promoter Finder (http://sdmc.lit.org.sg/promoter/CGrich1_0/CGRICH.htm) and TSSG (http://www.softberry.com/berry.phtml?topic=promoter). Promoterscan ...


European Journal of Cell Biology
Volume 88, Issue 12, December 2009, Pages 731-742

Molecular mechanisms underlying the pro-inflammatory synergistic effect of tumor necrosis factor ? and interferon ? in human microvascular endothelium

Lombardi et al.,
aDepartment of Clinical Physiopathology, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, Viale Pieraccini 6, I-50139 Florence, Italy bDepartment of Internal Medicine, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, I-50139 Florence, Italy

... A 5-kb region upstream from the TNFa-RII and the IFNg-R open reading frames was analyzed using the promoter identification programs promoter predictions (http://www.fruitfly.org/seq_tools/ promoter) and TSSG (http://softberry.com/berry.phtml?topic=tssg&group ...


Endocrinology
2009 Vol. 150, No. 4 1870-1878

Hypothalamic Expression of Eap1 Is Not Directly Controlled by Ovarian Steroids

Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa and Sergio R. Ojeda
Division of Neuroscience (V.M., S.R.O.), Oregon National Primate Research Center, Beaverton, Oregon 97006; and Department of Physiology and Pharmacology (C.M., R.A.S., D.M.D.), Oregon Health and Science University, Portland, Oregon 97239

... The position of a TSS was predicted using several search tools including Promoter 2.0 Prediction server (http://www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder version 1.5 (http://research.i2r.a-star.edu.sg/promoter/promoter1_5/DPF.htm), and Softberry TSSG (http ...


Endocrinology
2008, doi:10.1210/en.2008-0779

Hypothalamic expression of Eap1 is not directly controlled by ovarian steroids

Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa, and Sergio R. Ojeda
Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon, USA; and Department of Physiology & Pharmacology, Oregon Health & Science University, Portland, Oregon, USA

... www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder v1.5 (http://research. i2r.a- star.edu.sg/promoter/promoter1_5/DPF.htm) and Softberry TSSG (http://www ...


Endocrinology
2008, Vol. 149, No. 9 4256-4266

Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures

Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy

... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic promoter identification programs (http://www.softberry.com/berry.phtml?topic=tssg&group=programs&subgroup=promoter ...


Animal Genetics
39(5):531-543, October 2008.

Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST

Meyers, S. N.; Beever, J. E.

... Putative promoter sequences and transcriptional start sites (TSSs) were predicted using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...


Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95

Cloning and functional analysis of the promoter region of the human Disc large gene

Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina

... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...


Cancer Research
68, 8976-8985, November 1, 2008. doi: 10.1158/0008-5472.CAN-08-0769

Roles for MicroRNAs, miR-93 and miR-130b, and Tumor Protein 53–Induced Nuclear Protein 1 Tumor Suppressor in Cell Growth Dysregulation by Human T-Cell Lymphotrophic Virus 1

Yeung et al.,
Molecular Virology Section, Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland; 2 Laboratory of Virus Immunology, Institute for Virus Research, Kyoto University, Shogoin Kawahara-cho, Sakyo-ku, Kyoto, Japan;

... luciferase (f-luc) reporter gene. The putative promoter of miR-130b was predicted by TSSG promoter prediction program. 6 PCR primers (sense ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW" ... 1999–2005, www.softberry.com); ...


BMC Genomics
2007, 8:203 doi:10.1186/1471-2164-8-203

In silico comparative genomic analysis of GABAA receptor transcriptional regulation

Christopher J Joyce1§
1Faculty of Biological Sciences, The University of Leeds, Leeds, UK

Table 1 - Gene Regulation Prediction Software utilised ...TSSG TSS Prediction www.softberry.com ...


Nature and Science,
4(3), 2006

An In Silico Investigation into the Discovery of Novel Cis-acting Elements within the Intronic Regions of Human PAX7

Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center), New York City, New York 10021, USA

The names and functions of the programs used are: ...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) - This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) - TSSG is the most accurate mammalian cis element prediction program.


DNA and Cell Biology
Jun 2006, Vol. 25, No. 6 : 346 -358

Cloning and Characterization of the BRD7 Gene Promoter

Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Hunan, People's Republic of China

... The transcriptional initiation site was identified using the TSSG program (http://www.softberry.com/berry.phtml?topic promoter) and Dragon GC Promoter Finder ...


Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223

GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis

ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.

... Consistent with this result, sequence analysis using TSSG and TSSW softwares ( http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ... )


TSSW

International Journal of Fisheries and Aquatic Studies
2016; 4(3): 378-383

Isolation, characterization and activity analysis of selected promoters of mud crab, Scylla serrata

Mani, M. K., Neeli-Venkata, R., Kondadhasula, R., & Majumdar, K. C.
Post-Harvest Technology, Central Institute of Fisheries Education, Mumbai, India; Department Of Signal Processing, Tampere University Of Technology, Finland

.. Histone3 -R GGCGCTAGCTAGCTTCCTTCTT 2.3 Promoter nucleotide sequences analysis The sequences thus obtained were analysed for potential transcription factor binding sites specific for promoters using TSSW (http://linux1.softberry.com/berry.phtml) and ...


International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573

The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53

Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China

... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools: NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp. duke.edu/generegulation/McPromoterMMII/), and Softberry programs FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...


J. Virol. June
2012 vol. 86 no. 12 6688-6700 DOI: 10.1128/JVI.07037-11

Feline Tetherin Is Characterized by a Short N-Terminal Region and Is Counteracted by the Feline Immunodeficiency Virus Envelope Glycoprotein

Celestino et al.,
aDepartment of Molecular Medicine, University of Padua, Padua, Italy bRetrovirus Center and Virology Section, Department of Experimental Pathology, University of Pisa, Pisa, Italy

... The transcription initiation start site and the different cis-acting elements present in the putative cBST2 promoter region were predicted by using the following programs: the TSSW prediction program (Softberry), TFsitescan (MIRAGE [Molecular Informatics Resource for the ...


PLoS ONE
(2011), 6(10): e26944. doi:10.1371/journal.pone.0026944

A Common Genetic Variant (97906C>A) of DAB2IP/AIP1 Is Associated with an Increased Risk and Early Onset of Lung Cancer in Chinese Males.

Yang et al.,
The Institute for Chemical Carcinogenesis, The State Key Lab of Respiratory Disease, Guangzhou Medical University, Guangzhou, People's Republic of China Department of Pathology, Yale University School of Medicine, New Haven, Connecticut, United States of America

...We used the TSSW program (http://www.softberry.ru/berry.phtml) to predict promoter region and found that the 4000 bp 5?-upstream region of DAB2IP gene are potential promoter region. ...


Molecular and Cellular Biology
January 2009, p. 570-581, Vol. 29, No. 2 doi:10.1128/MCB.01275-08

CUX1 and E2F1 Regulate Coordinated Expression of the Mitotic Complex Genes Ect2, MgcRacGAP, and MKLP1 in S Phase

Seguin et al.,

... sequences immediately upstream of the transcription start sites were analyzed with the Genomatix suite (www.genomatix.de) and TSSW software (www.softberry.com ...


Animal Genetics
39(5):531-543, October 2008.

Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST

Meyers, S. N.; Beever, J. E.

... Putative promoter sequences and transcriptional start sites (TSSs) were predicted using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...


Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95

Cloning and functional analysis of the promoter region of the human Disc large gene

Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina

... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...


BMC Bioinformatics.
2008; 9: 113.

Human Pol II promoter recognition based on primary sequences and free energy of dinucleotides

Jian-Yi Yang, Yu Zhou, Zu-Guo Yu, Vo Anh, and Li-Qian Zhou
1School of Mathematics and Computational Science, Xiangtan University, Hunan 411105, China 2School of Mathematical Sciences, Queensland University of Technology, GPO Box 2434, Brisbane, Q 4001, Australia

... of promoter prediction tools, which are available on-line, namely Neural Network Promoter Prediction (NNPP version 2.2) [27], Soft Berry (TSSW) [28], Dragon ...


Mol. Cell. Biol.
doi:10.1128/MCB.01275-08

CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP and MKLP1 in S-phase

Seguin et al.,
INSERM U749, Faculte' de Pharmacie Paris XI, 92296 Cha^tenay-Malabry, France; and Molecular Oncology Group, McGill University, Montreal, Quebec, H3A 1A1, Canada

... with the genomatix suite (www.genomatix.de) and TSSW softwares (www.softberry.com). These analyses did not identify consensus TATA boxes in these 3 promoters. ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...


Lung Cancer
2007 Volume 57, Issue 2, Pages 143-151

Polymorphisms of cytosolic serine hydroxymethyltransferase and risk of lung cancer: A case–control analysis

L. Wang, J. Lu, J. An, Q. Shi, M. Spitz, Q. Wei
Department of Epidemiology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77230-1439, United States.

.. fcgi%3Fdb=Snp), of which two SNPs were found to be located in the SHMT1 promoter region as predicted by the online software TSSW (http://www.softberry.com/berry ...


Human Molecular Gene
2005 14(11):1465-1474; doi:10.1093/hmg/ddi156

Identification and characterization of a novel gene Saf transcribed from the opposite strand of Fas

Ming-De Yan et al.,
1Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC

... 1). After analysis with program TSSW (http://www.softberry.com), one promoter was predicted upstream of the transcription start site. ...


Genomics
Volume 86, Issue 4, October 2005, Pages 489-494

L3mbtl, the mouse orthologue of the imprinted L3MBTL, displays a complex pattern of alternative splicing and escapes genomic imprintingstar, open

Li et al.,
aDepartment of Haematology, Cambridge Institute for Medical Research, University of Cambridge, Hills Road, Cambridge CB2 2XY, UK bDepartment of Anatomy, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK

... which were predicted by promoter prediction programs including PROSCAN 1.7 (http://bimas.cit.nih.gov/molbio/proscan/) and TSSW (http://www.softberry.com/berry ...


J. Biol. Chem
Vol. 279, Issue 34, 35183-35192, August 20, 2004

STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes

Julia Travagli, Martine Letourneur, Jacques Bertoglio, and Josiane Pierre
From the INSERM U461, Faculte de pharmacie, 5 Rue J. B. Clement, 92296-Chatenay-Malabry, France

... The transcriptional start site was determined by computational analysis (TSSW using Softberry Software) and predicted to be located at nucleotide -16 from ...


Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223

GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis

ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.

... Consistent with this result, sequence analysis using TSSG and TSSW softwares ( http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...


Genomics
2004 Sep;84(3):577-86.

Cloning, genomic structure, and expression profiles of TULIP1 (GARNL1), a brain-expressed candidate gene for 14q13-linked neurological phenotypes, and its murine homologue

Schwarzbraun T et al.,
Institute of Medical Biology and Human Genetics, Medical University of Graz, Harrachgasse 21/8, A-8010 Graz, Austria.

... Putative promoter regions were detected from human and murine genomic sequences using the eukaryotic promoter prediction program TSSW from Softberry, Inc., http ...


Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297

Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene

Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA

... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms (http://www.softberry.com/berry.phtml) were initially employed. ...


3D-Match

Protein Science
Volume 19, Issue 3, pages 372–382, March 2010

Pyrroline-5-carboxylate synthase and proline biosynthesis: From osmotolerance to rare metabolic disease

Perez-Arellano, I., Carmona-Alvarez, F., Martinez, A. I., Rodriguez-Diaz, J. and Cervera, J
1. Molecular Recognition Laboratory. Centro de Investigacion Principe Felipe, Valencia, Spain 2. Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER-ISCIII), Valencia, Spain

... maritima (PDB ID 1O20) forms a tetramer made up of a dimer of dimers in which both the dimeric and the tetrameric contacts are extensive.35 These two 3D structures superim- pose with an RMSD of 1.8 A over 214 residues (pre- dicted by using 3D-Match by Softberry, Inc.) [Fig ... 


CYS_REC

Turkish Journal of Biology
2016, 40(3), p.623-633. .

Modeling of PrnD protein from Pseudomonas fluorescens RajNB11 and its comparative structural analysis with PrnD proteins expressed in Burkholderia and Serratia

SINGH, R. N., SINGH, R. P., SHARMA, A., & SAXENA, A. K.

... hydropathy (GRAVY) (Kyte and Doolittle, 1982). The sulfide bond pattern (SS) and linkages were predicted by the CYS_REC (http://linux1.softberry.com/ berry.phtml/topic) tool. PSIPRED v3.3 (http://bioinf. cs.ucl.ac.uk/psipred ...


Journal of Biotech Research [ISSN: 1944-3285]
2016, 7, 1-10.

Computational characterization and structure prediction of chitinase gene of beauveria bassiana using proteomic tools

Sood, S., Sandhu, S. S., Kumar, A. K., Gupta, A., Mukherjee, T. K.
1 Department of Biotechnology, Maharishi Markandeshwar University, Mullana , Ambala 133207, India. 2 Department of Biological Sciences, R. D. University, Jabalpur 482001, (MP) India.

... Disulphide linkages are important in functional characterization and bonds are predicted by the tool CYS_REC (http://sunI.softberry.com/berry.phtml?topic), which helps to identify the positions and total number of cysteines, and predicts the most probable "SS" bond pattern of ...


PloS one
2016, 11(1), e0145745. http://dx.doi.org/10.1371/journal.pone.0145745

Cloning and Expression of Phytase appA Gene from Shigella sp. CD2 in Pichia pastoris and Comparison of Properties with Recombinant Enzyme Expressed in E. coli.

Roy, M. P., Mazumdar, D., Dutta, S., Saha, S. P., Ghosh, S.
Department of Biotechnology, University of North Bengal, Siliguri, India

... The amino acid sequence encoded by the ORF was analyzed for the presence of signal peptide by SignalP 4.1 Server(http://www.cbs.dtu.dk/services/SignalP) [17] and for disulphide bond in the tertiary structure by using Softberry CYS_REC online services (www.softberry.com). ...


Applied biochemistry and biotechnology
2015, 176(3), 712-729. DOI: 10.1007/s12010-015-1606-2

1. Department of Animal Biotechnology, Faculty of Biotechnology, Jeju National University, Jeju Do, 690-756, Republic of Korea 2. Animal Genetic Resources Station, National Institute of Animal Science, Rural Development Administration, Namwon, Republic of Korea

Ghosh, M. et al.,
Department of Animal Biotechnology, Faculty of Biotechnology, Jeju National University

... The CYS_REC tool (www.?softberry.?com/?berry.?phtml??topic=?cys_?rec&? group=?programs&?subgroup=?propt) published by Softberry was used to predict the most probable SS bond pattern in the sequences [28]. ...


International Journal of Pharmaceutical Sciences and Research
2015, 6(4), 1727-1735. DOI: 10.13040/IJPSR.0975-8232.6(4).1727-35

COMPUTATIONAL MODELLING AND FUNCTIONAL CHARACTERIZATION OF HDAC-11

Samant, L. R., Sangar, V. C., Gulamaliwala, A., Chowdhary, A. S.
Systems Biomedicine Division 1, Department of Virology & Immunology 2, Haffkine Institute for Training, Research & Testing, Acharya Donde Marg, Parel, Mumbai - 400012. India.

... Functional characterization was computed using RaptorX, HMMTOP and SoftBerry Server's CYS_REC tool which predicted the secondary structure composition, presence of transmembrane proteins and the presence of cysteine residues respectively. Full Text. Keywords: ...


Asian Journal of Pharmaceutical & Clinical Research
Apr 2013 Supplement 2, Vol. 6, p265-268

SYNTHESIS AND MOLECULAR DOCKING STUDIES OF 2 CHOLROMETHYL-3-METHYL-1-PHENYL SULFONYL-1H-INDOLE COMPOUND

B., SARAVANAN; UPGADE, AKHILESH; BHASKAR, ANUSHA; V., MANIVANNAN

... The presence of SS bond and their bonding patterns were predicted by CYS_REC (16) and RASMOL server. CYS_REC (http://linux1.softberry.com/berry ... 23 283 16. CYS_REC.http://sun1. softberry.com/berry.phtml?topic=cys_rec &group=help &subgroup-propt. (27/10/2006) 17. ...


Structural Biology
Volume 2013 (2013), Article ID 370820, 10 pages http://dx.doi.org/10.1155/2013/370820

In Silico Characterization and Homology Modeling of a Cyanobacterial Phosphoenolpyruvate Carboxykinase Enzyme

Aubrey A. Smith and Amanda Caruso
Department of Biology, Montgomery College-Rockville Campus, 51 Mannakee Street, Rockville, MD 20850, USA

... disulfide patterns of each cyanobacterial PEPCK are tabulated in Table 3. The presence of disulfide bridges was analyzed using the CYS-REC tool which predicts the most probable bonding patterns between available cysteine residues (http://linux1.softberry.com/berry.phtml). ...


INT. J. BIOAUTOMATION,
2012, 16(4), 225-238 

In silico Characterization of Plant and Microbial Antifreeze Proteins

Md. Musharaf Hossain et al.,
Department of Genetic Engineering and Biotechnology Shahjalal University of Science and Technology Sylhet-3114, Bangladesh

... particular protein. The presence of SS bond and their bonding pairs were predicted by CYS_REC (http://linux1.softberry.com/berry phtml?topic) and “What If” server (identify SS bonds from 3D structure of a protein). The secondary ...


World Journal of Fish and Marine Sciences
5 (4): 426-429, 2013 DOI:10.5829/idosi.wjfms.2013.05.04.7427

Comparative in Silico Analysis of Mbl Homologues of Teleosts

Chirag Goel 1, Ashoktaru Barat 1, Veena Pande 2 and P.K. Sahoo 1
1 Molecular Genetics Laboratory, Directorate of Coldwater Fisheries Research (ICAR), Bhimtal-263136, Nainital, Uttarakhand, India 2 Department of Biotechnology, Kumaun University, Nainital, Uttarakhand, India

... test tube. There are certain dipeptides, the occurrence of structure (protein sequence data) by the tool CYS_REC which is significantly different in the unstable protein (http://sunI. softberry.com/ berry.phtml?topic). CYS_REC compared with those in the stable ones. This method ...


Bioinformation.
2013; 9(16): 802–807. DOI: 10.6026/97320630009802

in-silico characterization of b-(1, 3)-endoglucanase (ENGL1) from Aspergillus fumigatus by homology modeling and docking studies

Rizwan Ahmed, 1 Swatantra Kumar Jain, 2 and Praveen Kumar Shukla 1
1Medical Mycology lab, Division of Microbiology, CSIR-Central Drug Research Institute, Sitapur Road, Lucknow-226001, India 2Department of Biotechnology, Jamia Hamdard University, New Delhi, India

... Protein Topology prediction: Secondary structure of the protein ENGL1 from Aspergillus fumigatus was calculated with PSIPRED (http: //bioinf.cs.ucl.ac.uk/ psipred) and disulfide bonds were predicted by the Cys_REC tool (http://sunl.softberry.com/berry.phtml?topic). ...


Journal of PROTEINS AND PROTEOMICS
Vol 3, No 3 (2012)

IN SILICO CHARACTERIZATION OF BOVINE (BOS TAURUS) ANTIAPOPTOTIC PROTEINS

V G Vidhya, Akhilesh Upgade, Anusha Bhaskar, Dipanjana Deb
State

... RASMOL server. CYS_REC (http://linux1. softberry.com/berry.phtml) identified the position of a cysteine, total number of cystiene presented along with the most probable –SS- bond pairs in the protein sequences. The latter tool ...


Bioinformation
2013; 9(13): 680–684. DOI:10.6026/97320630009680

Insight from the structural molecular model of cytidylate kinase from Mycobacterium tuberculosis

Nitin Kumar Verma 1,2,* and Balwinder Singh 3
1Department of Bioscience, Shri Ram College, Muzaffarnagar 2Uttarakhand Technical University, Dehradun 3Department of Science, Ek Onkar Scholar Degree College, Shahbjnagar, Shahjahanpur

... The results are showing in Table 2 (see supplementary material). Functional characterization: CYC_REC (http://sunl.softberry.com/berry.phtml?topic) was used to locate “SS bond” between the pair of cystein residue, if present. ...


International Journal of Pharma & Bio Sciences
Jul-Sep2013, Vol. 4 Issue 3, pB-181-B-193. 13p.

IN SILICO CHARACTERIZATION OF HUMAN TYROSINASE USING COMPUTATIONAL TOOLS AND SERVERS

SEN GUPTA; PARTH SARTHI; BUDDHADEV MONDAL; BANDYOPADHYAY AMAL KUMAR

... Prot. Chem. 23 283 35. CYS_REC.http://sun1.softberry.com/berry.ph tml?topic= cys_rec&group=help&subgroup= propt. (27/10/2006) 36. Lambert C, Leonard N, De Bolle X and Depiereux E 2002 Bioinformatics 18 1250 37. Lovell. ...


INT.J. BIOAUTOMATION,
2012, 16(4), 225-238

In silico Characterization of Plant and Microbial Antifreeze Proteins

Hossain et al.,
Department of Genetic Engineering and Biotechnology Shahjalal University of Science and Technology Sylhet-3114, Bangladesh

... particular protein. The presence of SS bond and their bonding pairs were predicted by CYS_REC (http://linux1.softberry.com/berry phtml?topic) and “What If” server (identify SS bonds from 3D structure of a protein). The secondary ...


International Current Pharmaceutical Journal (ICPJ)
2012, Volume 1, Issue 2, pp 18-26 DOI

Fish antifreeze proteins: Computational analysis and physicochemical characterization

Md. Musharaf Hossain

.. Disulphide bonds are very essential in determining the functional linkage and the stability of a particular protein. The presence of SS bond and their bonding patterns were predicted by CYS_REC and What If server. CYS_REC (http://linux1.softberry.com/berry.phtml? ...


J Glob Infect Dis.
2012 Jan-Mar; 4(1): 43–54. doi: 10.4103/0974-777X.93761

Analyzing a Potential Drug Target N-Myristoyltransferase of Plasmodium falciparum Through In Silico Approaches

Amit Kumar Banerjee, Neelima Arora, and USN Murty
Bioinformatics Group, Biology Division, Indian Institute of Chemical Technology, Tarnaka, Uppal Road, Hyderabad, Andhra Pradesh, India

... of 0.05 and number of possible pseudomotifs predicted was kept 3. CYSREC (http://linux1.softberry.com/) was used to predict the cysteine pairing pattern. As some proteins are known to contain several unstructured or disordered ...


PLoS ONE
7(12): e50900. doi:10.1371/journal.pone.0050900

Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

Patnaik et al.,
Division of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju, South Korea

... and NetPhosK 1.0 server respectively [36]–[39]. Disulfide bonds were predicted by the Cys_REC tool (version 2.0) from Softberry (http://linux1.softberry.com/berry. phtml/). The superfamily and the conserved domains including ...


Bioinformation
8(17): 807-811 (2012)

Homology Modeling and Functional Characterization of PR-1a Protein of Hordeum vulgare subsp. Vulgare

Vahid Aslanzadeh 1 * & Mostafa Ghaderian 2, 3
1Department of Biotechnology, Research Institute of Physiology and Biotechnology, University of Zanjan, Zanjan, Iran; 2Department of Chemistry, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia;

... Protein was further subjected to CYS_REC program(http://linux1.softberry.com/berry. phtml?topic=cys_rec&gro up=programs&subgroup=propt) for locating SS-bonding states of cysteines and disulphide bridges in proteins, if present. ...


J Proteomics Bioinform
2012, 5:9 http://dx.doi.org/10.4172/jpb.1000238

Homology Modeling and Structural Analysis of NHX Antiporter of Leptochloa fusca (L.)

Panahi et al.,
1Department of Biotechnology and Plant Breeding, Ferdowsi University of Mashhad, Mashhad, Iran 2Department of Biotechnology, University of Isfahan, Iran

...CYS_REC (http://sunl.softberry.com/ berry.phtml?topic) was used to locate “SS bond” between the pair of cysteinee residues, if present. ...


IJPSR,
2012; Vol. 3(7): 2050-2056

IN-SILICO ANALYSIS AND HOMOLOGY MODELING OF TARGET PROTEINS FOR CLOSTRIDIUM BOTULINUM

Chirag Prajapati*1 and Chintan Bhagat 2
Department of Computer Science (Bioinformatics) 1, Department of Biotechnology 2, Veer Narmad South Gujarat University, Surat, Gujarat, India

... Disulphide bonds are important in determining functional linkages. Table 4 shows prediction of “SS” bonds using primary structure (protein sequence data) by tool CYS_REC http://linux1.softberry.com/berry.phtml?topic=cys_rec &group=programs&subgroup=propt. ...


Bioinformation
2011; 6(8): 315–319. PMCID: PMC3134781

Structure prediction and functional characterization of secondary metabolite proteins of Ocimum

Roy et al.,
Biotechnology Division, Central Institute of Medicinal and Aromatic Plants, (Council of Scientific and Industrial Research), Kukrail Picnik Spot Road, P.O. CIMAP, Lucknow - 226015, India

... protparam.html). The results are shown in (see Table 4). Functional characterization. CYS_REC (http://sunl.softberry.com/berry.phtml? topic) was used to locate “SS bond” between the pair of cystein residues, if present. The tool ...


Current Research Journal of Biological Sciences
3(1): 35-41, 2011 DOI:

Physiochemical, Functional and Structural Characterization of Wheat Germin Using In silico Methods

Vinita Hooda
Department of Botany, M.D. University, Rohtak -124001, Haryana, India

... For functional characterization disulfide bonds were predicted by the Cys_REC tool from softberry, secondary structures were calculated with SOPMA (Self Optimized Prediction Method with Alignment) (Geourjon and Deleage, 1995). ...


Journal of Applied Sciences in Environmental Sanitation
Volume 6, Number 3: 357-366, September, 2011

Structural Analysis and 3D-Modelling of Fur Protein from Bradyrhizobium japonicum

Singh et al.,
1National Bureau of Agriculturally Important Microorganisms (ICAR), Kushmaur, Kaithauli, Mau Nath Bhanjan, Uttar Pradesh-275101, India. 2Department of Botany and Microbiology, Gurukul Kangri University, Haridwar, Uttrakhand-249404, India.

... The sulphide (SS) bond pattern is predicted by using the tool CYS_REC (http://linux1.softberry.com/berry.phtml?topic), has shown that fur protein has three cysteine residues at position 19, 53 and 141, and have no SS bonding. ...


POJ
4(7):354-363 (2011)

In silico approaches in comparative genomics, structure prediction and functional characterization of secondary metabolite proteins of Mentha sp

Roy et al.,
1Biotechnology Division, Central Institute of Medicinal and Aromatic Plants, Council of Scientific and Industrial Research, Lucknow - 226015, India 2 IIDS Center of Bioinformatics, Nehru Science Center, University of Allahabad, Allahabad - 211001, India

... Disulphide bridges were find using Cys_REC tool from softberry (Table 7). Domain and fold recognition ... Functional characterization of disulfide bonds present in secondary metabolite proteins of Mentha species were done by Cys_REC tool from Softberry. Page 9. 362 ...


Journal of Applied Sciences in Environmental Sanitation
2011, 6 (4): 485-494.

Homology Modeling and Sequence Analysis of a Highly Thermostable Endo-(1,4)-Beta-Mannase from the Marine Bacterium Rhodothermus Marinus.

ZRaghvendra Pratap Singh, Alok R. Rai, Kunal Roychoudhury and R.C. Dubey .
1Department of Botany and Microbiology, Gurukul Kangri University, Haridwar, Uttrakhand-249404, India 2Department of Microbiology, Seth Kesarimal Porwal College, Kamptee Maharashtra 441002, India

... The sulphide (SS) bond pattern is predicted by employing the tool CYS_REC (http://linux1.softberry.com/berry.phtml?topic), has shown that 1,4-?-D-mannanase protein has three cysteines residues at position 255,265 have no SS bonding. ...


J Proteomics Bioinform
2010 Volume:3 Issue:5 pp. 148-154 doi:10.4172/jpb.1000134

In silico Analysis and Homology Modelling of Antioxidant Proteins of Spinach

Archna Sahay ; Madhvi Shakya
1 Department of Bioinformatics, MANIT, Bhopal-462051 M.P., India 2 Department of Mathematics, MANIT, Bhopal-462051, M.P., India

... Journal of Proteomics & Bioinformatics - Open Access www.omicsonline.com CYS_REC (http://sunI.softberry.com/berry.phtml?topic). CYS_REC identifies the position of cysteins, total number of cysteins present and pattern, if present, of pairs in the protein sequence. ... 


Asian J. Exp. Sci.,
Vol. 22, No. 3, 2008; 265-274

In silico Characterization of Silk Fibroin Protein using Computational Tools and Servers

K.V. Ashokan and M.M. Pillai
Department of Biological Science, P.V.P College, K. Mahnakl, Sangli - 416405 (Maharashtra); India. Department of Biotechnology, KIT’s College of Engineering, Gokul Shirgaon, Kolhapur (Maharashtra); India.

... using CLC free workbench tool Page 4. 268 CYS_REC (http://sunI.softberry. com/ berry.phtml?topic). CYS_REC identifies the position of ...


J. Chem. Sci.,
Vol. 119, No. 5, September 2007, pp. 571–579.

In silico characterization of antifreeze proteins using computational tools and servers

K SIVAKUMAR, S BALAJI and GANGARADHAKRISHNAN
1Department of Chemistry, Sri Chandrasekharendra Saraswathi Viswa Maha Vidyalaya (Deemed University), Enathur, Kanchipuram 631 561 2EXCEL and Polymer Science Labs, Central Leather Research Institute, Adyar, Chennai 600 020

... CYS_REC identifies the positions of cysteines, total number of cysteines present and predicts the most probable SS bond pattern of pairs in the protein sequence. ...


GetAtoms

Cambridge University Press
2006

Essential Bioinformatics

J Xiong

... 9. Perform comprehensive homology modeling using the GetAtoms server (www.softberry. com/berry.phtml?topic=getatoms&group=programs& subgroup=propt). 10. ...


NNSSP

Plant Physiology
132:1391-1404 (2003)

Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation

Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)

... of the sequence structure was derived by using three software programs for amino acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...


Pdisorder

BMC Bioinformatics
2012, 13:153 doi:10.1186/1471-2105-13-153

Molecular evolution of dihydrouridine synthases

Joanna M Kasprzak 2, Anna Czerwoniec 2 and Janusz M Bujnicki 1,2
1 Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Trojdena 4, PL-02-109, Warsaw, Poland 2 Institute of Molecular Biology and Biotechnology, Adam Mickiewicz University, Umultowska 89, PL-61-614, Poznan, Poland

... residues were made using MetaDisorder (http://iimcb.genesilico.pl/metadisorder/ webcite; [40], a meta-method which combines the predictions of the following primary methods: DisEMBL [41], DISPROT(VSL2) [42], GlobPlot [43], IUPred [44], PDISORDER (SoftBerry, http://linux1 ...


Molecular Genetics and Genomics
January 2012, Volume 287, Issue 1, pp 39-54

Molecular characterization and functional analysis by heterologous expression in E. coli under diverse abiotic stresses for OsLEA5, the atypical hydrophobic LEA protein from Oryza sativa L.

Shuai He et al.,
1. Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing, 400044, China

... Secondary structure predictions were run with the DSSP, PSIPRED (http:// www.ibi.vu.nl/ programs) (Jones 1999; Kabsch and Sander 1983), PDISORDER (http://linux1.softberry.com), and DisEMBL (http://dis.embl.de/) programs (Linding et al. 2003). ...


Applied Biochemistry and Biotechnology
January 2012, Volume 166, Issue 1, pp 222-233 10.1007/s12010-011-9418-5

Molecular Analysis of OsLEA4 and Its Contributions to Improve E. coli Viability

Tingzhang Hu et al.,
1. Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing, 400044, People’s Republic of China 2. School of Life Science and Engineering, Chongqing Three Gorges University, Chongqing, 404100, People’s Republic of China

... InterProScan/). Secondary structure predictions were run with the DSSP, PSIPRED (http://www.ibi.vu.nl/programs) [20, 21], PDISORDER (http://linux1.softberry.com), and DisEMBL (http://dis.embl.de/) programs [22]. Analysis ...


The EMBO Journal
2007, 26, 5071-5082, doi:10.1038/sj.emboj.7601916
A conserved function for a Caenorhabditis elegans Com1/Sae2/CtIP protein homolog in meiotic recombination

A. Penkner et al.,
1 Department of Chromosome Biology and Max F. Perutz Laboratories, Center for Molecular Biology, University of Vienna, Vienna, Austria 2 Developmental Genetics, TU Braunschweig, Germany 3 Bioinformatics Group, Research Institute of Molecular Pathology, Vienna, Austria


... They are mostly disordered and low-complex (Pdisorder; www.softberry.com) except for the C-terminal 70-100 aa corresponding to the region of highest sequence ...


BMC Bioinformatics
2005, 6:22 doi:10.1186/1471-2105-6-22

Research article Open Access
Proteins with two SUMO-like domains in chromatin-associated complexes: The RENi (Rad60-Esc2-NIP45) family

Maria Novatchkova*1, Andreas Bachmair3, Birgit Eisenhaber2 and Frank Eisenhaber2
Address: 1Gregor Mendel-Institut GMI, Austrian Academy of Sciences, Vienna Biocenter, A-1030 Vienna, Austria, 2Research Institute of Molecular Pathology, Dr. Bohr-Gasse 7, A-1030 Vienna, Austria and 3Max Planck Institute for Plant Breeding Research, Carl-von-Linne-Weg 10, D-50829 Cologne, Germany


...Initial analysis of its sequence complexity shows that the disordered N-terminal half of the protein is followed by a likely globular segment (predicted using Pdisorder by Softberry, Inc)...


PSSFinder

Frontiers in plant science
2014, 5: 26. DOI:10.3389/fpls.2014.00026

Plant 4/1 protein: potential player in intracellular, cell-to-cell and long-distance signaling

Morozov S. Y. et al.,
1 A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia 2 Department of Virology, Faculty of Biology, Moscow State University, Moscow, Russia

... PHYSICO-CHEMICAL PROPERTIES OF 4/1 PROTEIN. The Nt-4/1 protein is predicted by PSSFinder (Soli et al., 2009) (http://linux1.softberry.com/berry.phtml) to form six long alpha-helices and two short beta-sheet structures. ...


Australian Journal of Grape and Wine Research
Volume 19, Issue 2, pages 193–207, June 2013 DOI:10.1111/ajgw.12029

Polymorphisms in VvPel associate with variation in berry texture and bunch size in the grapevine

Vargas, A.M., Fajardo, C., Borrego, J., De Andres, M.T. and Ibanez, J.
1Instituto Madrileno de Investigacion y Desarrollo Rural, Agrario y Alimentario (IMIDRA), Alcala de Henares, Madrid, Spain 2Instituto de Ciencias de la Vid y del Vino (CSIC, Gobierno de La Rioja, Universidad de La Rioja), Complejo Cientifico Tecnologico, Logrono, Spain

... Prediction of secondary structure. The amino acid sequence for each haplotype was obtained, and secondary structure was predicted by means of the software PSSFinder, both implemented in Softberry, Inc. (NY, USA; http://linux1.softberry.com/berry.phtml). ...


Biochimie
Volume 95, Issue 7, July 2013, Pages 1360–1370 DOI:10.1016/j.biochi.2013.02.015

Subcellular localization and self-interaction of plant-specific Nt-4/1 protein

Solovyev A.G. et al.,
a A.N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Chochlova Str. 1, 119992 Moscow, Russia b M.M. Shemyakin & Yu.A. Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, 16/10 Miklukho-Maklaya Str., Moscow 117997, Russia

... 2) [6]. Predictions of the protein secondary structure carried out for Nt-4/1-CC-II using SSP and PSSFinder prediction methods available at the SoftBerry website (http://linux1.softberry.com/berry. phtml) revealed that the Pro residues introduced in Nt-4/1-CC-II precluded formation ...


Biochimie
Volume 93, Issue 10, October 2011, Pages 1770–1778 DOI: 10.1016/j.biochi.2011.06.018

Orthologues of a plant-specific At-4/1 gene in the genus Nicotiana and the structural properties of bacterially expressed 4/1 protein

Makarova et al.,
a Department of Virology, Biological Faculty, Moscow State University, Moscow 119992, Russia b M. M. Shemyakin and Yu. A. Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, 16/10 Miklukho-Maklaya Str., Moscow 117997, Russia

... For computer-assisted secondary structure prediction, the PSSFinder server (http://linux1.softberry. com/berry.phtml) [20], the PCOIL server (http://toolkit.tuebingen.mpg.de/pcoils) [21] and [22] and the MARCOIL server (http://www.isrec.isb-sib.ch/webmarcoil/webmarcoilC1.html ...


BMC Pharmacology
2009, 9:4doi:10.1186/1471-2210-9-4

Bioinformatics’ characterizations and prediction of K+ and Na+ ion channels effector toxins

Rima Soli 1, a, Belhassen Kaabi 1, a, *, Mourad Barhoumi 1, Mohamed El-Ayeb2 , and Najet Srairi-Abid 2
1) Laboratory of Epidemiology and Ecology of Parasites, Institut Pasteur de Tunis, Tunis, Tunisia. (2) Laboratory of Venom and Toxins, Institut Pasteur de Tunis, Tunis, Tunisia

... The 2D structure of all the sequences (training and test datasets) was determined based on the program PHD [36-38] using neural network approach, and the Softberry's software PSSfinder [39], which uses Markov chains probabilistic model. Phylogenetic analysis ...


BMC Molecular Biology
2008, 9:88 doi:10.1186/1471-2199-9-88

Computational modeling and in silico analysis of differential regulation of myo-inositol catabolic enzymes in Cryptococcus neoformans

Emalee A Mackenzie and Lisa S Klig
1Life Sciences Department, Irvine Valley College, Irvine, CA, USA and 2Department of Biological Sciences, California State University, Long Beach, CA, USA

... 35. PSSFinder [http://www.softberry.ru/berry.phtml?topic=pps&group=programs&subgroup =propt] 36. SAM_T02 [http://www.softberry.com/all.htm] 37. ...


SSPAL

Plant Physiology
132:1391-1404 (2003)

Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation

Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)

... of the sequence structure was derived by using three software programs for amino acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...


SSP

Molecular Plant Pathology
Volume 9 Issue 4 Page 511-523, July 2008

Natural variation reveals key amino acids in a downy mildew effector that alters recognition specificity by an Arabidopsis resistance gene

REBECCA L. ALLEN et al.,
Warwick HRI, Warwick University, Wellesbourne, Warwick CV35 9EF, UK Department of Evolutionary Biology, University of Munich, Gro?haderner Str. 2, 82152 Planegg-Martinsried, Germany

... html). Prediction of alpha helix was by the SSP program (http://softberry. com/berry.phtml?topic=sspgroup=programssubgroup=propt). ...


Plant Physiology
132:1391-1404 (2003)

Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation

Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)

... of the sequence structure was derived by using three software programs for amino acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...


FindTerm

Current microbiology
2016, 72(3), 235-241. DOI: 10.1007/s00284-015-0935-2

Isolation and Comparative Genomic Analysis of T1-Like Shigella Bacteriophage pSf-2

Jun, J. W. et al.,
1. College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, South Korea 2. Departments of Rheumatology, Bundang Jesaeng Hospital, Seongnam, 463-774, South Korea

... html) (mini- mum promoter score: 0.9). Rho-independent transcription terminators were identified using FindTerm programs (http://www.softberry.com) (energy threshold value: -11). Additional characteristics of the putative protein ...


Toxins
2016, 8(4), 113. doi:10.3390/toxins8040113

Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa

Li, G. et al.,
Department of Microbiology, Third Military Medical University, Chongqing 400038, China

... The putative promoter and terminator were predicted by BPROM (http://linux1.softberry.com/berry. phtml) and FindTerm (http://www.softberry.com/berry.phtml?topic=findterm&group= programs&subgroup=gfindb), respectively. 4.3. DNA Extraction, RNA Purification and RT-PCR. ...


Frontiers in microbiology
2016, 7: 545. doi: 10.3389/fmicb.2016.00545

Genomics of three new bacteriophages useful in the biocontrol of Salmonella

Bardina, C. et al.,
Departament de Genetica i de Microbiologia, Molecular Microbiology, Universitat Autonoma de Barcelona, Barcelona, Spain

... Potential promoter regions and transcription terminators were predicted using the Softberry programs BProm (http://linux1.softberry.com/berry.phtml), FindTerm (Solovyev and Salamov, 2011), and TransTerm (Ermolaeva et al., 2000). ...


Microbiology
April 2013 vol. 159 no. Pt 4 665-677 DOI:10.1099/mic.0.063396-0

The regulatory mechanism of 2,4,6-trichlorophenol catabolic operon expression by HadR in Ralstonia pickettii DTP0602

Torii et al.,
1Department of System Science, Graduate School of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan 2Department of Biomedical Engineering, Faculty of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan

... The rho-independent terminator was predicted with FindTerm (Softberry; http://linux1. softberry.com/berry.phtml). ... The presence of rho-independent terminator in the R1 and R10 regions was sought using FindTerm (Softberry), but not located. ...


Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


Antonie van Leeuwenhoek
Volume 104, Issue 6 , pp 941-948 DOI:10.1007/s10482-013-0013-3

An Lrp-type transcriptional regulator controls expression of the Bacillus subtilis chromate transporter

Aguilar-Barajas et al.,
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Mich., Mexico 3. Genomica Alimentaria, Universidad de la Cienega, Sahuayo, Mich., Mexico 2. Depto. Bioquimica, Facultad de Medicina, Universidad Nacional Autonoma de Mexico, Mexico, D.F., Mexico

... bin/seq_tools/promoter.pl). Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc., New York, NY, USA). Cloning of the ywrC-chr3N-chr3C gene cluster. The ywrC-chr3N-chr3C gene ...


Microbiology
November 2013 mic.0.073783-0 DOI:10.1099/mic.0.073783-0

Expression of the Six CHR Chromate Ion Transporter Homologues of Burkholderia xenovorans LB400

Acosta-Navarrete et al.,
1 Universidad Michoacana; 2 Laboratorio Estatal de Salud Publica

... Putative promoter sequences were identified employing PromScan software 109 (http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators were 110 searched using the program FindTerm (Softberry Inc.). 111 112 Bacterial growth and susceptibility tests ...


Microbiology
April 2013 vol. 159 no. Pt 4 691-700 DOI:10.1099/mic.0.064741-0

A Q-like transcription factor regulates biofilm development in Escherichia coli by controlling expression of the DLP12 lysis cassette

Karl-Gustav Rueggeberg 1, Faustino A. Toba 1, Mitchell G. Thompson 1, Bryan R. Campbell 1 and Anthony G. Hay 1,2
1Department of Microbiology, Cornell University, Ithaca, NY 14853, USA 2Institute for Comparative and Environmental Toxicology, Cornell University, Ithaca, NY 14853, USA

... Antiterminator predictions. essDp sequence encompassing 400 bp upstream of the translation start site was analysed for the presence of putative Rho-independent transcriptional terminators using FindTerm software from Softberry (Hagen et al., 2010). ...


Research in Microbiology
Volume 164, Issue 10, December 2013, Pages 979–986 DOI:10.1016/j.resmic.2013.08.007

Characterization and complete genome sequence of the Shigella bacteriophage pSf-1

Jun et al.,
a Laboratory of Aquatic Biomedicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 151-742, Republic of Korea b Korea Institute of Ocean Science & Technology, Ansan 426-744, Republic of Korea

... promoter.html) (minimum promoter score: 0.9). Rho-independent transcription terminators were identified using FindTerm programs (http://www.softberry.ru) (energy threshold value: ?11). Additional characteristics of the putative ...


Microbiology
May 2013 mic.0.063776-0 DOI:10.1099/mic.0.063776-0

Isolation, characterization and complete genome sequence of PhaxI: a phage of Escherichia coli O157:H7

Shahrbabak et al.,
1 Tehran University of Medical Sciences; 2 University of Helsinki; 3 Laval University

... 2004; Schattner et al., 2005). To find Rho-independent terminators, TransTerm 230 (Ermolaeva et al., 2000) and FindTerm (SoftBerry) were used. PHIRE was also used 231 to find phage regulatory elements (Lavigne et al., 2004). The genomic map was 232 ...


Current Microbiology
Volume 66, Issue 6 , pp 535-543 DOI:10.1007/s00284-013-0308-7

Characterization and Genome Sequencing of Phage Abp1, a New phiKMV-Like Virus Infecting Multidrug-Resistant Acinetobacter baumannii

Huang et al.,
1. Department of Microbiology, Third Military Medical University, Chongqing, 400038, China 2. Institute of Burn Research, Southwest Hospital, Third Military Medical University, Chongqing, China

... Bacte- riophage-specific promoters were determined using Neural Network Promoter Prediction [29] and PHIRE [30]. Tran- scriptional termination sites were determined using the FindTerm program (http://www.softberry.ru/berry.phtml). ...


PloS one
(2013). 8(5), e62933. DOI:10.1371/journal.pone.0062933

Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages

Lu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, China

...Predicted promoter regions were identified using neural network promoter prediction [51], and putative terminator structures were identified using the web tool FindTerm (http://linux1.softberry.com/berry.phtml)....


BMC genomics
(2013). 14(1), 849. DOI:10.1186/1471-2164-14-849

The Clostridium small RNome that responds to stress: the paradigm and importance of toxic metabolite stress in C. acetobutylicum

Venkataramanan et al.,
1 Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE, USA 2 Delaware Biotechnology Institute, University of Delaware, Newark, DE, USA

...Rho independent terminators were predicted using RNAmotif [90], Erpin [91] and Findterm (http://www.softberry.com webcite). ...


World Journal of Microbiology and Biotechnology
Volume 28, Issue 3 , pp 865-869 DOI 10.1007/s11274-011-0883-3

The ChrA homologue from a sulfur-regulated gene cluster in cyanobacterial plasmid pANL confers chromate resistance

Esther Aguilar-Barajas (1) (2) Paulina Jeronimo-Rodriguez (1) Martha I. Ramirez-Diaz (1) Christopher Rensing (2) Carlos Cervantes (1)
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Michoacan, Mexico 2. Department of Soil, Water, and Environmental Science, University of Arizona, Tucson, AZ, USA

... Promoter sequences were searched with the Neural Network Promoter Predic- tion (http://www.fruitfly.org/cgi-bin/seq_tools/promoter.pl software. Rho-independent terminators were predicted with the FindTerm (Softberry Inc.) program. ...


Archives of Virology
Volume 157, Issue 2 , pp 391-395 DOI 10.1007/s00705-011-1175-9

Complete genomic sequence of a T4-like bacteriophage, phiAS4, infecting Aeromonas salmonicida subsp. salmonicida

J. H. Kim et al.,
1. Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, Korea 2. Basic Science Institute for Cell Damage Control, Sogang University, Seoul, 121-742, Korea

... 13]. Rho-independent transcription terminators were also pre- dicted using the FindTerm program (http://www.softberry.ru/ berry.phtml?topic=findterm&group= programs&subgroup= gfindb) (energy threshold value: -11). Additional ...


BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain 2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain

... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...


Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002

IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany 2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile

... to GenBank sequences. Additional searches for genes, operons, promoters, and terminators were done using FGENESB, BPROM, and FindTerm at www.softberry. com (Softberry, Mount Kisco, NY, USA). The sequence data ...


PLoS ONE
7(5): e38283. (2012) doi:10.1371/journal.pone.0038283

Molecular Characterization of Podoviral Bacteriophages Virulent for Clostridium perfringens and Their Comparison with Members of the Picovirinae.

Volozhantsev NV et al.,
1 State Research Center for Applied Microbiology and Biotechnology, Obolensk, Moscow region, Russian Federation, 2 Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, Athens, Georgia, United States of America,

...Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.gatech.edu/GeneMark) [73] and SoftBerry FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs. ... Putative promoters were analyzed by using Martin Reese's neural network prediction program at http://www.fruitfly.org/seq_tools/promot?er.html and BPROM (Softberry, Inc., Mount Kisco, NY, USA) at its website http://linux1.softberry.com/berry.phtml. Potential transcriptional terminators were assessed using the software programs TransTerm at the Nano+Bio-Center (http://nbc3.biologie.uni-kl.de) and FindTerm (Softberry, Inc., Mount Kisco, NY, USA) at the web site http://linux1.softberry.com/berry.phtml. ...


Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002

Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes

M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico

... Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc.). ... Search for genomic islands was made using CpG finger program from Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...


RNA Biology
Volume 8, Issue 1 January/February 2011 Pages 11 - 13 DOI: 10.4161/rna.8.1.13346

ARNold: A web tool for the prediction of Rho-independent transcription terminators

Magali Naville, Adrien Ghuillot-Gaudeffroy, Antonin Marchais and Daniel Gautheret
Univ. Paris-Sud, Institut de Genetique et Microbiologie, Orsay Cedex, France

... search to intergenic regions, which makes it unfit for certain applications, including detection of transcriptional attenuators that occur after gene starts. Other available tools include com- mercial programs such as Softberry's Findterm (www.softberry. ...


Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142

Complete genome sequence of the lytic Pseudomonas fluorescens phage fjIBB-PF7A

Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga, Portugal

... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/ tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly. org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ... ...Terminators were predicted using FindTerm http://linux1.softberry. com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...


Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050

The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay

Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening of serotype-specific gene. Cross-hybridization experiments ...


FEMS Microbiology Letters
(2011), 324: 117–124. doi: 10.1111/j.1574-6968.2011.02394.x

Genetic analysis of the capsular polysaccharide synthesis locus in 15 Streptococcus suis serotypes.

Wang, K., Fan, W., Cai, L., Huang, B. and Lu, C.
1Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, China 2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Sequence annotation and bioinformatic analysis. The promoters and terminators of the sequenced cps locus were predicted using the bprom and findterm program (http://linux1.softberry.com/berry. phtml), respectively. ORFs were analyzed using the vectornt? program. ...


International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019

Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus

Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... Presence of putative promoters, terminators and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter. html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...


BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198

Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny

Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden

... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70- promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...


Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166

Antisense RNA associated with biological regulation of a restriction–modification system

Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences

... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator prediction were performed using the BPROM and FindTerm software, respectively (http://www.softberry.com/all.htm). RNA secondary structure ...


Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921

The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1

YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture

... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the & independent terminators were predicted using the BPROM and the FindTerm program respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...


J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11

A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550

Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland 2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy

... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique terminator region downstream of TTHA1327 were identified using BPROM and FindTerm (Softberry), respectively. Those findings showed that ...


PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108

Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence

Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611

...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the BProm and TermFind/RNAFold programs (Softberry)....


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...


Plasmid
Volume 63, Issue 2, March 2010, Pages 108-117

Sequence analysis of plasmid pIR52-1 from Lactobacillus helveticus R0052 and investigation of its origin of replication

Hagen et al.,
a Department of Research and Development, Institut Rosell Inc., 6100 Avenue Royalmount, Montreal, Que., Canada H4P 2R2 b Department of Biology, Utah State University, Logan, UT 84322-5305, USA

... To predict the presence of rho-independent terminators, the Softberry FindTerm program (version 2.8) was used (http://www.softberry.ru/berry.phtml?group=programs&subgroup= gfindb&topic=findterm). 2.7. Analysis of repA genes for repeat sequences. ... 


Journal of Bacteriology
October 2010, p. 5441-5453, Vol. 192, No. 20 doi:10.1128/JB.00709-10

Brochothrix thermosphacta Bacteriophages Feature Heterogeneous and Highly Mosaic Genomes and Utilize Unique Prophage Insertion Sites

Samuel Kilcher, Martin J. Loessner, and Jochen Klumpp
Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland

... Rho-independent bacterial transcription terminators were predicted by using Softberry FindTerm (http://www.softberry.ru/berry.phtml?topic=findterm&group=programs&subgroup= gfindb) using an energy threshold value of –11 (default setting). ... 


Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10

Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9

Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2

... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc., 234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator 236 sequences using BPROM and FindTerm programs (Softberry Inc.). ... 


Genomics
Volume 96, Issue 3, September 2010, Pages 167-172 doi:10.1016/j.ygeno.2010.06.001

Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii

Zhu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing 400038, China

... Bacteriophage-specific promoters were determined using Neural Network Promoter Prediction [32] and PHIRE [33]. Transcrptional termination sites were determined using FindTerm programs (http://www.softberry.ru/berry.phtml). ...


Microbiology
156 (2010), 2305-2315; DOI 10.1099/mic.0.038760-0

Detection and quantification of intergenic transcription in Mycoplasma hyopneumoniae

Stuart W. Gardner 1,2 and F. Chris Minion 1
1 Department of Veterinary Microbiology and Preventive Medicine, Interdepartmental Microbiology Program, Iowa State University, Ames, IA 50011, USA 2 Department of Statistics, Iowa State University, Ames, IA 50011, USA

... To identify stem–loop structures in the ig-072, ig-106, ig-282, ig-682 and ig-684 IG regions, SoftBerry FindTerm software was used. Heat-shock experimental design and data analysis. ... putative stem–loop structure as predicted by SoftBerry FindTerm software. ... 


BMC Microbiology
2010, 10:301doi:10.1186/1471-2180-10-301

Characterization of JG024, a pseudomonas aeruginosa PB1-like broad host range phage under simulated infection conditions

Garbe et al.,
1 Institute of Microbiology, Technische Universitat Braunschweig, Spielmannstr. 7, 38106 Braunschweig, Germany 2 DSMZ, German Collection of Microorganisms and Cell Cultures, Inhoffenstr. 7B, 38124 Braunschweig, Germany

... Two promoter regions were identified in this way. Rho-independent terminator structures were identified using the TransTerm [46] and FindTerm (Softberry, Inc.) software tools. The program MEME was used for identification of conserved intergenic motifs in phage JG024 [47]. ...


Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010

Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1 predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...


Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035

Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...


BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153

Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13

Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland

... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map of ICEclc was designed from SeqBuilder of the Lasergene software package ...


Food Microbiology
Volume 26, Issue 1, February 2009, Pages 52-57

Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis

Emmanuel Coton and Monika Coton
aADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France

... Prokaryotic promoter prediction was performed using the Internet site http://www.fruitfly.org/ seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm program at http://www.softberry.ru. 3. Results and discussion. 3.1. ...


Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080

Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing

Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA

... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table 2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...


Research in Microbiology
Volume 160, Issue 6, July-August 2009, Pages 401-408

Characterization of salivaricin CRL 1328, a two-peptide bacteriocin produced by Lactobacillus salivarius CRL 1328 isolated from the human vagina

Esteban Vera Pingitore, Elvira Maria Hebert, Maria Elena Nader-Macias and Fernando Sesma
aCentro de Referencia para Lactobacilos (CERELA–CONICET), Chacabuco 145 (T4000ILC), San Miguel de Tucuman, Tucuman, Argentina

... The presence of putative promoter elements was predicted by Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html). Transcriptional terminators were predicted with the FindTerm algorithm (http://www.softberry.ru/berry.phtml). ...


Journal of Bacteriology
February 2009, p. 1056-1065, Vol. 191, No. 3

Transcription of clpP Is Enhanced by a Unique Tandem Repeat Sequence in Streptococcus mutans

Jiaqin Zhang 1,2, Anirban Banerjee 1, and Indranil Biswas 1*
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160,1 Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong 250012, China2

... 55). The intergenic region between clpP and SMU.1671, which is 115 bp long, encodes a putative -independent terminator located between bp 85 and 109 that was identified by the FindTerm program (Softberry, Inc.). Figure ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


Journal of Bacteriology
doi:10.1128/JB.01436-08 JB Accepts, published online ahead of print on 1 December 2008

Transcription of clpP is enhanced by a unique tandem repeat sequence in Streptococcus mutans

Jiaqin Zhang, Anirban Banerjee, and Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160; Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong, 250012, P R China

... encodes a putative ?-independent terminator located between 85- and 109-bp that was identified 18 by FindTerm program (Softberry Inc.). 19 ...


Food Microbiology
doi:10.1016/j.fm.2008.07.009

Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis

Emmanuel Coton and Monika Coton
ADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France

... site http://www.fruitfly.org/seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm program at http://www.softberry.ru. ...


Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0

Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes

Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry. com), were used for operon and gene predictions. RESULTS. ...


Nucleic Acids Research
doi:10.1093/nar/gkm836 published online on October 16, 2007

Characterization of bacterial operons consisting of two tubulins and a kinesin-like gene by the novel Two-Step Gene Walking method

Martin Pilhofer et al.,
Lehrstuhl fur Mikrobiologie, Technical University Munich, Am Hochanger 4, D-85354 Freising, Germany

... The prediction of Rho-independent terminators was performed with the program FindTerm (www.softberry.com/berry.phtml?topic=findterm&group=programs&subgroup ...


Microbiology
153 (2007), 2148-2158;

ss-Dependent carbon-starvation induction of pbpG (PBP 7) is required for the starvation-stress response in Salmonella enterica serovar Typhimurium

William J. Kenyon et al.,
Department of Biomedical Sciences, University of South Alabama, Mobile, AL 36688, USA

... Relevant nucleotide sequences were retrieved using the NCBI's Entrez server. Bacterial terminator analysis was done using FindTerm (http://www.softberry.com/). ...


Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54

Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520

Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China

... Promoter and terminator predictions were performed using BPROM and FindTerm, respectively (http://www.softberry.com/berry.phtml). ...


Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753

Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture

Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States

... the sequences for bacterial promoters and rho-independent transcription termination sites was performed using BPROM and FindTerm, available at www.softberry.com ...


Journal of Bacteriology,
June 2006, p. 4362-4372, Vol. 188, No. 12

Characterization of a Novel Partition System Encoded by the d and w Genes from the Streptococcal Plasmid pSM19035

Micha Dmowski,* Izabela Sitkiewicz, and Piotr Cegowski
Department of Microbial Biochemistry, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawiskiego 5A, 02-106 Warsaw, Poland

... Despite the presence of a putative rho-independent terminator (FindTerm; Softberry) (positions 6281 to 6337 in pBT233), we wanted to confirm that and ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


Journal of Bacteriology,
January 2006, p. 160-168, Vol. 188, No. 1

Identification of the syr-syp Box in the Promoter Regions of Genes Dedicated to Syringomycin and Syringopeptin Production by Pseudomonas syringae pv. syringae B301D

Nian Wang,1, Shi-En Lu,1, Qingwu Yang,2 Sing-Hoi Sze,3 and Dennis C. Gross1*
Department of Plant Pathology and Microbiology,1 Department of Computer Science,2 Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 778433

... typical rho-independent terminators, located after the syrP-syrD-sypA-sypB operon and the syrC gene, were identified by the FindTerm program (Softberry) (Fig. ...


Journal of Bacteriology,
January 2006, p. 202-210, Vol. 188, No. 1

Reconstruction and Regulation of the Central Catabolic Pathway in the Thermophilic Propionate-Oxidizing Syntroph Pelotomaculum thermopropionicum

Tomoyuki Kosaka,1 Taku Uchiyama,1 Shun-ichi Ishii,1 Miho Enoki,1,2 Hiroyuki Imachi,3 Yoichi Kamagata,2 Akiyoshi Ohashi,3 Hideki Harada,3 Hiroshi Ikenaga,1 and Kazuya Watanabe1*
Laboratory of Applied Microbiology, Marine Biotechnology Institute, Kamaishi, Iwate 026-0001,1 Japan3

... were manually checked. Terminator sequences were analyzed using the FindTerm program (SoftBerry). Molecular weights and isoelectric ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis

Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


BestPal

Genetica
Volume 131, Number 3 / November 2007 p. 255-265

Isolation, gene structure, and comparative analysis of the S-layer gene sslA of Sporosarcina ureae ATCC 13881

Pavel M. Ryzhkov, , Kai Ostermann and Gerhard Rodel
Institut fu"r Genetik, Technische Universita"t Dresden, Helmholtzstr. 10, 01062 Dresden, Germany

... sequences and promoter regions were identified by means of BestPal and Bprom programs from ''SoftBerry'' software package (http://www.softberry.com). ...


FoldRNA

PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709

The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae

Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain

...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...


PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108

Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence

Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611

...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the BProm and TermFind/RNAFold programs (Softberry)....


Nature Protocols
ISSN 1750-2799 2009 DOI: 10.1038/nprot.2009.15

Efficient in silico Designing of Oligonucleotides for Artificial Gene Synthesis.

Garg, Abhishek D.
Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom

... 1. DNA mfold v.3.2 URL: http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi. 2. FoldRNA URL: http://www.softberry.com/berry.phtml?topic=foldrna&group=programs&subgroup= rnastruct. 3. Gene Design ?2.0 URL: http://baderlab.bme.jhu.edu/gd/. ...


FindMiRNA

Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020

Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles

da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil 2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil

...On the other hand, the same TA repeat block displays a predicted potential to function as a TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ... ...Finally, there is at least one predicted pre-miRNA (Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...


PLoS ONE
(2013), 8(3): e56694. doi:10.1371/journal.pone.0056694

De novo Transcriptome Sequencing Reveals a Considerable Bias in the Incidence of Simple Sequence Repeats towards the Downstream of ‘Pre-miRNAs’ of Black Pepper.

Joy N, Asha S, Mallika V, Soniya EV
Plant Molecular Biology, Rajiv Gandhi Center for Biotechnology, Thiruvananthapuram, Kerala, India

... From the identified transcripts bearing SSRs, the 'unannotated transcripts' which were considered as non-coding alone were chosen and subjected to miRNA predictions using 'findMiRNA' programme [35]of Softberry (www.softberry.com. Accessed 2013 Jan 17). ...


Functional & Integrative Genomics
Volume 12, Issue 2 , pp 387-395 DOI 10.1007/s10142-012-0267-2

Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper

Nisha Joy (1) Eppurathu Vasudevan Soniya (1)
1. Plant Molecular Biology, Rajiv Gandhi Centre for Biotechnology, Thycaud P O, Poojappura, Thiruvananthapuram, 695 014, Kerala, India

... Hence, the sequence was analysed miRNA prediction tools like 'findMiRNA' programme (Adai et al. 2005) of Softberry (www.softberry. ... b The predicted position of pre- miRNA and mature miRNA using 'findMiRNA' of Softberry. ...


Journal of Bioinformatics and Sequence Analysis
Vol. 3(2), pp. 11-22, February 2011

Avian influenza and micro RNA: Role of bioinformatics

Pankaj Koparde 1 and Shailza Singh 2 *
1 Institute of Bioinformatics and Biotechnology, University of Pune, Pune -411007, India. 2National Centre for Cell Science, Pune University Campus, Pune -411007, India.

... Also, prediction of metazoan miRNAs for NS1 homologous proteins from humans was also carried out. This was done using Softberry findmiRNA, miReval, TargetScanS and DIANA microT web tools. ... Softberry findmiRNA http://www.softberry.com/ ...


OligoZip

Genome Res.
2011. 21: 2224-2241 DOI: 10.1101/gr.126599.111

Assemblathon 1: A competitive assessment of de novo short read assembly methods

Earl et al.,
1Center for Biomolecular Science and Engineering, University of California, Santa Cruz, California 95064, USA; 2Biomolecular Engineering Department, University of California, Santa Cruz, California 95064, USA; 25Softberry Inc., Mount Kisco, New York 10549, USA;

...and OligoZip (http://linux1.softberry.com/berry.phtml?topic=OligoZip). ...


MolQuest

BMC Genomics
2016,17:657 DOI: 10.1186/s12864-016-3017-3

Transcriptome analysis of smooth cordgrass (Spartina alterniflora Loisel), a monocot halophyte, reveals candidate genes involved in its adaptation to salinity

Bedre, R., Mangu, V. R., Srivastava, S., Sanchez, L. E., & Baisakh, N.
School of Plant, Environmental and Soil Sciences, Louisiana State University Agricultural Center; Department of Genetics and Biochemistry, Clemson University

... The positions of the SSRs on open reading frames of the genes were determined by using gene finding software MolQuest (FGENESH+; http://linux1.softberry.com/berry.phtml). ...


Fungal Biology
2016 doi:10.1016/j.funbio.2016.06.005

Cytochrome P450 complement (CYPome) of Candida oregonensis, a gut-associated yeast of bark beetle, Dendroctonus rhizophagus

Hernandez-Martinez, F., Briones-Roblero, C. I., Nelson, D. R., Rivera-Orduna, F. N., & Zuniga, G.
a Departamento de Zoologia, Escuela Nacional de Ciencias Biologicas, Instituto Politecnico Nacional, Prolongacion de Carpio y Plan de Ayala, Col. Sto. Tomas, Mexico D.F. CP 11340, Mexico b Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, 858 Madison Ave. Suite G01, Memphis, TN 38163, USA

... in both processes have been documented (DiGuistini et al., 2011, Adams et al., 2013, Lah et al., 2013 and Xu et al., 2016). ... based (HMM) gene structure prediction was performed using the Fgenesh program (Solovyev 2007) in the MolQuest package v 2.4.5.1135 (SoftBerry Inc. ...


Fish & shellfish immunology
2016, 49, 110-121. doi:10.1016/j.fsi.2015.12.022

Septin genes in channel catfish (Ictalurus punctatus) and their involvement in disease defense responses

Fu, Q. et al.,
a State Key Laboratory of Estuarine and Coastal Research, East China Normal University, Shanghai, 200062, China b The Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL, 36849, USA

... with a cutoff E-value of 1e ?10 . Fgenesh program of Molquest software (Softberry Int.) was used to predict the genes from retrieved genomic scaffold sequences [56]. The simple modular architecture research tool (SMART http ...


Molecular biology reports
2014, 1-12. DOI:10.1007/s11033-014-3360-x

GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.)

Cai C. et al.,
1. State Key Laboratory of Crop Genetics & Germplasm Enhancement, Hybrid Cotton R & D Engineering Research Center, Ministry of Education, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China

... Gene prediction was performed using the Fgenesh program in MolQuest software v1.3.1 (http://?linux1.?softberry.?com/?berry.?phtml), and predicted genes and their GO (Gene Ontology) categories were annotated with the Blast2GO program ([ 18 ], http://?www.?blast2go ...


American Journal of Molecular Biology
2013, 3, 115-130 DOI:10.4236/ajmb.2013.32016

Genome sequencing and next-generation sequence data analysis: A comprehensive compilation of bioinformatics tools and databases

Jose C. Jimenez-Lopez 1, Emma W. Gachomo 2,3, Sweta Sharma 2,3, Simeon O. Kotchoni 2,3
1Department of Biochemistry, Cell and Molecular Biology of Plants, Estacion Experimental del Zaidin, High Council for Scientific Research (CSIC), Granada, Spain 2Department of Biology, Rutgers University, Camden, USA 3Center for Computational and Integrative Biology (CCIB), Rutgers University, Camden, USA

Example of tools used for gene prediction are: 1) Glimmer, a system for finding genes in microbial DNA, especially the genomes of bacteria, archaea, and viruses (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi), 2) FgenesB, a package developed by Soft- berry Inc. for automatic annotation of bacterial genomes (http://www.molquest.com/help/2.3/programs/FgenesB/about.html),


BMC Genomics
2013, 14:695 doi:10.1186/1471-2164-14-695

Histoplasma yeast and mycelial transcriptomes reveal pathogenic-phase and lineage-specific gene expression profiles

Edwards et al.,
1 The Department of Microbiology, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA 2 The Department of Microbial Infection and Immunity, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA

... Separately, the RNA-seq short reads were assembled into transcript contigs de novo (ie, independent of the reference genome sequence) using Inchworm [39] and open reading frames extracted from the transcripts with BestORF (Molquest package, Softberry). ...


Int. J. Mol. Sci.
2013, 14(7), 13559-13576; doi:10.3390/ijms140713559

First Insights into the Large Genome of Epimedium sagittatum (Sieb. et Zucc) Maxim, a Chinese Traditional Medicinal Plant

Liu et al.,
1 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China 2 University of Chinese Academy of Sciences, Beijing 100039, China

... protein database (NR) [72]. Secondly, ab initio gene prediction was performed on the ENS dataset using the FGENESH feature (Dicot plants-Arabidopsis) of the MolQuest software package (softberry) [73]. Thirdly, a local BLAST ...


J Oral Microbiol.
2013; 5: 10.3402/jom.v5i0.19729. DOI:10.3402/jom.v5i0.19729

Cryptic Streptococcus mutans 5.6-kb plasmids encode a toxin–antitoxin system for plasmid stabilization

Anke Rheinberg, 1 Izabela Jadwiga Swierzy, 1 Tuan Dung Nguyen, 1 Hans-Peter Horz, 1,2 and Georg Conrads 1
1Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry & Periodontology, RWTH Aachen University Hospital, Aachen, Germany 2Department of Medical Microbiology, RWTH Aachen University Hospital, Aachen, Germany

... DNA and protein sequences were analyzed with the software programs GeneDoc (www.psc.edu/biomed/genedoc), Pfam (Sanger Institute, Cambridge, England), MOTIFsearch (GenomeNet, Kyoto, Japan), Softberry (MolQuest, Mount Kisco, USA), EMBOSS (European ...


PLoS Pathog
8(4): e1002643. doi:10.1371/journal.ppat.1002643

Sequential Delivery of Host-Induced Virulence Effectors by Appressoria and Intracellular Hyphae of the Phytopathogen Colletotrichum higginsianum.

Kleemann et al.,
Department of Plant-Microbe Interactions, Max-Planck-Institute for Plant Breeding Research, Cologne, Germany Central Microscopy Max-Planck-Institute for Plant Breeding Research, Cologne, Germany

...ORFs were predicted from EST contigs with the Fusarium matrix of BESTORF (Molquest package, Softberry). ...


PLoS Pathog
8(9): e1002952. doi:10.1371/journal.ppat.1002952

Comparative Pathogenomics Reveals Horizontally Acquired Novel Virulence Genes in Fungi Infecting Cereal Hosts

Gardiner DM et al.,
Commonwealth Scientific and Industrial Research Organization (CSIRO) Plant Industry, Queensland Bioscience Precinct, Brisbane, Queensland, Australia Plant Pathology, Institute of Integrative Biology, ETH Zurich, Zurich, Switzerland

...Protein coding genes were ab initio predicted in the F. pseudograminearum genome using FGENESH [52] based on the F. graminearum gene models as part of the MolQuest2 package from Softberry, AUGUSTUS [53] and GeneMark-ES...


Australasian Plant Disease Notes
April 2012 DOI 10.1007/s13314-012-0048-8

Clitoria yellow mottle virus: a tobamovirus from Northern Australia

Kejun Wei (1) Adrian Gibbs (2) Anne Mackenzie (3)
1. Faculty of Applied Science, University of Canberra, Canberra, ACT, 2617, Australia 2. Australian National University Emeritus Faculty, Canberra, ACT, 0200, Australia 3. CSIRO Division of Plant Industry, Canberra, ACT, 2601, Australia

... The genome of CYMV has the same structure as most other tobamoviruses (Stobbe et al. 2011). The MolQuest- Softberry viral gene detector (http://www.softberry.com) found four open reading frames (ORFs) in the CYMV sequence. ...


International Journal of Evolutionary Biology
Volume 2012 (2012), Article ID 970920, 8 pages doi:10.1155/2012/970920

Purifying Selection Bias against Microsatellites in Gene Rich Segmental Duplications in the Rice Genome

P. C. Sharma, 1 Manish Roorkiwa l,1,2 and Atul Grover 1,3
1University School of Biotechnology, Guru Gobind Singh Indraprastha University, Sector 16C, Dwarka, New Delhi 110078, India 2Centre of Excellence in Genomics, International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Hyderabad 502324, India

.. [7]. A simple sequence with repeat motif length of 1–6 bp spanning a minimal length of 20 bp was considered as a microsatellite. Genes were predicted using MolQuest ver. 1.6.2 (Softberry; http://www.molquest.com/). Following ...


J Gen Virol
November 2011 vol. 92 no. 11 2679-2690 DOI: 10.1099/vir.0.033852-0

The enigmatic genome of Chara australis virus

Gibbs et al.,
Research School of Biological Science, Australian National University, Canberra, ACT 0200, Australia

...ORFs were predicted by using the MolQuest-Softberry viral gene detector, ...


Eukaryotic Cell
January 2010, p. 164-172, Vol. 9, No. 1 doi:10.1128/EC.00194-09

Evolutionary Dynamics of Mating-Type Loci of Mycosphaerella spp. Occurring on Banana

Mahdi Arzanlou, 1,2,3 Pedro W. Crous, 1,2 and Lute-Harm Zwiers 1
Evolutionary Phytopathology, CBS-KNAW Fungal Biodiversity Center, Utrecht 3508 AD, The Netherlands,1 Wageningen University and Research Center (WUR), Laboratory of Phytopathology, Wageningen 6708 PB, The Netherlands,2

... reading frames (ORFs) and intron positions were predicted by comparing the sequence data with known MAT sequences from other filamentous fungi, as well as by means of the FGENESH gene prediction module from the MOLQUEST software package (Softberry, Inc., Mount ... 


Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010

Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1 predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...


Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035

Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...


J Bacteriol.
2008 May;190(9):3362-73. Epub 2008 Feb 29.

The sim operon facilitates the transport and metabolism of sucrose isomers in Lactobacillus casei ATCC 334

Thompson J, Jakubovics N, Abraham B, Hess S, Pikis A.
Microbial Biochemistry and Genetics Unit, NIDCR, National Institutes of Health, Bldg. 30, Rm. 325, Convent Dr. MSC-4350, Bethesda, MD 20892, USA

... The structure of operons was predicted by automated genome annotation using the fgenesB module of the MolQuest software (Softberry Inc.). ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429

Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum

Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands

... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev, 2000) programs from the MOLQUEST software package (Softberry Inc. ...


Applied and Environmental Microbiology,
April 2007, p. 2290-2296, Vol. 73, No. 7

The SAR92 Clade: an Abundant Coastal Clade of Culturable Marine Bacteria Possessing Proteorhodopsin

Ulrich Stingl, Russell A. Desiderio, Jang-Cheon Cho, Kevin L. Vergin, and Stephen J. Giovannoni
Oregon State University, Department of Microbiology, Nash Hall 220, Corvallis, Oregon 97331, Division of Life and Marine Sciences, Inha University, Incheon 402-751, Republic of Korea

... of retinal, the chromophore of PR. Operon prediction using MolQuest (SoftBerry, Inc., Mt. Kisco, NY) software indicated that the ...


Human-mouse synteny

Methods In Molecular Biology™
2008 Volume 426 Structural Proteomics: High-throughput Methods (June 10) pp. 37-47 10.1007/978-1-60327-058-8

Target Selection: Triage in the Structural Genomics Battlefield

James Raftery
School of Chemistry, The University of Manchester, Manchester, UK

... events. A mouse-human comparison can be seen at http://www.softberry. com/berry.phtml?topic=human- mouse&prg=none 1.3. Filters ...


Human-mouse-rat synteny

Gene
Volume 316, 16 October 2003, Pages 47-56

The human SUMF1 gene, required for posttranslational sulfatase modification, defines a new gene family which is conserved from pro- to eukaryotes

Jobst Landgrebe1, Thomas Dierks1, Bernhard Schmidt and Kurt von FiguraCorresponding Author Contact Information
Abt. Biochemie II, Universitat Gottingen, Heinrich-Duker-Weg 12, 37073, Gottingen, Germany

... resources (http://www.ncbi.nlm.nih.gov/genome/guide/), the Human-Mouse Homology Map (http://www.ncbi.nlm.nih.gov/Homology/) and Softberry's Human–Mouse–Rat Synteny (http://www.softberry. com/). ...


Rat-mouse synteny

Mammalian Genome
Volume 18, Number 5 / May, 2007 pp. 300-309

Mammary tumor modifiers in BALB/cJ mice heterozygous for p53

Koch et al.,
(1) The University of Texas Graduate School of Biomedical Sciences and the Department of Cancer Genetics, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA (2) Department of Epidemiology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA

... SoftBerry’s (http:// www.softberry.com/berry.phtml) Rat-Mouse Synteny for chromosome 1 of rat was used to determine regions of syntenic conservation between ...


Various programs

PloS one
2016, 11(4), e0153962. http://dx.doi.org/10.1371/journal.pone.0153962

Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize

Guan, H. et al.,
Maize Research Institute, Shandong Academy of Agricultural Sciences, Jinan, China, Key Laboratory of Biology and Genetic Improvement of North Summer Maize, Ministry of Agriculture, Jinan, China, National Maize Improvement Sub-Center, Jinan, China

.. Gene prediction and annotation within the located region was conducted by Softberry and according to the Maize Genetics and Genomics Database. ...


Nucleic acids research
2016, 44(6), 2646-2660. doi: 10.1093/nar/gkv1331

Natural C-independent expression of restriction endonuclease in a C protein-associated restriction-modification system

Rezulak, M., Borsuk, I., & Mruk, I.
Department of Microbiology, University of Gdansk, Wita Stwosza 59, 80-308 Gdansk, Poland

... possibility of translational coupling. Moreover, the sequence analysis indicated a potential Rho-independent transcription terminator in the 152-nt intergenic region separating csp231IR and csp231IM genes (www.softberry.com). ...


Archives of Virology
2016, 1-8. doi:10.1007/s00705-016-3003-8

Molecular epidemiology of J-subgroup avian leukosis virus isolated from meat-type chickens in southern China between 2013 and 2014

Lin, W. et al.,
Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, Key Laboratory of Chicken Genetics, Breeding and Reproduction, College of Animal ScienceSouth China Agricultural University, Ministry of Agriculture Key Laboratory of Animal Health Aquaculture and Environmental Control South China Collaborative Innovation Center for Poultry Disease Control and Product Safety

... This deletion was similar to the mutation in the 30 UTRs of Chinese ALV-J isolates SCDY1 (Fig. 3). Transcriptional regulation elements were identified in the U3 region of all ALV-J isolates using SoftBerry software, including C/EBP, E2BP, NFAP-1, CArG box, Y box and CAAT. ...


PloS one
2016, 11(7), e0158159. doi: 10.1371/journal.pone.0158159

Expression Patterns of Three UGT Genes in Different Chemotype Safflower Lines and under MeJA Stimulus Revealed Their Potential Role in Flavonoid Biosynthesis

Guo, D. D. et al.,
Department of Pharmacognosy, College of Pharmacy, Second Military Medical University, 200433, Shanghai, China

... The 3D structures of three UGT proteins were predicted by SWISS model (beta.swissmodel.expasy.org) (Fig 5). The nucleotide sequence and the deduced amino acid sequence of three UGTs were predicted (linux1.softberry.com). ...


Scientific reports
2016, 6: 21047. doi: 10.1038/srep21047

Multiple functions of Na/K-ATPase in dopamine-induced salivation of the Blacklegged tick, Ixodes scapularis

Kim, D., Urban, J., Boyle, D. L., Park, Y.
1Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506, USA 2Division of Biology, Microscopy Facility, Kansas State University, Ackert Hall, Manhattan, Kansas 66506, USA

... its homology with other arthropod Na/K-ATPases and determining the translation initiation site prediction via GeneFinder (www.softberry.com ...


Developmental & Comparative Immunology
2016, 61, 116-125 doi:10.1016/j.dci.2016.03.011

A genome-wide survey of expansive NLR-C subfamily in miiuy croaker and characterization of the NLR-B30.2 genes

Li, J., Chu, Q., Xu, T.
Laboratory of Fish Biogenetics & Immune Evolution, College of Marine Science, Zhejiang Ocean University, Zhoushan, 316022, China

... Che et al., 2014) and whole genome database (Xu et al., 2016) by local BLASTn and tBLASTn programs. To further confirm the accuracy of miiuy croaker NLR-B and NLR-C subfamily sequences, the corresponding identified scaffolds were predicted by softberry software. ...


Gene
2016 doi:10.1016/j.gene.2016.07.018

Isolation and molecular characterization of a stationary phase promoter useful for gene expression in Gordonia

Singh, P., Chachan, S., Singhi, D., Srivastava, P.
Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology, Delhi, India

... The secondary structure was predicted by RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold. cgi) and the promoter prediction software used was http://linux1.softberry.com/berry ...


Sains Malaysiana
2016, 45(5), 717-727.

Isolation and Characterization of Full-Length Cellulose Synthase Gene (HsCesA1) from Roselle (Hibiscus sabdariffa L. var. UMKL).

Seyedi, S. S., Tan, S. G., Namasivayam, P., Yong, C. S. Y.
Institute

.. PROMOTER ANALYSIS The promoter sequence was analyzed using prediction plant promoter (http://linux1.softberry.com/berry. phtml), neural network promoter prediction (http://www.fruitfly. ...


Molecular plant pathology
2016 DOI: 10.1111/mpp.12444

Fungal phytopathogens encode functional homologues of plant rapid alkalinisation factor (RALF) peptides

Thynne, E. et al.,
Plant Sciences Division, The Australian National University, Canberra, Australia Evolution, Ecology and Genetics Division, Research School of Biology, The Australian National University, Canberra, Australia

... Masachis et al. (2016) grew plants for inoculation in vermiculite with no plant nutrients provided and it is possible ... 2013; Nemri et al. 2014). Where annotations were not present or were different, the online Softberry server (http://linux1.softberry.com/berry.phtml) ...


Arch Virol
2016 doi:10.1007/s00705-016-2965-x

Isolation, identification and evolution analysis of a novel subgroup of avian leukosis virus isolated from a local Chinese yellow broiler in South China

Li, X. et al.,
College of Animal Science, South China Agricultural University Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding and Key Laboratory of Chicken Genetics, Breeding and Reproduction, Ministry of Agriculture

.. The transcriptional regulatory elements in the non-coding regions of the genome were analyzed using Softberry (Softberry, Mount Kisco, NY, USA). ...


Plant Physiology and Biochemistry
2016, 108, 241-250. doi:10.1016/j.plaphy.2016.07.016

Molecular cloning and functional characterization of DkMATE1 involved in proanthocyanidin precursor transport in persimmon (Diospyros kaki Thunb.) fruit

Yang, S. et al.,
a Key Laboratory of Horticultural Plant Biology, Huazhong Agricultural University, Wuhan 430070, Hubei, China b Hubei Collaborative Innovation Center for the Characteristic Resources Exploitation of Dabie Mountains, Huanggang 438000, Hubei, China c Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan

... Translation of gene sequences was performed using SoftBerry (http://linux1.softberry.com/). ...


Gene
2016, 316, 47-56 doi:10.1016/S0378-1119(03)00746-7

The human SUMF1 gene, required for posttranslational sulfatase modification, defines a new gene family which is conserved from pro-to eukaryotes

Landgrebe, J., Dierks, T., Schmidt, B., von Figura, K.
Abt. Biochemie II, Universitat Gottingen, Heinrich-Duker-Weg 12, 37073 Gottingen, Germany

.. and mouse genome resources (http://www.ncbi.nlm.nih.gov/genome/guide/), the Human–Mouse Homology Map (http://www.ncbi.nlm.nih.gov/Homology/) and Softberry's Human–Mouse ...


BMC genetics
2016, 17(1), 1. DOI: 10.1186/s12863-016-0350-0

DHPLC technology for high-throughput detection of mutations in a durum wheat TILLING population

Colasuonno, P. et al.,
Department of Soil, Plant and Food Sciences, section of Genetic and Plant Breeding, University of Bari "Aldo Moro"

... All these sequences were subjected to bioinformatic analysis via Aegilops tauschii genome sequence database [42] and CerealsDB site [43] to distinguish the A and B genome homoeologous copies, and via SoftBerry [44] to predict the gene structures. ..


Research in microbiology
2016, 167(5), 403-412. doi:10.1016/j.resmic.2016.03.005

The arginine deiminase system facilitates environmental adaptability of Streptococcus equi ssp. zooepidemicus through pH adjustment

Xu, B. et al.,
a College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China b Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China

... According to the results of in silico analysis (Softberry, www.softberry.com), a promoter and a terminator were predicted to be located in the intergenic region between arcB and arcD, which indicated that arcA, orf2 and arcB, or arcD, arcT and arcC might also be transcribed as an ...


Advanced Science Letters
2016, 10(1), 146-152. DOI: http://dx.doi.org/10.1166/asl.2012.3743

Cloning and Bioinformatics Analysis of a Peroxidase Gene from Camellia Oleifera Seed

Chen, H., Tan, X., Shao, G.
Institute

... Second Structure Analysis and 3D Structure Prediction The Softberry Platform figured out that -helix and -sheet were the main components in the second structure of Co-POD, and there ... IP: 93.91.26.12 On: Sun, 20 Mar 2016 03:18:59 Copyright: American Scientific Publishers ...


Gene
Volume 580, Issue 1, 10 April 2016, Pages 8–16 doi:10.1016/j.gene.2015.12.069

Molecular cloning, expression and characterization of acylpeptide hydrolase in the silkworm, Bombyx mori

Fu, P., Sun, W., Zhang, Z.
School of Life Sciences, Chongqing University, Chongqing 400044, China

... Therefore, we re-predicted the APH gene in the scaffold 2829 on the 17th chromosome of silkworm using softberry (www.softberry.com). Based on the nucleotide sequence of the putative APH gene, the specific primers were designed to clone the gene (Table S1). ...


Tree Genetics & Genomes
2016, 12(2), 1-11. DOI: 10.1007/s11295-016-0976-0

ADH and PDC genes involved in tannins coagulation leading to natural de-astringency in Chinese pollination constant and non-astringency persimmon (Diospyros kaki Thunb.)

Mo, R. et al.,
1. Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Wuhan, 430070, China 2. Hubei Collaborative Innovation Center for the Characteristic Resources Exploitation of Dabie Mountains, Huanggang, 438000, China

... The gene sequences were confirmed with BLAST in GenBank. The ORFs of genes were predicted using online software (http://?linux1.?softberry.?com/?). Sequence identity analysis was performed with ClustalW2 (Khater et al. 2012). RNA extraction and qRT-PCR analysis. ...


Scientific reports
2016, 6: 19104. doi: 10.1038/srep19104

A Novel Naturally Occurring Class I 5-Enolpyruvylshikimate-3-Phosphate Synthase from Janibacter sp. Confers High Glyphosate Tolerance to Rice

Yi, S. Y. et al.,
1State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China 2National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, China

... Sequence analysis. The inserted fragment from the plasmid pZY3 was sequenced by the Genescript Company (Nanjing, China), and the nucleotide sequences were analyzed using the Softberry Gene Finding Tool (http://linux1.softberry.com/berry). ...


Developmental & Comparative Immunology
2016, 61, 116-125. doi:10.1016/j.dci.2016.03.011

A genome-wide survey of expansive NLR-C subfamily in miiuy croaker and characterization of the NLR-B30. 2 genes

Li, J., Chu, Q., Xu, T.
Laboratory of Fish Biogenetics & Immune Evolution, College of Marine Science, Zhejiang Ocean University, Zhoushan, 316022, China

... To further confirm the accuracy of miiuy croaker NLR-B and NLR-C subfamily sequences, the corresponding identified scaffolds were predicted by softberry software. The cDNA sequences were aligned with the obtained scaffold using MAFFT (Katoh and Standley, 2013). 2.5. ...


FEMS microbiology letters
2016, 363(8), fnw063. DOI: http://dx.doi.org/10.1093/femsle/fnw063

Overexpression of two stress-responsive, small, non-coding RNAs, 6S and tmRNA, imparts butanol tolerance in Clostridium acetobutylicum

Jones, A. J., Venkataramanan, K. P., Papoutsakis, T.
1Department of Biological Sciences, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA 2Molecular Biotechnology Laboratory, Delaware Biotechnology Institute, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA

... The larger bands present in both tmRNA and 6S RNA northern blots are believed to be transcriptional products from additional promoters on the p94MCS vector backbone located upstream of its cloning site; using the Softberry promoter prediction tool (Solovyev and Salamov ...


Frontiers in plant science
2016, 7: 156. doi: 10.3389/fpls.2016.00156

Isolation and Characterization of DkPK Genes Associated with Natural Deastringency in C-PCNA Persimmon

Guan, C. et al.,
1Key Laboratory of Horticultural Plant Biology, Huazhong Agricultural University, Wuhan, China 2Institute of Horticultural Sciences, Jiangxi Academy of Agricultural Sciences, Nanchang, China

... The sequences of the primers used for RACE, genome walking and cloning are described in Supplementary Table S1. The gene sequences were translated with online software (http://linux1.softberry.com/) and confirmed with BLAST methods in GenBank (Benson et al., 2000). ...


Journal of Integrative Agriculture
2016 Doi: 10.1016/S2095-3119(15)61295-3

Isolation and molecular characterization of the FLOWERING LOCUS C gene 2 promoter sequence in radish (Raphanus sativus L.).

Rong-hua, L. U. O., Li-wang, L. I. U.
1National Key Laboratory of Crop Genetics and Germplasm Enhancement; Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), M inistry of Agriculture of P.R.China; College of Horticulture, Nanjing Agricultural University, Nanjing 210095, P.R. China. 2 Department of Plant Sciences, North Dakota State University, Fargo, ND 58108, USA.

... The promoter's' transcription start sites (TSS) were predicted by the Softberry databases ...


Research in microbiology
2016, Volume 167, Issue 5, June 2016, Pages 403–412 doi:10.1016/j.resmic.2016.03.005

The arginine deiminase system facilitates environmental adaptability of Streptococcus equi ssp. zooepidemicus through pH adjustment

Xu, B. et al.,
a College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China b Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China

... According to the results of in silico analysis (Softberry, www.softberry.com), a promoter and a terminator were predicted to be located in the intergenic region between arcB and arcD, which indicated that arcA, orf2 and arcB, or arcD, arcT and arcC might also be transcribed as an ...


PloS one, 11(3), e0151657. http://dx.doi.org/10.1371/journal.pone.0151657
2016

KatG, the Bifunctional Catalase of Xanthomonas citri subsp. citri, Responds to Hydrogen Peroxide and Contributes to Epiphytic Survival on Citrus Leaves

Tondo, M. L. et al.,
Molecular Biology Division, Instituto de Biologia Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Cientificas y Tecnicas, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, Rosario, Santa Fe, Argentina Planta Piloto de Procesos Industriales Microbiologicos, Consejo Nacional de Investigaciones Cientificas y Tecnicas, San Miguel de Tucuman, Tucuman, Argentina

... bp upstream of the 5' end to 22 bp downstream of the 3' end of the ORF was amplified using the primer pair ckatG-F and ckatG-R (Table 1). The amplified sequence included the putative promoter sequence of the katG gene, previously predicted with SoftBerry (www.softberry ...


Horticultural Plant Journal
2016, Volume 2, Issue 1, Pages 16–25 doi:10.1016/j.hpj.2016.02.001

Evolution of TWIN SISTER of FT (TSF) Genes in Brassicaceae

Hu, Y. et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China

... syntenic intergenic regions). Residues present in intergenic regions were re-annotated using SoftBerry (http://linux1.softberry.com/). 3. Results. 3.1. Identification of FT and TSF genes in Brassicaceae genomes. FT orthologs in ...


Scientific reports
2016, 6: 20532. doi: 10.1038/srep20532

Transcriptional Regulation of Atp-Dependent Chromatin Remodeling Factors: Smarcal1 and Brg1 Mutually Co-Regulate Each Other

Haokip, D. T. et al.,
1Chromatin Remodeling Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067.

... gene was analyzed for its regulatory sequences. Bioinformatic analysis using Softberry promoter prediction software (www.softberry.com) as well as information from Huang et al. 23 showed that a putative promoter sequence was present upstream of the translation start sequence and the promoter region was enriched in CpG islands....


Planta
2016, 1-11. DOI 10.1007/s00425-016-2511-9

Identification and functional characterization of the NAC gene promoter from Populus euphratica

Wang, J. Y., Wang, J. P., Yang, H. F.
1. Biotechnology Research Institute of the Chinese Academy of Agricultural Sciences, No. 12 Zhong Guan Cun South Street, 100081, Beijing, China 2. Tianjin University of Science and Technology, No. 29 13th Avenue, Tianjin Economic and Technological Development Area, 300457, Tianjin, China

... The transcription start site was analyzed using available online tools (http://?www.?Softberry.? com). ... The elements were identified using PLACE. The transcription start site analysis was completed using online tools (http://?www.?Softberry.?com). ...


Plant Physiology and Biochemistry
2016, 105, 90-101. doi:10.1016/j.plaphy.2016.04.011

Genome-wide identification and expression analysis of the metacaspase gene family in Hevea brasiliensis

Liu, H. et al.,
a Key Laboratory of Biology and Genetic Resources of Rubber Tree, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou 571737, China b College of Agriculture, Hainan University, Haikou 570228, China

... Redundant sequences were removed after similarity comparison. The open reading frames (ORFs) of candidate mRNA or genome DNA sequences were determined by NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and Softberry (http://linux1.softberry.com/). ...


Pakistan Journal of Agricultural Sciences
2016, 53(1), 27-33.

Characterization of ERD15 gene from cultivated tomato (Solanum lycopersicum).

Ziaf, K. et al.,

... Bioinformatics analyses: The sequencing results were used to get predicted peptide for SlERD15 using Genescan (MIT, Cambridge, MA) and Softberry. Intron in the genomic DNA was computed by the Splign tool at NCBI (http://www.ncbi.nlm.nih.gov/sutils/splign/splign.cgi). ...


Virus Genes
2016, Volume 52, Issue 3 , pp 432-435 DOI: 10.1007/s11262-016-1300-7

Complete genome sequence of the cold-active bacteriophage VMY22 from Bacillus cereus

Qin K. et al.,
1. Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming, 650500, China 2. Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming, 650500, China

... The Tandem Repeats Finder program was used to test for the presence of tandem repeats. Open reading frames (ORFs) were predicted using program Softberry and RAST. ... The program Softberry was used to predict promoter and transcription termination sites. ...


Proceedings of the National Academy of Sciences, India Section B: Biological Sciences
June 2013 DOI:10.1007/s40011-013-0192-8

Organization and Classification of Cytochrome P450 Genes in Castor (Ricinus communis L.)

Maryada Shailendar Kumar, Peram Ravindra Babu, Khareedu Venkateswara Rao, Vudem Dashavantha Reddy
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, India

... The CYP proteins which are below 300 and above 600 amino acids were validated by using Softberry gene prediction tool (http://linux1.softberry. com/berry.phtml) by increasing the scaffold size to 2,000 bp upstream of 50 end. ...


Gene
Volume 528, Issue 2, 10 October 2013, Pages 170–177 DOI: 10.1016/j.gene.2013.07.022

PLC-?1-Lf, a novel N-terminal extended phospholipase C-?1

Kim et al.,
a Department of Aquatic Life Medicine, Pukyong National University, Busan 608-737, South Korea b Department of Embryology, Carnegie Institution for Science, Baltimore, MD 21218, USA

... The promoter region was predicted from the genomic DNA sequence using BIMAS Promoter Scan Version 1.7 (http://bimas.dcrt.nih.gov/molbio/proscan/), Softberry (http://www.softberry.com/), Promoter 2.0 Prediction (http://www.cbs.dtu.dk/services/Promoter/), and MOTIF Search ...


Molecular Biology Reports
April 2013, Volume 40, Issue 4, pp 2887-2896 DOI:10.1007/s11033-012-2304-6

Comparative characterization of sweetpotato antioxidant genes from expressed sequence tags of dehydration-treated fibrous roots under different abiotic stress conditions

Yun-Hee Kim, Jae Cheol Jeong, Haeng-Soon Lee, Sang-Soo Kwak
1. Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Gwahak-ro 125, Yuseong-gu, Daejeon, 305-806, Republic of Korea

... The isoelectric point (pI), molecular weight, and signal sequences of deduced proteins were predicted using the ExPasy (http://www.expasy.org/tools), PSORT (http://psort.ims.u-tokyo.ac. jp), and SoftBerry (http://www.softberry.com) programs. Stress treatment. ...


Current Microbiology
Volume 66, Issue 3 , pp 259-265 DOI: 10.1007/s00284-012-0266-5

Identification of Regulatory Sequences and Expression Analysis of OmpR Gene Under Different Stress Conditions in the Antarctic Bacterium Psychrobacter sp. G

Weizhi Song, Xuezheng Lin, Shuai Che
1. Key Lab of Marine Bioactive Substances, First Institute of Oceanography, SOA, Xianxialing Road 6, Qingdao, 266061, China

... Bioinformatics Analysis of OmpR503 The regulatory sequences, ie, -10 region, -35 region, ribosomal binding site (RBS), and open reading frame (ORF) were analyzed using the Softberry (http://linux1. softberry.com/berry.phtml ...


J. Agric. Food Chem.
2013, 61 (26), pp 6423–6429 DOI: 10.1021/jf401537q

A Vigna radiata 8S Globulin ?? Promoter Drives Efficient Expression of GUS in Arabidopsis Cotyledonary Embryos

Chen et al.,
† College of Life Science, Jinan University, Guangzhou 510632, China ‡ School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China

... The transcription start site and TATA box were 126 predicted with software Softberry (http://www.softberry.com). ... 32 Putative 188 cis-elements were identified and analyzed using several promoter analysis software including 189 plantCARE, PLACE and Softberry. ...


World Journal of Microbiology and Biotechnology
September 2013 DOI:10.1007/s11274-013-1477-z

Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate

Wang et al.,
1. Department of Bioengineering, College of Food Science, South China Agricultural University, 482 Wu-Shan Road, Tian-He District, Guangzhou, 510642, Guangdong, China 3. Guangdong VTR Bio-Tech Co., Ltd., Zhuhai, China

... Further analyses of the sequences were performed by using Recognition of Regulatory Motifs with statistics in the softberry software (http://www.softberry.rn/berry.html) and PLACE Web Signal Scan (http://www.dna.affrc.go.jp/PLACE/signalscan.html). ...


Appl. Environ. Microbiol.
October 2013 vol. 79 no. 19 6176-6179 DOI:10.1128/AEM.02015-13

Clostridium acidurici Electron-Bifurcating Formate Dehydrogenase

Shuning Wang a,b, Haiyan Huang a, Jorg Kahnt a and Rudolf K. Thauer a
Max Planck Institute for Terrestrial Microbiology, Marburg, Germanya State Key Laboratory of Microbial Technology, Shangdong University, Jinan, People's Republic of Chinab

... terminator. Bioinformatics analysis was performed with Softberry software (Softberry, Inc., NY) and the software provided by the ARNold finding terminators at IGM-Web Server (http://rna.igmors.u-psud.fr/toolbox/arnold/index.php). ...


AAC
00423-13 May 2013, doi: 10.1128/AAC.00423-13

Complete Sequence of pOZ176, a 500-kb IncP-2 Plasmid Encoding IMP-9-mediated Carbapenem Resistance, from Outbreak Isolate Pseudomonas aeruginosa 96

Xiong et al.,
aDept. of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada bPublic Health Ontario Laboratories, Toronto, ON, Canada cCentre de Recherche en Infectiologie, CHU de Quebec, Quebec, QC, Canada

... Additional software, including IS finder 119 (http://www-is.biotoul.fr/is.html) and various Softberry programs 120 (http://linux1.softberry.com/berry.phtml), were used for analysis of specific plasmid genetic 121 features, such as IS elements and pathogenicity islands. ...


Functional & Integrative Genomics
Volume 13, Issue 4 , pp 425-434 DOI:10.1007/s10142-013-0333-4

Genes encoding the production of extracellular polysaccharide bioflocculant are clustered on a 30-kb DNA segment in Bacillus licheniformis

Yan et al.,
1. Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005, People’s Republic of China 2. Key Laboratory for Chemical Biology of Fujian Province, Xiamen University, Xiamen, 361005, People’s Republic of China

... DNA sequencing was performed by Majorbio BioTechnologies Co., Ltd. (Shanghai, China). The open reading frames (ORFs) and predicted genes in the DNA sequences were identified using the SoftBerry program (http:// linux1.softberry.com/berry.phtml). ...


PloS one
April 09, 2013DOI: 10.1371/journal.pone.0060717

Klebsiella Phage vB_KleM-RaK2 — A Giant Singleton Virus of the Family Myoviridae

Simoliunas et al.,
Department of Molecular Microbiology and Biotechnology, Institute of Biochemistry, Vilnius University, Vilnius, Lithuania

... sequences was performed using extractUpStreamDNA (http://lfz.corefacility.ca/extractUpStre? amDNA/), MEME analysis [36] at http://meme.sdsc.edu/meme/cgibin/meme.cg?i as well as PePPER (http://pepper.molgenrug.nl/index.php/pep?per-tools) and SoftBerry (http://linux1 ...


Neurosignals
2013;21:129-149 (DOI:10.1159/000343672)

Brain-Site-Specific Proteome Changes Induced by Neuronal P60TRP Expression

Manavalan A. a, b · Mishra M. a, b · Sze S.K. a · Heese K. c
aSchool of Biological Sciences and bInstitute of Advanced Studies, Nanyang Technological University, Singapore, Singapore; cDepartment of Biomedical Engineering, Hanyang University, Seoul, Korea

... picture [10]. We used online databases, eg Panther (www.pantherdb.org), UniProt, NCBI, and 'softberry' (http://linux1.softberry.com/ berry.phtml), to classify the functions of the iTRAQ-identified p60TRP-regulated proteins. STRING ...


Genes & Genomics
Volume 35, Issue 1 , pp 47-58 DOI:10.1007/s13258-013-0068-6

Cloning and characterization of Tc1 family-derived PPTN related transposons from ridged-eye flounder (Pleuronichthys cornutus) and inshore hagfish (Eptatretus burgeri)

Sang Jung Ahn et al.,
1. Department of Biotechnology, Pukyong National University, Busan, 608-737, South Korea 2. Department of Embryology, Carnegie Institution for Science, Baltimore, MD, 21218, USA

... and Ensembl Multi blastview. Promoter regions in transposons were identified using BIMAS Promoter Scan Version 1.7 (http://bimas.dcrt. nih.gov/molbio/proscan/), Softberry (http://www.softberry. com/),Promoter 2.0 Prediction ...


Journal of Asia-Pacific Entomology
Volume 16, Issue 3, September 2013, Pages 257–261 DOI:10.1016/j.aspen.2013.03.004

Characterization of a novel mosquitocidal strain of Bacillus thuringiensis serovar aizawai which harbors a rolling-circle replication plasmid, pBt1–3

Liu et al.,
a Department of Agricultural Biotechnology, College of Agriculture and Life Science, Seoul National University, Seoul 151-742, Republic of Korea b Division of Medical Entomology, Korea National Institute of Health, Chungbuk 363-951, Republic of Korea

... nih.gov/gorf/gorf.html) and Softberry (http://linux1.softberry.com/berry.phtml) were utilized to predict the putative open reading frames (ORFs) of pBt1-3. The plasmid pBt1-3 nucleotide sequence determined in this paper has been deposited in the GenBank database under the ...


Scientia Horticulturae
Volume 156, 7 June 2013, Pages 29–37 DOI:10.1016/j.scienta.2013.03.003

Functional analysis of female gametophyte specific promoters in Chinese cabbage

Soo-Yun Kim a, Hee-Ju Yu b, Joon Ki Hong c, Jong Gyu Woo a, Yul Kyun Ahn a
a Vegetable Research Division, National Institute of Horticultural and Herbal Science, RDA, Suwon 440-706, Republic of Korea b Department of Life Sciences, the Catholic University of Korea, Buxheon 420-743, Republic of Korea

... Sequence information of At5g40260 was obtained from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/). Hypothetical coding sequences of At5g40260 and BRA0029160 were predicted using Softberry program (www.softberry.com). ...


Journal of Agricultural Science and Technology
Article 16, Volume 16, Issue 1, January 2014, Page 191-202

Isolation and Characterization of DBR2 Gene Promoter from Iranian Artemisia annua

R. Sarvestani; S. A. Peyghambary; A. Abbasi
Department of Agronomy and Plant Breeding, Agricultural College, University of Tehran, Karaj, Islamic Republic of Iran.

... DNA sequencing was performed on an ABI 373A automated sequence. Then, promoter prediction, characterization, and search for the putative cis-acting elements were carried out using different databases: Softberry, PlantCARE [23] and PLACE [24]. Page 4. ...


Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 950-959 DOI: 10.1007/s12010-012-0060-7

Selective n-Butanol Production by Clostridium sp. MTButOH1365 During Continuous Synthesis Gas Fermentation Due to Expression of Synthetic Thiolase, 3-Hydroxy Butyryl-CoA Dehydrogenase, Crotonase, Butyryl-CoA Dehydrogenase, Butyraldehyde Dehydrogenase, and NAD-Dependent Butanol Dehydrogenase

Vel Berzin, Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA 2. Ajinomoto–Genetika Research Institute, 1st Dorozhny pr. 1-1, 117545, Moscow, Russia

... Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Electrotransformation procedure [7] was used in modification. ...


PloS one
March 29, 2013DOI: 10.1371/journal.pone.0059802

Truncated Cotton Subtilase Promoter Directs Guard Cell-Specific Expression of Foreign Genes in Tobacco and Arabidopsis

Lei Han, Ya-Nan Han, Xing-Guo Xiao
State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing, China

... Online analysis using SoftBerry (http://linux1.softberry.com) and PLACE (http://www.dna.affrc. go.jp/htdocs/PLACE/) [60] of the regulatory fragment revealed the presence of 1 TATA box (?31) and 10 Dof protein-targeted cis-acting elements “(T/A)AAAG” (Fig. ...


Experimental & Molecular Medicine
2013) 45, e39; doi:10.1038/emm.2013.76 Published online 6 September 2013

Brain site-specific proteome changes in aging-related dementia

Manavalan et al.,
1School of Biological Sciences, Nanyang Technological University, Singapore, Singapore 2Department of Obstetrics and Gynecology, University of California Irvine, Irvine, CA, USA

... In addition, we used online databases (for example, Panther (Protein Analysis Through Evolutionary Relationship) at www.pantherdb.org, UniProt, NCBI and 'softberry' http://linux1. softberry.com/berry.phtml) to classify the functions of the iTRAQ-identified proteins modulated ...


J. Exp. Zool. (Mol. Dev. Evol.) .
9999:1–11 DOI: 10.1002/jez.b.22527

Transcriptional activity of transposable elements in coelacanth

Forconi et al.,
1Dipartimento di Scienze della Vita e dell'Ambiente, Universita Politecnica delle Marche, Ancona, Italy 2Institut de Genomique Fonctionnelle de Lyon, ENS Lyon, France

tools, such as Censor (Jurka et al., 1996, 2005), BLAST (Altschul et al., 1990), Softberry (http://linux1.softberry.com/berry.phtml), RNAfold (http://rna.tbi.univie.ac.at), and MUSCLE ...


Plant Science
Volume 213, December 2013, Pages 106–113 DOI:10.1016/j.plantsci.2013.09.005

The tonoplast intrinsic aquaporin (TIP) subfamily of Eucalyptus grandis: Characterization of EgTIP2, a root-specific and osmotic stress-responsive gene

Marcela I. Rodrigues, Juliana P. Bravo, Flavio T. Sassaki, Fabio E. Severino, Ivan G. Maia
UNESP, Instituto de Biociencias, Departamento de Genetica, Botucatu, SP, Brazil

... and [27]. The transcriptional start site (TSS) prediction program [28] available at Softberry (www.softberry.com) was used to predict the TSS position of EgTIP2. 2.11. Generation of transgenic tobacco plants. The resulting pCAMBIAEgTIPpromo ...


The Crop Journal
Volume 1, Issue 1, October 2013, Pages 2–14 DOI:10.1016/j.cj.2013.07.007

Identification and fine mapping of two blast resistance genes in rice cultivar 93-11

Lei et al.,
a Institute of Crop Science, Chinese Academy of Agricultural Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Beijing 100081, China b Key Laboratory of Crop Genetics and Germplasm Enhancement, Jiangsu Provincial Center of Plant Gene Engineering, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

... Ltd., Beijing. DNA and protein sequences were predicted using the softberry program (http://linux1.softberry.com/), and then aligned with Nipponbare homologues using the Gramene and EBI needle programs (http://www.ebi.ac.uk/). Table 4. ...


Journal of Integrative Plant Biology
DOI:10.1111/jipb.12144

SbHKT1;4, a member of the high affinity potassium transporter gene family from Sorghum bicolour, functions to maintain optimal Na+/K+ balance under Na+ stress

Wang et al.,
1The Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China 2College of Life Sciences, Capital Normal University, Beijing, China

... bright border fluorescence, which was consistent with the cell membrane-localised prediction by TMHMM server and the softberry online database (www.softberry.com). To determine whether the expression of the SbHKT1;4 was modulated by the external ...


Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1176-1183 DOI:10.1007/s11105-013-0576-1

Structural and Transcriptional Characterization of rbcS Genes of Cotton (Gossypium hirsutum)

Kumar Paritosh, Deepak Pental, Pradeep Kumar Burma
1. Centre for Genetic Manipulation of Crop Plants, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India 2. Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India

... Higo et al. 1999), PlantCARE (Lescot et al. 2002), and Softberry (www.softberry.com.) databases. A number of putative regulatory motifs corresponding to the known cis-elements of rbcS genes were found. The relative positions ...


Journal of Industrial Microbiology & Biotechnology
Volume 40, Issue 7 , pp 749-758 DOI:10.1007/s10295-013-1279-1

Gene replacement and elimination using ?Red- and FLP-based tool to re-direct carbon flux in acetogen biocatalyst during continuous CO2/H2 blend fermentation

Michael Tyurin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA

... Promoter and terminator sequences. Promoter and terminator sequences used in both vectors were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Primers for the synthetic genes used in this project are listed in Table ...


World Journal of Microbiology and Biotechnology
Volume 29, Issue 9 , pp 1611-1623 DOI:10.1007/s11274-013-1324-2

Selective methanol or formate production during continuous CO2 fermentation by the acetogen biocatalysts engineered via integration of synthetic pathways using Tn7-tool

Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA 2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia

... early sporulation gene. Promoter and terminator sequences for the components of all vectors used were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). The confirmation ...


Bioprocess Biosyst Eng.
2013 Jun 18. DOI:

Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H 2 blend.

Kiriukhin M, Tyurin M.
Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA.

... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR. ...


Journal of Applied Microbiology
Volume 114, Issue 4, pages 1033–1045, April 2013 DOI:10.1111/jam.12123

Expression of amplified synthetic ethanol pathway integrated using Tn7-tool and powered at the expense of eliminated pta, ack, spo0A and spo0J during continuous syngas or CO2/H2 blend fermentation

M. Kiriukhin 1, M. Tyurin 2,
1Ajinomoto-Genetika Research Institute, Moscow, Russia 2Syngas Biofuels Energy, Inc, Houston, TX, USA

... Promoter and terminator sequences for the components of all vectors. Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). rtPCR. ...


Applied Biochemistry and Biotechnology
Volume 170, Issue 6 , pp 1503-1524 DOI:10.1007/s12010-013-0285-0

Synthetic 2,3-Butanediol Pathway Integrated Using Tn7-tool and Powered Via Elimination of Sporulation and Acetate Production in Acetogen Biocatalyst

Michael Tyurin, Michael Kiriukhin
State

... Promoter and Terminator Sequences for the Components of All Vectors Promoter and terminator sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR ...


Theoretical and Applied Genetics
Volume 126, Issue 5 , pp 1273-1283 DOI:10.1007/s00122-013-2052-6

Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1

Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan 2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan

... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry. phtml) software was then used to allow the simultaneous comparison of distinct annotated genomes. Phylogenetic analysis. Protein sequence ...


Antimicrob. Agents Chemother.
April 2013 vol. 57 no. 4 1603-1609 DOI:10.1128/AAC.01998-12

Elucidating the Regulon of Multidrug Resistance Regulator RarA in Klebsiella pneumoniae

Shyamasree De Majumdar a, Mark Veleba a, Sarah Finn b, Seamus Fanning b and Thamarai Schneiders a
aCentre for Infection and Immunity, Queen's University Belfast, Belfast, United Kingdom bUCD Centre for Molecular Innovation and Drug Design, School of Public Health, Physiotherapy & Population Science, University College Dublin, Dublin, Ireland

... labeled “TSS” and shaded. The Shine-Dalgarno sequence is shown underlined, and putative ?10, ?35 promoter regions determined through Softberry software analysis are shown boxed and labeled accordingly. Our initial work ...


Genetic Testing and Molecular Biomarkers.
July 2013, 17(7): 553-561. doi:10.1089/gtmb.2012.0118.

Results of Genetic Testing in 855 Consecutive Unrelated Patients Referred for Long QT Syndrome in a Clinical Laboratory

Lieve et al.,
1Department of Pediatrics, Columbia University, New York, New York. 2Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands. 3GeneDx, Gaithersburg, Maryland.

... Browser. Variants were analyzed for predicted functional effect using PolyPhen2, SIFT, Mutation Taster, Softberry Grantham score, cross species alignment, and location compared with published functional domains of the protein. ...


Microbial Biotechnology,
6: 551–563. (2013) doi: 10.1111/1751-7915.12040

Tight coupling of polymerization and depolymerization of polyhydroxyalkanoates ensures efficient management of carbon resources in Pseudomonas putida.

Arias, S., Bassas-Galia, M., Molinari, G. and Timmis, K. N.
1Environmental Microbiology Laboratory, Helmholtz Centre for Infection Research, Braunschweig, Germany 2Institute for Microbiology, Technical University Braunschweig, Braunschweig, Germany

... The analysis of possible transcription promoters using Softberry, PromScan and the PDBG online informatics tools, revealed that all pha genes are preceded by potential promoters and more specifically, that both ? 70 and ? 54 potential promoters were found upstream of the ...


J. Bacteriol.
December 2013 vol. 195 no. 23 5233-5241 DOI:10.1128/JB.00965-13

Expanding the Cyanuric Acid Hydrolase Protein Family to the Fungal Kingdom

Anthony G. Dodge a, Chelsea S. Preiner a and Lawrence P. Wacket a,b
BioTechnology Institutea Department of Biochemistry, Molecular Biology, and Biophysics,b University of Minnesota, St. Paul, Minnesota, USA

... directions by DNA sequence walking with a GenomeWalker Universal kit (Clontech, Mountain View, CA) and primers SaroGSP1-5?, SaroGSP1-3?, SaroGSP2-5?, and SaroGSP2-3? (Table 1). Potential genes were predicted in the resulting sequence on the Softberry Inc. ...


ReseJ. Antimicrob. Chemother.
(2013) 68 (7): 1543-1550. doi: 10.1093/jac/dkt078arch

Association of the novel aminoglycoside resistance determinant RmtF with NDM carbapenemase in Enterobacteriaceae isolated in India and the UK

Hidalgo et al.,
1Department of Animal Health and VISAVET, Universidad Complutense de Madrid, Madrid, Spain 2Antimicrobial Resistance and Healthcare Associated Infections (AMRHAI) Reference Unit, Health Protection Agency Microbiology Services – Colindale, London, UK

... into DH5? cells, which were then plated on agar containing ampicillin (50 mg/L) and gentamicin (10 mg/L). A CloneJET PCR cloning kit (Fermentas International Inc.) was used to clone rmtF along with its promoter region, previously determined with the Softberry online tool. ...


Plant Physiology and Biochemistry
Volume 69, August 2013, Pages 1–8 DOI:10.1016/j.plaphy.2013.04.007

Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches

Sabetta et al.,
a Department of Soil, Plant and Food Sciences, Section of Genetics and Breeding, University of Bari «Aldo Moro», via Amendola 165/A, 70126 Bari, Italy b CRA-OLI The Olive Growing and Olive Product Industry Research Centre, Contrada LiRocchi, 87036 Rende, Cosenza, Italy c Department of Crop Systems, Forestry and Environmental Sciences, University of Basilicata, via N. Sauro 85, 85100 Potenza, Italy

... 4.3. EcoTILLING and PCR sequencing. The full-length genomic sequence was analysed by CODDLE (http://www.proweb.org/input/) and SoftBerry (http://linux1.softberry.com/ berry.phtml) software and the gene structure was predicted. ...


J. Integr. Plant Biol.
Volume 55, Issue 5, pages 462–472, May 2013 doi: 10.1111/jipb.12027

Fine mapping of RppP25, a southern rust resistance gene in maize.

Zhao et al.,
1National Maize Improvement Center of China, Key Laboratory of Biology and Genetic Improvement of Maize (Ministry of Agriculture), China Agricultural University, Beijing 100193, China 2National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI), Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 10081, China

... Prediction of candidate gene The gene structure prediction program SoftBerry (http://linux1.softberry. com/berry.phtml) and the GENSCAN Web Server at MIT (http://genes.mit.edu/GENSCAN.html) were used to predict candidate gene in the resistance gene region. ...


J Bone Miner Res,
28: 1041–1049. doi: 10.1002/jbmr.1849

SNX10 mutations define a subgroup of human autosomal recessive osteopetrosis with variable clinical severity

Pangrazio et al.,
1Unita Organizzativa di Supporto/Istituto di Ricerca Genetica e Biomedica, Milan Unit, CNR, Milano, Italy 2Humanitas Clinical and Research Center, Rozzano, Italy 3Division of Immunology, Department of Pediatrics, University of Gothenburg, Gothenburg, Sweden

... the UCSF Chimera package. PovRay was used to generate high-quality images. The effect of the mutation c.111 + 5G > C was tested using the software www.fruitfly.org, www.cbs.dtu.dk, and www.linux1.softberry.com. Results. ...


Antibiotics
2013, 2(1), 11-27; doi:10.3390/antibiotics2010011

The Staphylococcus aureus Membrane Protein SA2056 Interacts with Peptidoglycan Synthesis Enzymes

Quiblier et al.,
1 Institute of Medical Microbiology, University of Zurich / Gloriastrasse 32, 8006 Zurich, Switzerland 2 Centre of Quality Control in Microbiology / ul. Chelmska 30/34, 00-725 Warsaw, Poland

... downstream of both femX and sa2056 [15]. Apart from the promoter upstream of femX, the program softberry identified an additional putative promoter in the intergenic region between femX and sa2056 [16]. Microarray analyses ...


Advance Journal of Food Science & Technology
2013, Vol. 5 Issue 4, p440-444. 5p.

Cloning of Formate dehydrogenase Gene and Effect on the Waterlogging Tolerance of Brassica napus L

Xu et al.,

... 442 expasy. org and http://www.softberry.com/ berry. phtml). Evaluation of waterlogging tolerance of 12 materials: One-hundred seeds were submerged in 10 mL of deionized water in tubes for 24 h in an incubator at 20°C (Ueno and Takahashi, 1997). ...


HAYATI Journal of Biosciences
Vol 20, No 3 (2013)

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

LUCIA KUSUMAWATI, KATHRYN KURAN, NIJAT IMIN, ULRIKE MATHESIUS, MICHAEL DJORDJEVIC

... The open reading frame from Softberry was blasted to the University of Oklahoma Medicago truncatula genome blast server (http://www.genome.ou.edu/medicago_ blast.html) using blastn to get the contig number (for example mtgsp_008f03.Contig1 for FAD). ...


Applied Microbiology and Biotechnology
Volume 97, Issue 5 , pp 1941-1952 DOI:10.1007/s00253-012-4044-x

Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen

Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China 2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China

... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry. com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...


Biology of Reproduction
89(4):Article 98, 1-11. 2013 doi: http://dx.doi.org/10.1095/biolreprod.113.111849

Expression, Regulation, and Promoter Activation of Vanin-2 (VNN2) in Bovine Follicles Prior to Ovulation

Khampoun Sayasith 2, Jean Sirois , and Jacques G. Lussier
Centre de recherche en reproduction animale and the departement de biomedicine veterinaire, Faculte de medecine veterinaire, Universite de Montreal, Saint-Hyacinthe, Quebec, Canada 2Correspondence: Khampoun Sayasith, Centre de recherche en reproduction animale and the departement de biomedecine veterinaire, Faculte de medecine veterinaire, Universite de Montreal, Saint-Hyacinthe, Quebec, Canada

... The promoter sequence was analyzed to identify consensus cis-acting elements (TFSEARCH: TRANS FAC databases [release date December 1999 and previously hosted at http://motif.genome.jp/]; Transfac DB, Biobase GmbH [http://linux1.softberry.com/berry.phtml], ...


Fungal Genetics and Biology
Volume 61, December 2013, Pages 69–79 DOI:10.1016/j.fgb.2013.10.006

Disruption of the nitrogen regulatory gene AcareA in Acremonium chrysogenum leads to reduction of cephalosporin production and repression of nitrogen metabolism

Jinyang Li a, b, 1, Yuanyuan Pan a, 1, Gang Liu a
a State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China b University of Chinese Academy of Sciences, Beijing 100049, China

... The insert in the resulting plasmid was verified by sequencing. To confirm AcareA, the large fragment containing speculated AcareA was analyzed by software softberry. 2.4. Disruption, complementation and overexpression of AcareA. ...


PloS one
November 13, 2013DOI: 10.1371/journal.pone.0079036

Identification and Molecular Characterization of FKF1 and GI Homologous Genes in Soybean

Li et al.,
MOA Key Lab of Soybean Biology (Beijing), National Key Facility of Crop Gene Resource and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Haidian District, Beijing, China CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, China

... three GI homologs were determined based on further analysis in Softberry database (http://www.softberry.com/berry.phtml). ...


Molecular Biology Reports
Volume 40, Issue 10 , pp 5907-5912 DOI:10.1007/s11033-013-2697-x

Construction and application of the vectors to identify genes encoding exported proteins of Escherichia coli

Niu et al.,
1. College of Animal Sciences, Zhejiang University, Hangzhou, 310058, China 2. Veterinary Bureau of Yuhang District, Hangzhou, 311100, China

... gorf/, http://bioinformatics.biol.rug.nl/websoftware/orf/orf_start.php), signal peptide prediction (http://www.cbs.dtu.dk/services/SignalP/) and promoter analysis tools (http://www.fruitfly.org/ seq_tools/promoter.html, http://molbiol-tools.ca/promscan/, http://linux1.softberry.com/berry ...


Microbiological Research
Volume 168, Issue 8, 1 October 2013, Pages 477–484 DOI:10.1016/j.micres.2013.04.002

A serine hydroxymethyltransferase from marine bacterium Shewanella algae: Isolation, purification, characterization and l-serine production

Wei Jiang, Bingzhao Xia, Ziduo Liu
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China

... A fragment sequence (722 bp) was obtained by PCR with degenerate primers, DP-F and DP-R. Then through TAIL-PCR, sequences matching and executing the ORF-finding program on DNA sequence (http://linux1.softberry.com/berry.phtml), the full-length sequence of the ...


Applied Microbiology and Biotechnology
Volume 97, Issue 11 , pp 4965-4976 DOI:10.1007/s00253-013-4851-8

ku70 and ku80 null mutants improve the gene targeting frequency in Monascus ruber M7

Yi He, Qingpei Liu, Yanchun Shao, Fusheng Chen
3. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China 1. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China

... Sequence prediction (http://linuxl.softberry.com/berry.phtml) of these two frag- ments revealed that the putative M. ruber M7 ku70 gene consists of a 1,905-nt long open reading frame (ORF) interrupted by five introns and the putative M. ruber M7 ku80 gene consists of a 1,998-nt ...


The Journal of Neuroscience
28 August 2013, 33(35): 14087-14097; doi: 10.1523/JNEUROSCI.2710-13.2013

Small-Fiber Neuropathy Nav1.8 Mutation Shifts Activation to Hyperpolarized Potentials and Increases Excitability of Dorsal Root Ganglion Neurons

Huang et al.,
1Department of Neurology and 2Center for Neuroscience and Regeneration Research, Yale University School of Medicine, New Haven, Connecticut 06510,

... Polyphen-2, and Sift characterize the substitution as “c25, likely to interfere with function,” “possibly damaging,” and “nontolerated.” Splice prediction programs (SpliceSiteFinder, MaxEntScan, NNSplice, GeneSplicer, Human Splicing Finder, Fruitfly, and Softberry) predict that ...


3 Biotech
September 2013, DOI:10.1007/s13205-013-0164-y

Siderophore biosynthesis genes of Rhizobium sp. isolated from Cicer arietinum L.

Bejoysekhar Datta, Pran K. Chakrabartty
1. Department of Botany, University of Kalyani, Nadia, Kalyani, West Bengal, 741 235, India 2. Acharya J.C. Bose Biotechnology Innovation Centre, Madhyamgram Experimental Farm, Madhyamgram, Kolkata, West Bengal, 700 129, India

... an operon. In the sequence of 4,921 bp, a probable ribosome-binding site (AGGAGG) was identified six bp upstream of the ATG start codon of sidC of BICC 651 using Promoter prediction search tool (www.softberry.com). A presumable ...


BMC Genetics
2013, 14:51 doi:10.1186/1471-2156-14-51

Linking the potato genome to the conserved ortholog set (COS) markers

Lindqvist-Kreuze et al.,
1 International Potato Center, Lima, Peru 2 USDA-Agricultural Research Service, Vegetable Crops Research Unit, University of Wisconsin, Madison, WI, USA

... genome sequence, but no gene hit. We ran those genome regions through Softberry gene prediction and were able to identify genes matching the COS marker hit region (results not shown). Further work focusing on the genome ...


Molecular Plant-Microbe Interactions
(2013). 26(6), 676-685. DOI:

A Rhamnose-Rich O-Antigen Mediates Adhesion, Virulence, and Host Colonization for the Xylem-Limited Phytopathogen Xylella fastidiosa

Clifford, J. C., Rapicavoli, J. N., & Roper, M. C.
Department of Plant Pathology and Microbiology, University of California, Riverside 92512, U.S.A.

... Online tools used for DNA manipulation and DNA and protein analysis were Integrated Microbial Genomes, the National Center for Biotechnology Information, San Diego Supercomputer Center Biology Workbench, Netprimer, and SoftBerry. Mutagenesis and complementation. ...


Journal of bacteriology
(2013). 195(4), 896-907. DOI:10.1128/JB.01973-12

Identification of the Treponema pallidum subsp. pallidum TP0092 (RpoE) Regulon and Its Implications for Pathogen Persistence in the Host and Syphilis Pathogenesis

Giacani, L., Denisenko, O., Tompa, M., & Centurion-Lara, A.
aDepartments of Medicine bComputer Science and Engineering, University of Washington, Seattle, Washington, USA

...Transcription unit prediction (using http://linux1.softberry.com), hydropathy plot analysis (using http://web.expasy.org/protscale/), and prediction of transmembrane regions (using http://www.ch.embnet.org/software/TMPRED_form.html) identified TP0093 as the best putative anti-? factor for TP0092....


Journal of Invertebrate Pathology
Volume 110, Issue 1, May 2012, Pages 24?32, DOI: 10.1016/j.jip.2012.01.008

The lipopolysaccharide biosynthesis core of the Mexican pathogenic strain Serratia entomophila is associated with toxicity to larvae of Phyllophagablanchardi

Zitlhally Rodriguez-Segura b, Jianwu Chen c, Francisco J. Villalobos d, Sarjeet Gill c, Maria Eugenia Nunez-Valdez a
a Facultad de Ciencias, Universidad Autonoma del Estado de Morelos, Av. Universidad 1001, Col. Chamilpa, CP 62209, Cuernavaca, Morelos, Mexico b Centro de Investigacion en Biotecnologia, Universidad Autonoma del Estado de Morelos, Av. Universidad 1001, Col. Chamilpa, CP 62209, Cuernavaca, Morelos, Mexico

... Automated sequencing was performed at the University of California Riverside Core Instrumentation Facility. DNA sequences were analyzed by the Softberry Inc. software. ... According to the DNA sequence analysis done by using the Softberry, Inc. ...


Journal of Bone and Mineral Research
DOI: 10.1002/jbmr.1849

SNX10 mutations define a subgroup of human Autosomal Recessive Osteopetrosis with variable clinical severity

Pangrazio et al.,
1UOS/IRGB, Milan Unit, CNR, Milano, Italy 2Humanitas Clinical and Research Center, Rozzano, Italy

... Chimera package. PovRay was used to generate high quality images. The effect of the mutation c.111+5G>C was tested using the software www.fruitfly.org, www.cbs.dtu.dk and www.linux1.softberry.com. Results Genetic findings ...


Journal of Integrative Agriculture
Volume 11, Issue 10, October 2012, Pages 1592–1600 DOI: 10.1016/S2095-3119(12)60162-2

Isolating the Mutator Transposable Element Insertional Mutant Gene mio16 of Maize Using Double Selected Amplification of Insertion Flanking Fragments (DSAIFF)

ZHONG et al.,
a National Key Laboratory of Crop Genetic Improvement/Huazhong Agricultural University, Wuhan 430070, P.R. China b Institute of Upland Food Crops, Guizhou Academy of Agricultural Sciences/Guizhou Center of Maize Engineering Techniques, Guizhou 550006, P.R. China

... The alignment between the genomic sequence and the cDNA showed that the Mio16 gene contained a 2 550-bp ORF encod- ing a putative 850 aa protein (http://www. softberry. com), which was composed of 11 exons and 10 introns. ...


PLoS ONE
7(5): e37611. doi:10.1371/journal.pone.0037611

A Unique Regulator Contributes to Quorum Sensing and Virulence in Burkholderia cenocepacia

O'Grady EP, Viteri DF, Sokol PA
Department of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, Alberta, Canada

... 1). BCAM1871 expression appeared to be driven from the cepI promoter as no other promoter was identified upstream of the BCAM1871 ORF using promoter prediction software (www.softberry.com or http://www.fruitfly.org, data not shown). ...


Advanced Science Letters
(2012) Volume 10, Number 1, pp. 153-157(5) DOI: 10.1166/asl.2012.3745

Isolation and Characterization of An Aldo-Keto Reductase cDNA from Camellia Oleifera Seed

Shao, Gongfeng; Tan, Xiaofeng; Chen, Hongpeng,
Laboratory

...Second Structure Analysis and 3D Structure Prediction The Softberry Platform figured out that -helix and -sheet were the main components in the second structure of Co-AKR ..


Advanced Science Letters
(2012) Volume 10, Number 1, pp. 168-172(5) DOI: 10.1166/asl.2012.3722

A Novel Metallothionein Gene Putatively Related to Fatty Acid Biosynthesis in Camellia Oleifera Seeds Confronted to Heavy Metal Stress.

Zhu, Fengyun; Tan, Xiaofeng; Chen, Hongpeng

...The sub-cellular location result predicted by Softberry revealed Co-MT deposit in cytoplasmid and it was a secreted protein. ...


mBio
3(3):e00035-12. doi:10.1128/mBio.00035-12.

Nontypeable Pneumococci Can Be Divided into Multiple cps Types, Including One Type Expressing the Novel Gene pspK

In Ho Park et al.,
Department of Pathology, School of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USAa; Department of Pediatrics, School of Medicine, Ewha Womans University, Seoul, South Korea

...Insertional sequences and the open reading frames (ORFs) in the DNA sequences were identified using a BLAST search at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST), Softberry (http://www.softberry.com) free web-based software,...


J Mol Endocrinol
April 1, 2012 48 89-97 DOI: 10.1530/JME-11-0105

17b-Estradiol regulates cyclin A1 and cyclin B1 gene expression in adult rat seminiferous tubules

Camille Bois 1,2, Christelle Delalande 1,2, Helene Bouraima-Lelong 1,2, Philippe Durand 3 and Serge Carreau 1,2
1Universite de Caen Basse Normandie, EA 2608, Laboratoire «Estrogenes et Reproduction», Esplanade de la Paix, F-14032 Caen Cedex, France 2INRA USC 2006, F-14032 Caen, France

... al. 1990). Promoter regions of cyclin A1 and cyclin B1 gene were analyzed using TF Search and Softberry online software. The threshold was fixed at 0.85. Terminal dUDP transferase nick end labeling. Squash preparations ...


Applied Microbiology and Biotechnology
April 2012 DOI: 10.1007/s00253-012-4044-x

Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen

Zhilan Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China 2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China

... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry. com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...


Journal of Integrative Agriculture
Volume 11, Issue 6, June 2012, Pages 898–909 DOI: 10.1016/S2095-3119(12)60080-X,

Cloning and Characterization of a Somatic Embryogenesis Receptor-Like Kinase Gene in Cotton (Gossypium hirsutum)

Ya-li SHI*, Rui ZHANG*, Xiao-ping WU, Zhi-gang MENG, San-dui GUO
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R. China

... The full- length cDNA sequence was obtained by primers GS1- 5PF and GS1-3PR (Table 2). Sequence analysis The full-length genomic sequence obtained was analyzed using the Softberry program (http://linux1.softberry.com/ berry.phtml). ...


American Journal of Molecular Biology
2012 Volume 2, Issue 2 , pp 132-139

Molecular cloning and characterization of fruit specific promoter from Cucumis sativus L.

Sindhu Chandrika Unni ; Padmanabhan Jayanthikumari Vivek ; Thakidiyil Thankappan Maju ; Rintu Thundiyil Varghese ; Eppurathumana Vasudevan Soniya

... promoter for successful fruit specific expression and this region was amplified using PRF and PRR primers (Figure 1(e)). The 1.5 kb promoter region along with the 5' region of expansin gene was shown in Figure 2. Transcription start site was predicted using Softberry online tool ...


Genetica
Volume 140, Issue 7-9 , pp 337-347 DOI: 10.1007/s10709-012-9685-2

Characterization of an Ac transposon system based on apt1-m1 (Ac) on the long arm of maize chromosome 9

Fei Wang et al.,
1. School of Life Sciences, Shanghai Key Laboratory of Bio-energy Crop, Shanghai University, 333 Nanchen Road, Shanghai, 200444, People’s Republic of China

... analysis. If the tr-Ac/Ds inserted into a gene, the gene structure could be identified based on annotations in maizesequence (www.maizesequence.org) and prediction using gene-finding tools for Eukaryota (www.softberry.com). ...


AEM
Published ahead of print 24 August 2012, DOI: 10.1128/AEM.02065-12

Unveiling the expression characteristics of IspC, a cell wall-associated peptidoglycan hydrolase in Listeria monocytogenes during growth under stress conditions

Jennifer Ronholm 1,2, Xudong Cao 3 and Min Lin 1,2
1Canadian Food Inspection Agency, Ottawa Laboratory Fallowfield, Ottawa, Ontario K2H 8P9, Canada 2Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada

... Corresponding to this experimentally determined TSS, there are 209 -10 (TGGTAAAAT) and -35 (TTGTTA) elements spaced by 19bp, as predicted by a bacterial 210 promoter program (http://linux1.softberry.com) (Fig. 1). Examination of the sequence in this 211 ...


Theoretical and Applied Genetics
Volume 125, Issue 8 , pp 1717-1726 DOI: 10.1007/s00122-012-1948-x

Mapping and characterization of the major quantitative trait locus qSS7 associated with increased length and decreased width of rice seeds

Xianjin Qiu, Rong Gong, Youbin Tan, Sibin Yu
1. National Key Laboratory of Crop Genetic Improvement, and College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, China

... The 23-kb target region contains two common predicted genes (LOC_Os07g41200, LOC_Os07g41210) based on three genome annotation databases (http://rice.plantbiology. msu.edu/; http://ricegaas.dna.affrc.go.jp/; http://linux1.softberry.com/) (Fig. ...


Viruses.
2012 April; 4(4): 581–612. Published online 2012 April 16. doi: 10.3390/v4040581

RNA-Sequencing Analysis of 5' Capped RNAs Identifies Many New Differentially Expressed Genes in Acute Hepatitis C Virus Infection

Papic et al.,
1 Department of Medicine, University of Utah, 30 N 1900 E #3C310, Salt Lake City, UT 84132, USA 2 Huntsman Cancer Institute, University of Utah, 30 N 1900 E #3C310, Salt Lake City, UT 84132, USA

...Using the ORF Finder software (Softberry) we found a small peptide of 48 amino acids encoded in this unannotated transcript ...


Insect Molecular Biology
Volume 21, Issue 4, pages 395–404, August 2012 DOI: 10.1111/j.1365-2583.2012.01145.x

Physiological significance of alternatively spliced exon combinations of the single-copy gene class A chitin synthase in the insect Ostrinia furnacalis (Lepidoptera)

M. Qu, Q. Yang
School of Bioscience and Biotechnology, Dalian University of Technology, Dalian, China

... DNA and protein sequence analyses. DNA sequence data for OfCHSA (GenBank ID: EU376026) were translated to amino acids by DNAMAN software (Lynnon, Quebec, Canada). The splicing sites of OfCHSA were analysed with SoftBerry (http://www.softberry.com/all.htm). ...


Front Plant Sci.
2012; 3: 54. DOI: 10.3389/fpls.2012.00054

Turnover of Phosphatidic Acid through Distinct Signaling Pathways Affects Multiple Aspects of Pollen Tube Growth in Tobacco

Pleskot et al.,
1Institute of Experimental Botany, v. v. i., Academy of Sciences of the Czech Republic, Prague, Czech Republic 2Department of Experimental Plant Biology, Faculty of Science, Charles University in Prague, Prague, Czech Republic

... Since gene models based on computer annotations often contain errors, exon-intron structures were manually curated using SoftBerry server4 with the aid of experimentally verified sequences or sequences from closely related species. ...


Molecular Microbiology Volume 86, Issue 2, pages 394–410, October 2012
DOI: 10.1111/j.1365-2958.2012.08203.x

sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis-dependent release of eDNA

Christner et al.,
1Institute for Medical Microbiology, Virology and Hygiene, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany 2Institute for Clinical Chemistry, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

... Bioinformatics analysis of 150 nucleotides up-stream of the embp start codon identified three high affinity SarA binding sites as defined by Sterba and co-workers (Sterba et al., 2003), two located near or within the anticipated ?10 region (http://linux1.softberry.com), suggesting ...


J. Virol.
November 2012 vol. 86 no. 21 11937-11938 doi: 10.1128/?JVI.02009-12

Complete Genome Sequence of a J Subgroup Avian Leukosis Virus Isolated from Local Commercial Broilers

Hongxin Li et al.,
a College of Animal Science, South China Agricultural University, Guangzhou, China

... Japan), sequenced three times, and assembled using DNAStar (version 7). Multiple-sequence alignment was performed with Clustal X (BioEdit version 7). The transcriptional regulatory elements in noncoding regions of the genome were analyzed with SoftBerry (Softberry, Inc ...


Journal of Biotech Research
[ISSN: 1944-3285] 2012; 4:54-64

Acetogen biocatalyst Clostridium sp. MTEtOH871 engineered with our proprietary electrotransformation technology and equipment: continuous synthesis gas fermentation for selective ethanol production

Vel Berzin and Michael Tyurin*
Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX 77019, USA.

... Promoter and terminator sequences were identified using Softberry Bacterial Promoter, Operon and Gene finding tool (http://linux1.softberry.com/). We used the origin of replication of a ~35-copy number 1.8 kb cryptic plasmid pMT351 we have isolated previously from the ...


J. Virol.
doi: 10.1128/?JVI.01894-12 October 2012 vol. 86 no. 19 10907-10908

Complete Genome Sequence of an Avian Leukosis Virus Isolate Associated with Hemangioma and Myeloid Leukosis in Egg-Type and Meat-Type Chickens

Jun Ji et al.,
aCollege of Animal Science, South China Agricultural University, Guangzhou, China bCollege of Veterinary Medicine, South China Agricultural University, Guangzhou, China

... Multiple-sequence alignment was performed with Clustal X (BioEdit version 7). The transcriptional regulatory elements in noncoding regions of the genome were analyzed with SoftBerry (Softberry, Inc., Mount Kisco, NY). Comparative ...


Molecular Biology Reports
July 2012, Volume 39, Issue 7, pp 7347-7353 DOI 10.1007/s11033-012-1566-3

Assay and characterization of an osmolarity inducible promoter newly isolated from Bacillus subtilis

Wei-Wei Zhang (1) Qiu-Rong Gao (1) Ming-Ming Yang (2) Hui Liu (2) Dun Wang (1)
1. College of Life Sciences, Northwest A&F University, Yangling, 712100, People’s Republic of China 2. College of Animal Sciences, Yangling, 712100, People’s Republic of China

... Analysis of DNA sequence of the pro- moter-active fragment was carried out online with NCBI blast 2.0 (http: www.ncbi.nih.gov). The promoter was predicted by softberry (http: www.softberry.com). Results and discussion Characterization of an osmolarity-inducible promoter ...


Journal of Plant Physiology
Volume 169, Issue 11, 15 July 2012, Pages 1112–1120

Molecular characterization of two ethylene response factor genes in sweetpotato that respond to stress and activate the expression of defense genes in tobacco leaves

Yun-Hee Kima, 1, Jae Cheol Jeonga, 1, Seyeon Parka, b, Haeng-Soon Leea, b, Sang-Soo Kwaka, b,
a Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Gwahak-ro 125, Yuseong-gu, Daejeon 305-806, Republic of Korea b Green Chemistry and Environmental Biotechnology, University of Science and Technology (UST), 217 Gajungro, Yuseong-gu, Daejeon 305-350, Republic of Korea

... To predict the isoelectric point (pI), molecular weight and signal peptides of the deduced proteins, the ExPasy (http://www.expasy.org/tools), PSORT (http://psort.ims.u-tokyo.ac.jp) and SoftBerry (http://www.softberry.com) programs were used. Subcellular localization of ERFs. ...


African Journal of Biotechnology
Vol. 11 (29), pp. 7378-7387, 10 April, 2012 DOI: 10.5897/AJB11.2875

Isolating Barley (Hordeum vulgare L.) B1 Hordein Gene Promoter and Using Sequencing Analaysis For The Identification of Conserved Regulatory Elements By Bioinformatic Tools

Kobra Nalbandi1, Bahram Baghban Kohnehrouz2* , Khalil Alami Saeed1 and Ashraf Gholizadeh3
1Ramin Agricultural and Natural Resources University, Mollasani, Ahwaz, Iran. 2Department of Plant Breeding and Biotechnology, University of Tabriz, Tabriz, Iran. 3Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Tabriz, Iran.

... Hor.W. To find regulatory elements in promoter sequences, the PLANTCARE (http://bioinformatics.psb.ugent.be/ webtools/plantcare/html) and Softberry (http://linux1.softberry.com/berry.phtml) software were applied. Analysis ...


Polar Biology
October 2012, Volume 35, Issue 10, pp 1515-1524 DOI 10.1007/s00300-012-1191-6

Characterization and expression analysis of three cold shock protein (CSP) genes under different stress conditions in the Antarctic bacterium Psychrobacter sp. G

Weizhi Song (1) (2) Xuezheng Lin (1) (2) Xiaohang Huang (1) (2)
1. First Institute of Oceanography, SOA, Qingdao, 266061, China 2. Key Lab of Marine Bioactive Substances, SOA, Qingdao, 266061, China

... The regulatory sequences (ie, -10 region, -35 region, ribosomal binding site (RBS), DB, and ORF) were analyzed using the Softberry (http:// linux1.softberry.com/berry.phtml) (Panicker et al. 2010) and Neural Network Promoter Prediction (http://www. ...


Advanced Science Letters
Volume 10, Number 1, May 2012 , pp. 146-152(7) DOI: http://dx.doi.org/10.1166/asl.2012.3743

Cloning and Bioinformatics Analysis of a Peroxidase Gene from Camellia Oleifera Seed

Chen, Hongpeng; Tan, Xiaofeng; Shao, Gongfeng

... and chemical property of predicted protein, genetic evo- lution, homology modeling, 3D structural optimization and ren- dering were analyzed with Codon W, Antheprot 5.0, Clustral X, SWISS-MODEL sever, VMD1.8.5 and POV-Ray respectively, NCBI center, Softberry platform ...


Gene.
2012 Oct 1;507(1):9-19. Epub 2012 Jul 24.

BnC15 and BnATA20, the different putative components, control anther development in Brassica napus L.

Wan L, Hu Q, Hong D, Yang G.
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei, PR China.

... downstream of the coding sequence. Full cDNA sequence was analyzed using Softberry (http://linuxl.softberry.com/berry.phtml) and GeneScan Web Server (http://genes.mit.edu/- GENSCAN.html). The deduced protein was viewed ...


Molecular Breeding
Volume 29, Issue 4 , pp 939-949 DOI 10.1007/s11032-011-9644-0

Validation of DGAT1-2 polymorphisms associated with oil content and development of functional markers for molecular breeding of high-oil maize

Yuchao Chai et al.,
1. National Maize Improvement Center of China, Beijing Key Laboratory of Crop Genetic Improvement, China Agricultural University, Beijing, 100193, China 2. Pioneer Hi-Bred International Inc., Johnston, IA, 50131–1004, USA

... 2008) was used to BLAST against the maize high-throughput genomic sequences database (www.ncbi.nlm.nih.gov) to obtain the B73 genomic sequence. The gene structure was predicted using online tools from the Softberry web site (www.softberry.com). ...


Animal Biotechnology
Volume 23, Issue 3, 2012 pages 156-173 DOI:10.1080/10495398.2012.662925

Screening of a Xylanase Clone from a Fosmid Library of Rumen Microbiota in Hu Sheep

Dr. Jiakun Wang et al.,
a College of Animal Sciences, Zhejiang University, Hangzhou, China b Center for Biomedicine and health, Hangzhou Normal University, Hangzhou, China

... The GC composition was studied using the DNAStar software. Open reading frames (ORFs) were characterized using Softberry online program using the criteria of sequences encoding peptides longer than 50 amino acids (http://linux1.softberry.com/berry.phtml). ...


Letters in Applied Microbiology
Volume 55, Issue 2, pages 149–154, August 2012 DOI: 10.1111/j.1472-765X.2012.03272.x

Selective production of acetone during continuous synthesis gas fermentation by engineered biocatalyst Clostridium sp. MAceT113

V. Berzin1, M. Kiriukhin2, M. Tyurin1
1 ?Syngas Biofuels Energy, Inc., Houston, TX, USA 2 Ajinomoto – Genetika Research Institute, Moscow, Russia

... ljungdahliiDSM13528 (NC_014328, region 1295679…1297232, nucleotides 1–564). Promoter and terminator sequences used in both vectors were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). ...


International Journal of Medical Microbiology
Volume 302, Issue 3, July 2012, Pages 117–128 http://dx.doi.org/10.1016/j.ijmm.2012.03.003

Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1,3-diaminopropane

Evelyn Skiebe et al.,
a Robert Koch-Institute, Wernigerode Branch, D-38855 Wernigerode, Germany b CEA, DSV, IG, Genoscope, 2 rue Gaston Cremieux, 91057 Evry, France

... A 3815-bp fragment encompassing genes A1S-2453 (ddc) and A1S-2454 (dat) as well as the putative promoter and terminator regions (analysed with the softberry package available online: http://linux1.softberry.com/berry.phtml) was amplified by PCR (see Fig. ...


Applied Biochemistry and Biotechnology
Volume 167, Issue 2 , pp 338-347 DOI 10.1007/s12010-012-9697-5

Elimination of Acetate Production to Improve Ethanol Yield During Continuous Synthesis Gas Fermentation by Engineered Biocatalyst Clostridium sp. MTEtOH550

Vel Berzin (1) Michael Kiriukhin (2) Michael Tyurin (1)
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA 2. Ajinomoto-Genetika Research Institute, 1st Dorozhny pr. 1-1, Moscow, Russia, 117545

... 2627526) flanking cat gene (FM201786) CDS. Promoter and terminator sequen- ces were identified using Softberry Bacterial Promoter, Operon and Gene finding tool (http:// linux1.softberry.com/). Detection of synthetic cat was ...


Gene
Volume 498, Issue 2, 1 May 2012, Pages 280–287

DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA)

Tatiana E. Erova a, Valeri G. Kosykh b, Jian Sha a, Ashok K. Chopra a
a Department of Microbiology & Immunology, University of Texas Medical Branch, Galveston, TX 77555-1070, USA b Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-1070, USA

... vector (Invitrogen, Carlsbad, CA). Upstream sequences of the gidA and act genes of A. hydrophila SSU contained promoter regions, which we identified by using the SoftBerry program (www.softberry.com). To obtain PCR products ...


Mol. Plant
(2012) 5 (5): 1042-1057. doi: 10.1093/mp/sss003

The Arabidopsis AP2/ERF Transcription Factor RAP2.11 Modulates Plant Response to Low-Potassium Conditions

Min Jung Kima, Daniel Ruzickaa, Ryoung Shinb and Daniel P. Schachtmana,c,1
aDonald Danforth Plant Science Center, St Louis, MO 63132, USA bRIKEN Plant Science Center, Yokohama, Kanagawa 230-0045, Japan

... (A) AtHAK5 promoter contains ERE, CGTCA (MeJA responsiveness), ABRE (ABA responsiveness), GCC-box, and CE3 (ABA responsiveness) elements. SoftBerry (www.softberry.com/berry.phtml) was used as a promoter prediction tool. ...


Journal of Biotech Research
2012; 4:1-12

Electrofusion of cells of Acetogen Clostridium sp. MT 351 with erm(B) or cat in the chromosome

Michael Tyurin 1, *, Michael Kiriukhin 2, Vel Berzin 1
1Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX 77019, USA. 2Ajinomoto Company, 1st Dorozny pr. 1-1, Moscow, Russia 117545

... downstream of erm(B) (AY334073), respectively. Promoter and terminator sequences were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). The resulted synthetic ermB operon ...


Theoretical and Applied Genetics
August 2012 DOI 10.1007/s00122-012-1954-z

QTL mapping of resistance to gray leaf spot in maize

Yan Zhang et al.,
1. National Maize Improvement Center of China, China Agricultural University, 2 West Yuanmingyuan Road, Haidian District, Beijing, 100193, People’s Republic of China 2. Institute of Food Crops, Yunnan Academy of Agricultural Sciences, Longtou Street, Kunming, 650205, People’s Republic of China

... In an attempt to find out more InDels, we predicted putative genes in the single-/low- copy sequence using tools in software SoftBerry (http:// linux1.softberry.com/berry.phtml), and designed primers in either 50- or 30- ends of the predicted genes as high-level polymorphism is ...


Applied Biochemistry and Biotechnology
September 2012 DOI 10.1007/s12010-012-9864-8

Cre-lox66/lox71-Based Elimination of Phosphotransacetylase or Acetaldehyde Dehydrogenase Shifted Carbon Flux in Acetogen Rendering Selective Overproduction of Ethanol or Acetate

Vel Berzin (1) Michael Kiriukhin (2) Michael Tyurin michael@syngasbiofuelsenergy.com (1)
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA 2. Ajinomoto—Genetika Research Institute, 1st Dorozhny pr. 1-1, Moscow, Russia, 117545

... Inactivation of pta was performed as described [13] using integration vector pMT674pta. Promoter and terminator sequences used in all integration vectors were identified using Softberry Bacterial Promoter, Operon, and Gene Finding tool (http://linux1.softberry.com/). PCR ...


The Journal of Immunology
July 15, 2012 vol. 189 no. 2 539-550 doi: 10.4049/jimmunol.1103204

Identification, Cloning, and Functional Characterization of the IL-1 Receptor Antagonist in the Chicken Reveal Important Differences between the Chicken and Mammals

Mark S. Gibson*, Mark Fife*, Steve Bird†, Nigel Salmon* and Pete Kaiser*,1
*Institute for Animal Health, Compton, Berkshire RG20 7NN, United Kingdom; and †Department of Biological Sciences, School of Science and Engineering, University of Waikato, Hamilton 3240, New Zealand

... HE608245). Putative promoter regions were analyzed using Softberry (http://linux1. softberry.com/berry.phtml). 5? RACE was carried out using the SMARTer RACE cDNA amplification kit (Clontech) following the manufacturer's instructions. ...


Plant Molecular Biology Reporter
August 2012 DOI 10.1007/s11105-012-0499-2

Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid

Seok Yien Christina Yong (1) Ratnam Wickneswari wicki@ukm.my (2)
1. Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, Malaysia 2. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia

... cgi /iprscan.cgi). Promoter sequence was analyzed using Prediction of Plant Promoter (http:// www.softberry.com/berry.phtml) and Neural Network Pre- diction (http://www.fruitly.org/seq_tools/promoter.html) software. The cDNA ...


Insect Biochemistry and Molecular Biology
Available online 25 September 2012 http://dx.doi.org/10.1016/j.ibmb.2012.09.006 In Press, Uncorrected Proof — Note to users

Expansion of the silkworm GMC oxidoreductase genes is associated with immunity

Wei Sun a et al.,
a The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400715, China b College of Life Sciences, Chongqing University, Chongqing 400044, China

... domains. It was hypothesized that either of these two genes could be two single genes. Indeed, both of them could be divided into two genes when re-analyzed using Softberry (http://linux1.softberry.com/berry.phtml). Therefore ...


Antimicrob. Agents Chemother.
August 2012 vol. 56 no. 8 4450-4458 doi: 10.1128/?AAC.00456-12

Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae

Mark Veleba a
aCentre for Infection and Immunity, Queen's University Belfast, Medical Biology Centre, Belfast, United Kingdom bInstitute for Medical Microbiology, Immunology and Hygiene, University of Cologne, Cologne, Germany

... The junction between the C tail and the start site of rarA open reading frame was taken to be the transcriptional start site. Predictions of the putative ?10 and ?35 hexamers were determined using SoftBerry analysis of the intergenic region. ...


Cellular Signalling
Volume 25, Issue 1, January 2013, Pages 168–177 http://dx.doi.org/10.1016/j.cellsig.2012.09.006,

Structural diversity of the cAMP-dependent protein kinase regulatory subunit in Caenorhabditis elegans

Martyna W. Pastok et al.,
Institute of Integrative Biology, University of Liverpool, Biosciences Building, Crown St., Liverpool, L69 7ZB, United Kingdom

... http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi), Grail (http://compbio.ornl.gov/Grail-1.3/), GeneScan (http://genes.mit.edu/GENSCAN.html) and GeneFinder (http://www.bioscience.org/ urllists/genefind.htm) together with various tools available from Softberry (http://linux1 ...


MPMI
November 2012, Volume 25, Number 11 Pages 1419-1429 http://dx.doi.org/10.1094/MPMI-06-12-0155-R

A Polyketide Synthase Gene, ACRTS2, Is Responsible for Biosynthesis of Host-Selective ACR-Toxin in the Rough Lemon Pathotype of Alternaria alternata

Y. Izumi et al.,
1Faculty of Agriculture, Kagawa University, Miki, Kagawa 761-0795 Japan; 2Department of Plant Pathology, Washington State University, Pullman 99164-6430 U.S.A.

... with the largest contig at approximately 41 kb. One 17 kb contig (C14014) contained 12 three open reading frames (ORFs) that encoded two unknown proteins and a putative 13 PKS, identified via SoftBerry and BLAST/FASTA searches. The putative 14 ...


Human Mutation
Volume 33, Issue 11, pages 1576–1588, November 2012 DOI: 10.1002/humu.22142

Comprehensive functional assessment of MLH1 variants of unknown significance

Ester Borras et al.,
1 Hereditary Cancer Program, Catalan Institute of Oncology, ICO-IDIBELL, Hospitalet de Llobregat, Spain 2 Medical Clinic 1, Johann Wolfgang Goethe-University Clinic, Frankfurt, Germany

... To identify potential splicing mutations, disruption or creation of SS were evaluated using NNSplice [Reese et al., 1997], Splicerport [Dogan et al., 2007], NetGene2 Server [Hebsgaard et al., 1996], and SoftBerry [Burset et al., 2001]. ...


Microbial Pathogenesis
Volume 52, Issue 4, April 2012, Pages 227–238 http://dx.doi.org/10.1016/j.micpath.2012.01.004,

The Mycobacterium avium ESX-5 PPE protein, PPE25-MAV, interacts with an ESAT-6 family Protein, MAV_2921, and localizes to the bacterial surface

Michael McNamara a, b, Lia Danelishvili a, Luiz E. Bermudez a, b, c
a Department of Biomedical Sciences, College of Veterinary Medicine, Oregon State University, Corvallis, OR, USA b Molecular and Cellular Biology Program, College of Science, Oregon State University, Corvallis, OR, USA

... PCR analysis (Suppl. Table 4). Bioinformatics analysis of potential operons and terminator sites was performed using Softberry software (Softberry, Mount Kisko, NY). 2.13. Statistical analysis. Each experiment was repeated ...


Extremophiles
Volume 16, Issue 1 , pp 35-43 DOI: 10.1007/s00792-011-0403-2

Effects of salts on activity of halophilic cellulase with glucomannanase activity isolated from alkaliphilic and halophilic Bacillus sp. BG-CS10

Guimin Zhang (1) (2) Shunyi Li (2) Yanfen Xue (1) Liangwei Mao (2) Yanhe Ma (1)
1. State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China 2. College of Life Sciences, Hubei University, Wuhan, 430062, China

... The signal peptide was identified using the SignalP 3.0 server (http:// www.cbs.dtu.dk/ services/SignalP), and the promoter sequence was predicted online (http://linux1. softberry. com/berry.phtml). Construction of the expression plasmid ...


Appl. Environ. Microbiol.
January 2012 vol. 78 no. 2 581-585 DOI 10.1128/?AEM.06611-11

Controlled Gene Expression in Bifidobacteria by Use of a Bile-Responsive Element

Lorena Ruiz et al.,
Department of Microbiology and Biochemistry of Dairy Products, Instituto de Productos Lacteos de Asturias (IPLA), Consejo Superior de Investigaciones Cientificas (CSIC), Villaviciosa, Asturias, Spain

... Schematic representation of the constructs used in this work. (A) Main features of the betA upstream region (unpublished data) deduced after the analysis with Softberry and Neural Network Promoter Prediction. Pin-like symbols represent potential inverted repeats. ...


Scientific Reports
2, Article number: 228 doi:10.1038/srep00228 2012

Recruitment in the sea: bacterial genes required for inducing larval settlement in a polychaete worm

Ying Huang, Sean Callahan & Michael G. Hadfield

... Promoter prediction was performed using the BPROM program, which predicts bacterial promoters and is available through the Softberry website (http://linux1.softberry.com/berry.phtml?topic=index&group=program&subgroup=promoter) ...


Breast Cancer Research and Treatment
Volume 121, Number 1, 177-184, DOI: 10.1007/s10549-009-0532-9

Potentially functional polymorphisms in ESR1 and breast cancer risk: a meta-analysis

Ni Li, Jing Dong, Zhibin Hu, Hongbing Shen and Min Dai
(1) National Office of Cancer Prevention and Control, Cancer Hospital/Institute, Chinese Academy of Medical Sciences, 17 Panjiayuannanli, Chaoyang District, 100021 Beijing, China (2) Department of Epidemiology and Biostatistics, Cancer Center, Nanjing Medical University, 210029 Nanjing, China

... For SNPs in the promoter region and 50UTR, we use software in the web site of Softberry (http://www. softberry.com/berry.phtml) and use TF search (http://www. cbrc.jp/research/db/ TFSEARCH.html) to see the change of transcription factor binding. ... 


Plant Molecular Biology
DOI: 10.1007/s11103-009-9557-z

OsPRP3, a flower specific proline-rich protein of rice, determines extracellular matrix structure of floral organs and its overexpression confers cold-tolerance

Kodiveri Muthukalianan Gothandam 1 , Easwaran Nalini 1, Sivashanmugam Karthikeyan 1 and Jeong Sheop Shin 2
(1) School of Bio Sciences & Technology, VIT University, Vellore, 632 014, Tamil Nadu, India (2) School of Life Sciences & Biotechnology, Korea University, Seoul, 136-701, Korea

... 2000). Nucleotide and deduced amino acid sequence were analyzed with the Basic Local Align- ment Search Tool (BLAST) at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and the Soft berry programme (http://www.softberry.com). ...


Biology of Reproduction
Published online before print March 3, 2010, doi: 10.1095/?biolreprod.109.082644

Kit System in the Zebrafish Ovary--Evidence for Functional Divergence of Two Isoforms of Kit (Kita and Kitb) and Kit Ligands (Kitlga and Kitlgb) During Folliculogenesis

Kai Yao and Wei Ge

... For kitb, a partial genomic sequence was available in the Ensembl Databank ( ENSDARG00000056133; http://www.ensembl.org/Danio_rerio/) and the exons of kitb were predicted by CBS PREDICTION SERVERS (http://www.cbs.dtu.dk/services/) and SOFTBERRY ( ... 


Molecular Biotechnology
Volume 46, Number 2, 127-133, DOI: 10.1007/s12033-010-9277-2

Novel Expression System for Combined Vaccine Production in Edwardsiella tarda Ghost and Cadaver Cells Novel Expression System for Combined Vaccine Production in Edwardsiella tarda Ghost and Cadaver Cells

Seung Hyuk Choi 1, Yoon Kwon Nam 2 and Ki Hong Kim 1
(1) Department of Aquatic Life Medicine, Pukyong National University, Busan, 608-737, Korea (2) Department of Aquaculture, Pukyong National University, Busan, 608-737, Korea

... of the trapped fragment. Based on the bioinformatic prediction of putative promoter region (SOFTBERRY; http://linux1.softberry.com/berry. phtml), a clone (C#28) was chosen for the trimming of the promoter region. From the C ... 


Genetics
Vol. 184, 975-983, April 2010 doi:10.1534/genetics.109.112557

An Interspecific Plant Hybrid Shows Novel Changes in Parental Splice Forms of Genes for Splicing Factors

Moira Scascitelli, Marie Cognet 1 and Keith L. Adams 2
University of British Columbia Botanical Garden and Centre for Plant Research, and Department of Botany, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada

... When gene models were not available, we analyzed putative gene exon/intron structures and protein sequence predictions with gene finding programs from Softberry (http://linux1.softberry. com/berry.phtml). View this table: In this window In a new window, TABLE 1. ... 


Appl. Environ. Microbiol.
doi:10.1128/AEM.01742-10

Ralstonia solanacearum Dps contributes to oxidative stress tolerance, colonization, and virulence on tomato plants

Jennifer M. Colburn-Clifford, Jacob M. Scherf, and Caitilyn Allen
University of Wisconsin-Madison Department of Plant Pathology, 1630 Linden Dr., Madison WI 53706 USA

... Page 6. AEM01742-10 Version 2 -6- as previously described (1). DNA and protein sequences were analyzed using Softberry 118 (http://linux1.softberry.com/berry. phtml), Biology Workbench (http://workbench.sdsc.edu/), 119 ... 


New Biotechnology
Volume 27, Issue 4, 30 September 2010, Pages 289-299 doi:10.1016/j.nbt.2010.01.337

Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene

Subhi Siti Masura 1, Ghulam Kadir Ahmad Parveez 1, and Ismanizan Ismail 2
1 Advanced Biotechnology and Breeding Centre (ABBC), Biological Research Division, Malaysian Palm Oil Board (MPOB), P.O. Box 10620, 50720 Kuala Lumpur, Malaysia 2 School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysia

... assembly. DNA and protein homology searches against GenBank databases were performed using BLAST 2.0 [23]. Prediction of putative location of transcription start sites was carried out using the Softberry database. Identification ... 


Extremophiles
2010 Mar;14(2):171-83. Epub 2009 Dec 20.

Occurrence and distribution of capB in Antarctic microorganisms and study of its structure and regulation in the Antarctic biodegradative Pseudomonas sp. 30/3

Panicker G, Mojib N, Nakatsuji T, Aislabie J, Bej AK.
Department of Biology, University of Alabama at Birmingham, 1300 University Boulevard, CH103, Birmingham, AL, 34294-1170, USA.

... ncbi.nlm.nih.gov) using the Basic Local Alignment Search Tool (BLAST). The promoter, RBS and ORF sequences were analyzed using Softberry (http://softberry.com/berry. phtml) and Geneious (http://www.geneious.com) software. ... 


Plant Physiology and Biochemistry
Volume 48, Issues 2-3, February-March 2010, Pages 153-159 doi:10.1016/j.plaphy.2009.12.008

Identification of iron-deficiency responsive microRNA genes and cis-elements in Arabidopsis

Wei Wei Kong a and Zhi Min Yang
a Department of Biochemistry and Molecular Biology, College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China

... Using transcription start site (TSS) predicted software (SoftBerry, http://www.softberry.com), we were able to obtain 139 (74.3%) 2 kb proximal promoter sequences upstream of pre-miRNAs. These sequences contain at least one transcription start site or promoter. ... 


Microbial Pathogenesis
Volume 48, Issue 5, May 2010, Pages 168-177 doi:10.1016/j.micpath.2010.02.006

The Burkholderia cenocepacia K56-2 pleiotropic regulator Pbr, is required for stress resistance and virulence

Ramos et al.,
a IBB – Institute for Biotechnology and Bioengineering, Centre for Biological and Chemical Engineering, Instituto Superior Tecnico, Torre Sul, Piso 6. Av. Rovisco Pais, 1049-001 Lisboa, Portugal b Department of Microbiology, Institute of Plant Biology, University of Zurich, Zurich, Switzerland

... pbr and phzD–phzF (Fig. 1C). These results demonstrate that phzD and phzF are forming an operon, which was predicted using the Softberry software suite (http://linux1.softberry.com/berry.phtml). The two fragments could not ... 


Planta
DOI: 10.1007/s00425-010-1326-3

Sweetpotato late embryogenesis abundant 14 (IbLEA14) gene influences lignification and increases osmotic- and salt stress-tolerance of transgenic calli

Park et al.,

... http://www.expasy.org/tools), PSORT (http://psort.ims. u-tokyo.ac.jp), and SoftBerry (http://www.softberry.com) programs. Planta 123 Page 4. Gene expression analysis Total RNA was isolated from sweetpotato using TRIzol reagent ..


International Journal of Medical Microbiology
Volume 300, Issue 5, June 2010, Pages 279-288

Characterisation of multidrug-resistant Salmonella Typhimurium 4,[5],12:i:- DT193 strains carrying a novel genomic island adjacent to the thrW tRNA locus

Sandra Trupschuch a, 1, Jenny A. Laverde Gomez a, 1, Ia Ediberidze b, Antje Flieger a and Wolfgang Rabsch a
a Division of Bacterial Infections and National Reference Centre for Salmonella and other Bacterial Enteric Pathogens, Robert Koch-Institute, Wernigerode Branch, Germany b Eliava Institute of Bacteriophage, Microbiology and Virology, Tbilisi, Georgia

.. For bioinformatical analyses, we used the following online available software tools: www.ncbi.nlm.nih.gov/ for NCBI's BLASTn and BLASTx analyses; linux1.softberry.com /berry.phtml for promotor search; www.effectors.org for the prediction of potential T3SS-secreted ... 


European journal of plant pathology
2010, vol. 127, no3, pp. 351-363

Alternative splicing and genetic diversity of the white collar-1 (wc-1) gene in cereal Phaeosphaeria pathogens

Ericka et al.,
(1) Seed Improvement and Propagation Station, Taichung 426, TAIWAN, PROVINCE DE CHINE (2) Department of Plant Pathology, National Chung Hsing University, Taichung City 402, TAIWAN, PROVINCE DE CHINE

... When the wc-1 genomic sequence was analyzed by Softberry (http://linux1.softberry. ... Therefore, the deduced WC-1 polypep- tide (1,076 aa) analyzed by Softberry was three amino acids fewer as compared to the analysis from the Broad Institute. ... 


PLoS ONE
2010, 5(5): e10803. doi:10.1371/journal.pone.0010803

The Monofunctional Catalase KatE of Xanthomonas axonopodis pv. citri Is Required for Full Virulence in Citrus Plants

Tondo ML, Petrocelli S, Ottado J, Orellano EG
Molecular Biology Division, Facultad de Ciencias Bioquimicas y Farmaceuticas, Instituto de Biologia Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Cientificas y Tecnicas, Universidad Nacional de Rosario, Rosario, Argentina

... bp upstream of the 5? end to 14 bp downstream of the 3? end of the ORF was amplified using the primer pair ckatE-F and ckatE-R (Table 1). The amplified sequence included the putative promoter sequence of the katE gene, previously predicted with SoftBerry (www.softberry ... 


The Journal of Agricultural Science
2010, 148: 579-591, DOI: 10.1017/S0021859610000420

Gene expression and nitrogen loss in senescing root systems of red clover (Trifolium pratense)

WEBB et al.,
a1 Institute of Biological, Environmental and Rural Sciences, Gogerddan, Aberystwyth, Ceredigion SY23 3EB, UK a2 Department of Environmental and Geographical Sciences, Manchester Metropolitan University, Manchester M1 5GD, UK

... DNA sequences were aligned using ClustalW. Gene structure was analysed using multiple alignment construction and analysis workbench (MACAW) and Softberry (Mount KIsco, New York, USA; http://linux1.softberry.com/berry.phtml). ... Analysis by Softberry shows two exons. ... 


Acta Derm Venereol.
2010;90(1):95-6

A new SPINK5 donor splice site mutation in siblings with Netherton syndrome

Tuysuz et al.,

... Page 2. 96 Letters to the Editor using two different software programs available at http://www. fruitfly.org/ and http://linux1.softberry.com). Both predictors showed that the splice site score of the mutant sequence was much lower (0.59) than the wild-type counterpart (0.96). ... 


African Journal of Biotechnology
Vol. 9(41), pp. 6826-6834, 11 October, 2010

Cloning and functional analysis in transgenic tobacco of a tapetum-specific promoter from Arabidopsis

Xuan-Li Nie, Jian-Wei Zhu, An-Qi Geng and Xing-Guo Xiao
State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing, 100193, China.

... In order to identify this kind of cis-elements, we analyzed in detail the DNA sequence of the -155 region (Figure 5) with Plant CARE (http://bioinformatics.psb,ugent.be/webtools/plantcare/ht ml) and SOFTBERRY (http://linuxl.softberry.com/berry. phtml), in addition to PLACE. ... 


International Journal of Hydrogen Energy
Volume 35, Issue 3, February 2010, Pages 1065-1073 doi:10.1016/j.ijhydene.2009.11.102

Molecular characterization and homologous overexpression of [FeFe]-hydrogenase in Clostridium tyrobutyricum JM1

Ji Hye Jo a, Che Ok Jeon b, Seung Yoon Lee c, Dae Sung Lee d, and Jong Moon Park e
a Biosciences Center, National Renewable Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401-3393, USA b Department of Life Science, Chung-Ang University, Seoul 156-756, South Korea

... nucleotide identity. Transcription promoters and termination sequences of the hydA gene were analyzed using web-based programs (http://www.softberry.com/; http://www.fruitfly.org/seq.tools/promoters. html). The theoretical ... 


Journal of plant biology
2010, vol. 53, no2, pp. 134-141

Cloning and Characterization of Functional Trehalose-6-Phosphate Synthase Gene in Maize

Jiang Wei (1) ; Fu Feng-Ling (1) ; Zhang Su-Zhi (1) ; Wu Ling (1) ; Li Wan-Chen (1)
(1) Maize Research Institute, Sichuan Agricultural University, Sichuan, Ya’an, China

... The completely matched sequence together with its sequences within 5,000 bp upstream and downstream, a total of 15,000 bp, was used to analyze the gene structure using GeneFinder software (http://linux1.softberry.com). Open Reading Frame Cloning ... 


Antimicrob. Agents Chemother.
doi:10.1128/AAC.01672-09

A novel insertion sequence, ISAba10, inserted into ISAba1 adjacent to the blaOXA-23 gene and disrupting the outer membrane protein carO gene in Acinetobacter baumannii

Lee et al.,
Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752, Korea; Korean Institute of Tuberculosis, 14 Woomyun-dong, Seocho-gu, Seoul 137-900, Korea

... higher level carbapenem resistance by conferring additional promoter sequences to the 85 blaOXA-23 gene. Analyses using an online tool (http://linux1.softberry.com) suggested the 86 presence of a putative promoter within the ISAba10 element (Fig. 1). 87 ...


Appl. Environ. Microbiol.
doi:10.1128/AEM.02417-09

Random mutagenesis of Clostridium cellulolyticum using a Tn1545 derivative

Jean-Charles Blouzard, Odile Valette, Chantal Tardif, and Pascale de Philip
Laboratoire de Chimie Bacterienne, IFR88-CNRS, Marseille, France; Universite d'Aix-Marseille, Marseille, France

...Promoter predictions (http://linux1.softberry.com/) at the 14 junctions of pMIS1545 and the insertion sites revealed that putative -10/-35 promoters sites were 15 ... 


Clinical Genetics
Volume 77, Issue 5, pages 453–463, May 2010 DOI: 10.1111/j.1399-0004.2009.01337.x

Novel exon nucleotide substitution at the splice junction causes a neonatal Marfan syndrome

Chao et al.,
1 Department of Obstetrics and Gynecology, National Cheng Kung University Hospital, Douliou Branch, Yunlin, Taiwan 2 Institute of Basic Medical Sciences, National Cheng Kung University Medical College, Tainan, Taiwan

... The tools included Splice Site Prediction by Neural Network (NNSplice; http://www.fruitfly.org/ seq tools/splice.html) (9), a weight matrix-based prediction tool (Splm; http://linux1.softberry.com/ berry.phtml), NetGene2 (http://www.cbs.dtu.dk/services/ NetGene2/) (10), and ... 


Mol Biotechnol.
2010 May;45(1):24-33

Characterization of a cryptic plasmid pD403 from Lactobacillus plantarum and construction of shuttle vectors based on its replicon

Sun Z, Kong J, Kong W
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China.

... ncbi. nlm.nih.gov/Blast.cgi). Prediction of open reading frames, prokaryotic promoters, and terminators was performed at http://opal.biology.gatech.edu/GeneMark/ gmhmm2_prok.cgi and http://www.softberry.com/berry.phtml. To ... 


Electronic Journal of Biotechnology
DOI: 10.2225/vol13-issue5-fulltext-12

Isolation and characterization of the tissue and development-specific potato snakin-1 promoter inducible by temperature and wounding

Natalia I. Almasia 1 · Vanesa Narhirnak 1 · H. Esteban Hopp 1 · Cecilia Vazquez-Rovere 1
1 Instituto de Biotecnologia, Centro Nacional de Investigaciones Agropecuarias, Instituto Nacional de Tecnologia Agropecuaria, Castelar, Los Reseros y Dr. N. Repetto, Hurlingham, Provincia de Buenos Aires, Argentina

... The amplified fragment was cloned in pCRII-TOPO® (TACloning®, Invitrogen (EUA), sequenced and analyzed with the BioEdit Sequence Alignment Editor software, Softberry, PlantCARE (Rombauts et al. 1999; Lescot et al. ... 


The Plant Journal
61: 324–338. doi: 10.1111/j.1365-313X.2009.04057.x

Sucrose non-fermenting kinase 1 (SnRK1) coordinates metabolic and hormonal signals during pea cotyledon growth and differentiation

Radchuk et al.,
1 Institut fur Pflanzengenetik und Kulturpflanzenforschung (IPK), Corrensstrasse 3, D-06466 Gatersleben, Germany 2 Biology Department, Trent University, Peterborough, ON K9J 7B8, Canada

... Data bank searches (http://www.softberry.com) revealed a TTAGGGTTT motif described as an inverted telo-box, associated with gene translation and the cell cycle (proliferating cell nuclear antigen), a AATATTTTTATT motif found in pea ribulose-1,5-bisphosphate carboxylase ... 


Plant Cell Rep.
2010 Mar;29(3):239-48

Isolation and functional characterization of two novel seed-specific promoters from sunflower (Helianthus annuus L.)

Zavallo D, Lopez Bilbao M, Hopp HE, Heinz R
Instituto de Biotecnologia, CNIA, Instituto Nacional de Tecnologia Agropecuaria-Castelar, Los Reseros y Nicolas Repeto, 1686 Hurlingham, Buenos Aires Province, Argentina

... Amplified fragments were cloned into pCR8/GW/TOPO (Invitrogen, USA), sequenced and analyzed in silico with Vector NTI Advance 9 software (Invitrogen, USA). Pro- moter motif search was conducted using Softberry server, PlantCARE database (Lescot et al. ... 


PLoS
2010

Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri

Yinping Guo, Uma Shankar Sagaram, Jeong-soon Kim, and Nian Wang
Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, Florida 33850

... The intergenic distance between the galU gene and the downstream gene kefB is 174 bp. The galU gene and the downstream kefB gene were predicted to belong to different operons based on operon prediction using SOFTBERRY (Softberry, Inc.). ... 


PLoS Biol
2010 8(8): e1000467. doi:10.1371/journal.pbio.1000467

Distinct Olfactory Signaling Mechanisms in the Malaria Vector Mosquito Anopheles gambiae

Liu et al.,
1 Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in Developmental Biology, Vanderbilt University, Nashville, Tennessee, United States of America, 2 USDA, Agricultural Research Service, Henry A. Wallace Beltsville Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Beltsville, Maryland, United States of America

...Potential exon-intron gene models were predicted based on homology to DmIRs or AgIRs, as well as with the aid of a Hidden Markov Model-based gene structure predictor (www.Softberry.com)...


Journal of Bacteriology
October 2010, p. 5081-5092, Vol. 192, No. 19 doi:10.1128/JB.00653-10

The Delta Subunit of RNA Polymerase, RpoE, Is a Global Modulator of Streptococcus mutans Environmental Adaptation

Xiaoli Xue, Jurgen Tomasch, Helena Sztajer, and Irene Wagner-Dobler
esearch Group Microbial Communication, Division of Cell Biology, Helmholtz Centre for Infection Research, Inhoffenstr. 7, D-38124 Braunschweig, Germany

... S6 and S7 in the supplemental material) predicted by the SoftBerry web service (SoftBerry Inc., Mount Kisco, NY), while the third one had too short a sequence length (114 bp in total, but with only 45 bp before the putative terminator) to find a putative promoter. ... 


Journal of Bacteriology
May 2010, p. 2535-2545, Vol. 192, No. 10 doi:10.1128/JB.01689-09

A Genetic Determinant in Streptococcus gordonii Challis Encodes a Peptide with Activity Similar to That of Enterococcal Sex Pheromone cAM373, Which Facilitates Intergeneric DNA Transfer

Vickerman et al.,
Department of Periodontics and Endodontics and Department of Oral Biology, School of Dental Medicine, University at Buffalo, 223 Foster Hall, Buffalo, New York 14214,1 Cariology, Restorative Sciences and Endodontics, School of Dentistry,2

... oxidase signature (PS00079). The lspA gene is located between two overlapping open reading frames with a single upstream promoter identified by both MacVector and Softberry promoter prediction software. In silico analysis ...


Journal of Bacteriology
March 2010, p. 1184-1192, Vol. 192, No. 5 doi:10.1128/JB.01372-09

In Helicobacter pylori, LuxS Is a Key Enzyme in Cysteine Provision through a Reverse Transsulfuration Pathway

Doherty et al.,
Centre for Biomolecular Science, University of Nottingham, University Park, Nottingham NG7 2RD,1 Nottingham Digestive Diseases Centre NIHR Biomedical Research Unit, School of Clinical Sciences, University of Nottingham and Nottingham University Hospitals NHS Trust, Queen's Medical Centre, Nottingham NG7 2UH,2

... A putative 70 promoter lying upstream of cysK Hp was identified using promoter prediction algorithms found at http://www.softberry.ru/berry.phtml and http://www.fruitfly.org/seq_tools/promoter.html and is shown as an arrow. ... 


Fungal Genetics and Biology
Volume 47, Issue 10, October 2010, Pages 818-827 doi:10.1016/j.fgb.2010.06.009

Specialized and shared functions of the histidine kinase- and HOG1 MAP kinase-mediated signaling pathways in Alternaria alternata, a filamentous fungal pathogen of citrus

Ching-Hsuan Lin a, b and Kuang-Ren Chung a, b
a Citrus Research and Education Center, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA b Department of Plant Pathology, IFAS, University of Florida, Gainesville, FL 32611, USA

... nlm.nih.gov/). Open 9 reading frame (ORF) and exon/intron positions were deduced from comparisons of 10 genomic and cDNA sequences or predicted using the gene-finding software at 11 http://www.softberry.com. A search ... 


Research in Microbiology
Volume 161, Issue 2, March 2010, Pages 144-152 doi:10.1016/j.resmic.2009.12.002

The 285 kDa Bap/RTX hybrid cell surface protein (SO4317) of Shewanella oneidensis MR-1 is a key mediator of biofilm formation

Bjorn Vergauwen
a Laboratory for Protein Biochemistry and Biomolecular Engineering (L-ProBE), Ghent University, 9000 Ghent, Belgium b Laboratory of Pharmaceutical Microbiology, Ghent University, 9000 Ghent, Belgium

.. A predicted promoter region (http://www.softberry.com) precedes the start site of ORF SO4317, ORFs SO4318–SO4323 are separated from each other by no more than 27 base pairs, and an intergenic region of 818 base pairs, containing a predicted transcription termination site ... 


PLoS ONE
5(6): e11067. doi:10.1371/journal.pone.0011067

Genomic Features of the Human Dopamine Transporter Gene and Its Potential Epigenetic States: Implications for Phenotypic Diversity

Shumay E, Fowler JS, Volkow ND
1 Brookhaven National Laboratory, Medical Department, Upton, New York, United States of America, 2 National Institute on Drug Abuse, National Institutes of Health, Bethesda, Maryland, United States of America

... the typical sequence characteristics of a strong promoter. Here, de novo predicted TSSs are only marginal (Promoter 2.0 Prediction server) or off-target (Softberry). The software Eponine (Sanger) predicts multiple low-score ...


Chinese Science Bulletin
Volume 54, Number 18 / September, 2009 pp. 3249-3257

Characterization of a PDR type ABC transporter gene from wheat (Triticum aestivum L.)

Yi Shang et al.,
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Cytogenetics Institute, Nanjing Agricultural University, Nanjing, 210095, China (2) Institute of Crop Research and Nuclear Technique Utilization, Zhejiang Academy of Agricultural Science, Hangzhou, 310021, China

... A positive TAC clone was identified using the primer pair SH49S and SH49A. The TAC clone was sequenced us- ing a chromosome walking method and the gene was predicted using Softberry software (http://www. soft- berry.com). ...


Mem. Inst. Oswaldo Cruz
vol.104 no.3 Rio de Janeiro May 2009 doi: 10.1590/S0074-02762009000300018

Phylogeny and evolution of the aspartyl protease family from clinically relevant Candida species

B Parra-Ortega; H Cruz-Torres; L Villa-Tanaca; C Herna'ndez-Rodri'guez
Departamento de Microbiologi'a, Escuela Nacional de Ciencias Biolo'gicas, Instituto Polite'cnico Nacional, Plan de Ayala y Prol. Carpio, Colonia Casco de Santo Toma's, CP 11340 Agencia de Correos 220, Me'xico, DF, Me'xico

... Prediction of motif sequences was performed with PROSITE (http://www.expasy.org) (Falquet et al. 2002). PSORTII (http://www.psort.org/) and Softberry (http://www.softberry.com) were used to predict subcellular localization; Softberry was also used to find exons. ...


Insect Biochemistry and Molecular Biology
Volume 39, Issue 8, August 2009, Pages 547-567

Comparative and functional genomics of lipases in holometabolous insects

Irene Horne, Victoria S. Haritos, John G. Oakeshott
CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia

encoded by href="genbank:XM_312606">XM_312606) to identify acid lipases; gene structures were then predicted using Genscan (Burge and Karlin, 1997) or Softberry (http://www ...


Journal of Biomedicine and Biotechnology
Volume 2009 (2009), Article ID 398434, 10 pages doi:10.1155/2009/398434

Adding to Yersinia enterocolitica Gene Pool Diversity: Two Cryptic Plasmids from a Biotype 1A Isolate

Lepka et al.,
Robert Koch Institute, Wernigerode Branch, Burgstrasse 37, 38855 Wernigerode, Germany

... resp.). 2.5. Sequence Analyses. Potential coding regions were determined by softberry (http://www.softberry.com/) tools and confirmed applying Glimmer (http://www.ncbi.nlm. nih.gov/genomes/MICROBES/glimmer_3.cgi). Comparison ...


Peptides
Volume 30, Issue 7, July 2009, Pages 1241-1248

FGLamide Allatostatin genes in Arthropoda: Introns early or late?

Francisco Marti'nez-Pe'rez a, b, William G. Benden ac, Belind a S.W. Chang a and Stephen S. Tobe a
aDepartment of Cell and Systems Biology, University of Toronto, Toronto, ON, Canada bDepartment of Genetics and Molecular Biology, CINVESTAV, Mexico, D.F., Mexico

... from D. punctata and D. melanogaster. With the sequences obtained, the exon-intron organization was established with Softberry programs (http://linux1.softberry.com/ berry.phtml). The conceptual translation and the sequence ...


Plant Molecular Biology
Volume 71, Numbers 1-2 / September, 2009, pp. 193-205

Cloning and characterization of two novel chloroplastic glycerol-3-phosphate dehydrogenases from Dunaliella viridis

Yunxia He et al.,
(1) Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, 200444 Shanghai, People’s Republic of China (2) Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 200032 Shanghai, People’s Republic of China

... al. 1997). Gene and protein predictions were carried out with the SoftBerry service (http://www.softberry.com/berry.phtml). Possible chloroplast transit peptides were predicted using ChloroP (http://www.cbs.dtu.dk/services/). Subcellular ...


Biochem. J.
(2009) 418, 443–451 (Printed in Great Britain) doi:10.1042/BJ20081478

Intracellular catalase/peroxidase from the phytopathogenic rice blast fungus Magnaporthe grisea: expression analysis and biochemical characterization of the recombinant protein

ZAMOCKY et al.,
*Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, University of Natural Resources and Applied Life Sciences, Muthgasse 18 A-1190 Vienna, Austria, †Department of Chemistry, University of Modena and Reggio Emilia, Modena, Italy

... Promoter and subcellular targeting prediction Prediction of intron and native promoter location within the geno- mic DNA of M. grisea strain 70-15 was performed in the SoftBerry suite (http://www.softberry.com) using the ascomycete- specific parameters. ...


Applied and Environmental Microbiology
May 2009, p. 2869-2878, Vol. 75, No. 9 doi:10.1128/AEM.02326-08

Biosynthesis of Sibiromycin, a Potent Antitumor Antibiotic

Wei Li, Ankush Khullar, ShenChieh Chou, Ashley Sacramo, and Barbara Gerratana
Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742

... ORF and sequence homology analyses were performed by using SoftBerry (Softberry, Inc.) and GeneMark (exon.gatech.edu/GeneMark/) and by using BLAST programs (blast.ncbi.nlm.nih.gov/ blast.cgi), respectively. Production, isolation, and analysis of sibiromycin. ...


Molecular Genetics and Genomics
Volume 281, Number 1 / January, 2009 pp. 109-123

TRANSPARENTTESTA12 genes from Brassica napus and parental species: cloning, evolution, and differential involvement in yellow seed trait

You-Rong Chai et al.,
(1) Chongqing Rapeseed Engineering Research Center, Southwest University, Tiansheng Road 216#, Beibei, 400716 Chongqing, People’s Republic of China (2) Chongqing Key Laboratory of Crop Quality Improvement, Southwest University, Tiansheng Road 216#, Beibei, 400716 Chongqing, People’s Republic of China

... Page 4. 112 Mol Genet Genomics (2009) 281:109-123 123 and websites such as NCBI (http://www.ncbi.nlm.nih.gov), Expasy (http://www.expasy.org), and SoftBerry (http://www. softberry.com). Southern hybridization for TT12 genes in B. napus and its two parental species ...


Plant Physiology Preview
Published on September 18, 2009; 10.1104/pp.109.145177

Metabolite sorting of a germplasm collection reveals the Hydroxylase3 locus as a new target for maize provitamin A biofortification

Ratnakar Vallabhaneni et al.,
Department of Biological Sciences, Lehman College, The City University of New York, 250 Bedford Park Blvd. West, Bronx, NY 10468; The Graduate School and University Center-CUNY, 365 Fifth Ave., New York, NY 10016-4309

... Gene models were drawn using Genscan (www.genscan.com), Softberry (www.softberry. com) and Vector NTI Suite9.0 (Invitrogen, Carlsbad, CA). Transcription start sites were estimated by EST and promoter analysis (www.softberry.com). ...


BMC Genomics
2009, 10:224doi:10.1186/1471-2164-10-224

Complete sequence determination of a novel reptile iridovirus isolated fromsoft-shelled turtle and evolutionary analysis of Iridoviridae

Youhua Huang et al.,
aState Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, 135 West Xingang Road, Guangzhou 510275, PR China

... programs at the NCBI website (http://www.ncbi.nlm.nih.gov). The whole genome sequence was also submitted to http://www.softberry.com (Softberry Inc., Mount Kisco, NY, USA) for identification of all putative ORFs. For more refined analyses, conserved motifs and domains and ...


Euphytica
Volume 167, Number 3 / June 2009, pp. 281-291

Promoter anchored amplified polymorphism based on random amplified polymorphic DNA (PAAP-RAPD) in cotton

Mingxiong Pang 1, R. G. Percy 2, Ed. Hughs 3 and Jinfa Zhang 1
(1) Department of Plant and Environmental Sciences, New Mexico State University, Las Cruces, NM 88003, USA

... information about the cloned PAAP-RAPD fragments, 220 plant promoter sequences were downloaded from http://www.soft- berry.com and ... the cloned potential promoters we downloaded the characterized dicot plant promoters from database at http://www.softberry.com/with a ...


Veterinary Immunology and Immunopathology
Volume 128, Issue 4, 15 April 2009, Pages 437-440

Complete sequencing of full-length canine ataxia telangiectasia mutated mRNA and characterization of its putative promoter

Fabio Gentilini, Maria Elena Turba, Monica Forni and Stefano Cinotti
aVeterinary Clinical Department, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 - Ozzano Emilia, Bologna, Italy

... proscan/) (Prestridge, 1995) and "MOTIF" software (http://motif.genome.jp). The putative PolyA signal sites were predicted using PolyA (http://www.softberry.com/). Finally, the predictors PhD-SNP (http://gpcr.biocomp.unibo.it ...


International Journal of Hydrogen Energy
Volume 35, Issue 3, February 2010, Pages 1065-1073

Molecular characterization and homologous overexpression of [FeFe]-hydrogenase in Clostridium tyrobutyricum JM1

Ji Hye Jo, Che Ok Jeon, Seung Yoon Lee, Dae Sung Lee and Jong Moon Park
a Biosciences Center, National Renewable Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401-3393, USA

... nucleotide identity. Transcription promoters and termination sequences of the hydA gene were analyzed using web-based programs (http://www.softberry.com/; http://www.fruitfly.org/seq.tools/promoters. html). The theoretical ...


Glycoconjugate Journal
Volume 26, Number 3 / April, 2009, pp. 313-324

Sialylation in protostomes: a perspective from Drosophila genetics and biochemistry

Kate Koles1, Elena Repnikova1, Galina Pavlova2, Leonid I. Korochkin2 and Vladislav M. Panin1
1) Department of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843-2128, USA

... insect species: African malaria mosquito (Anopheles gambiae, XP_308850), yellow fever mosquito (Aedes aegypti, XM_001649540), red flour beetle (Tribolium castaneum, XP_968750), and pea aphid (Acyrthosiphon pisum, reconstructed using SoftBerry prediction (www.softberry.com) ...


Applied and Environmental Microbiology
November 2009, p. 6712-6720, Vol. 75, No. 21

Edwardsiella ictaluri Encodes an Acid-Activated Urease That Is Required for Intracellular Replication in Channel Catfish (Ictalurus punctatus) Macrophages

Natha J. Booth,1, Judith B. Beekman,1,2 and Ronald L. Thune 1,2*
Department of Veterinary Science, Louisiana State University Agricultural Center, Louisiana State University, Baton Rouge, Louisiana 70803,1 Department of Pathobiological Sciences, School of Veterinary Medicine, Skip Bertman Drive and River Road, Louisiana State University, Baton Rouge, Louisiana 708032

... The genetic structure of the urease operon was examined using the stem-loop and terminator programs of the Wisconsin package (Genetics Computer Group, Madison, WI) and the bacterial operon and gene-finding software program from SoftBerry, Inc. ...


Microb Cell Fact.
2009; 8: 48.

Surface display of heterologous proteins in Bacillus thuringiensis using a peptidoglycan hydrolase anchor

Xiaohu Shao,1 Mengtian Jiang,1 Ziniu Yu,1 Hao Cai,2 and Lin Li
1State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China 2College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China

... kurstaki wild-type strain YBT-1520 comprises over 5600 ORFs (data not published). A whole-genome analysis of the corresponding proteins in this strain was performed with the online tool "softberry" [21], using the genome data of B. thuringiensis subsp. ...


The Plant Cell
21:131-145 (2009)

A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-Domain Protein JAZ10 in Arabidopsis

Hoo Sun Chung a,b and Gregg A. Howe a,b
a Department of Energy–Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824 b Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824

... Gene prediction programs (www.softberry.com) suggest that JAZ10 orthologs in rice (Oryza sativa) (gi:115458122) and poplar (Populus trichocarpa) (Joint Genome Institute gene model 548076) are subject to alternative splicing events that alter the Jas domain. ...


MPMI
August 2009, Volume 22, Number 8 Pages 942-952 DOI: 10.1094/MPMI-22-8-0942

The YAP1 Homolog–Mediated Oxidative Stress Tolerance Is Crucial for Pathogenicity of the Necrotrophic Fungus Alternaria alternata in Citrus

Ching-Hsuan Lin, Siwy Ling Yang, and Kuang-Ren Chung
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Rd., Lake Alfred 33850, U.S.A.

... The pro- moter region was analyzed using regulatory sequence analysis tools. ORF and exon or intron positions were predicted using Softberry gene-finding software and verified by comparisons of genomic and cDNA sequences. ...


Journal of Plant Interactions
Volume 3, Issue 2 June 2008 , pages 75 - 93

Endophytes: exploiting biodiversity for the improvement of natural product-based drug discovery

Agata Staniek; Herman J. Woerdenbag; Oliver Kayser
Pharmaceutical Biology Department, University of Groningen, The Netherlands

... gramme (available from: http://www.softberry.com/ berry.phtml) aided by RACE (rapid amplification of cDNA ends) and confirmed by reverse transcription- PCR ...


PLoS Genet
(2008) 4(1): e3. doi:10.1371/journal.pgen.0040003

Repetitive Element-Mediated Recombination as a Mechanism for New Gene Origination in Drosophila

Yang et al.,
Chinese Academy of Sciences (CAS)—Max Planck Junior Research Group, Key Laboratory of Cellular and Molecular Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan, China

... copy-specific primers, and for those that resulted in no RACE product (possibly due to low expression levels or long ends), we used the Softberry software [65 ...


Genetics.
2008 August; 179(4): 2239–2252. doi: 10.1534/genetics.108.089862

Quantitative Trait Loci (QTL) Analysis For Rice Grain Width and Fine Mapping of an Identified QTL Allele gw-5 in a Recombination Hotspot Region on Chromosome 5

Wan et al.,
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China and †Institute of Crop Science and the National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China

... candidate genes in the 49.7-kb region (http://www.ncbi.nlm.nih.gov/BLAST; http://www.softberry.com). Of these genes, one had unknown ...


Nucleic Acids Research
Volume 36(7)April 2008pp 2196-2207

Epigenetics of a tandem DNA repeat: chromatin DNaseI sensitivity and opposite methylation changes in cancers

Koji et al.,
Human Genetics Program and Department of Biochemistry and Tulane Cancer Center, Tulane Medical School, Tulane University, New Orleans, LA 70112, USA

... that p13E-11, which is only 0.1 kb from D4Z4 (Figure 1) and has no features of a gene (http://exon.gatech.edu/GeneMark/ , http://www.softberry.com/berry.phtml ...


Cell Research
18, 1199 - 1209 (01 Dec 2008), doi: 10.1038/cr.2008.307

Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight

Weng et al.,

... (D) Compared with IR24, 1.2-kb genomic DNA is deleted in Asominori. (E) Three ORFs are predicted in the candidate region harboring GW5 (http://softberry.com). ...


PROTEOMICS
2008, Volume 8 Issue 20, Pages 4273 - 4286

Physiology of Streptococcus thermophilus during the late stage of milk fermentation with special regard to sulfur amino-acid metabolism

Herve-Jimenez et al.,
INRA,UR477 Biochimie Bacterienne, Jouy-en-Josas, France

... a) L/E ratio: ratio between the relative mRNA levels at 5h30 and 2h30. b) Determined with ProFinder software (http://www.softberry.com/all.htm). ...


BMC Microbiology
2008, 8:227 doi:10.1186/1471-2180-8-227

Genomic analysis of bacteriophage epsilon34 of Salmonella enterica serovar Anatum (15+)

Robert Villafane, Milka Zayas, Eddie B. Gilcrease, Andrew M. Kropinski, and Sherwood R. Casjens
Ponce School of Medicine, Departments of Biochemistry and Microbiology, Ponce, Puerto Rico 00732

The Betawrap [57], Softberry , tRNAscan-SE [79], [44] web sites were used for beta-helix structure, phage promoter, tRNA gene and transmembrane helix identification, respectively.


Published in Crop Sci
48:2314-2320 (2008)

Cloning and Characterization of a CAP Gene Expressed in Gossypium arboreum Fuzzless Mutant

Sheng Wang, Guo-Hong Zhao, Yin-Hua Jia and Xiong-Ming Du
Cotton Germplasm Division, Cotton Research Institute, Chinese Academy of Agricultural Sciences, Huanghe Dadao, Kaifaqu, Anyang, Henan 455000, China

... Blast.cgi). Softberry server was used to determine the exon/intron boundaries (http://www.softberry.com/berry.phtml). The conceptual ...


J Microbiol Methods.
2008 May;73(2):133-41. Epub 2008 Feb 11

An integrative expression vector for strain improvement and environmental applications of the nitrogen fixing cyanobacterium, Anabaena sp. strain PCC7120

Chaurasia AK, Parasnis A, Apte SK
Molecular Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India.

... 164 base pair region upstream of psbA1) showed 50% homology with the ? 10 and ? 35 consensus sequences of E. coli promoters (www.softberry.com/promoscan). ...


The Journal of Immunology
2008, 181: 7106-7114.

Histoplasma capsulatum Cyclophilin A Mediates Attachment to Dendritic Cell VLA-5

Francisco J. Gomez, Robyn Pilcher-Roberts, Arash Alborzi and Simon L. Newman
Department of Internal Medicine, Division of Infectious Diseases, University of Cincinnati College of Medicine, and {dagger} Veterans Administration Medical Center, Cincinnati, OH 45267

... The sequence was analyzed with the SoftBerry GeneFinder on-line server (http://www.softberry.com/berry.phtml) that correctly identified the Hc CypA coding ...


Biochemical Journal Immediate Publication.
Published on 10 Nov 2008 as manuscript BJ20081478

Intracellular catalase-peroxidase from the phytopathogenic fungus Magnaporthe grisea: expression analysis and biochemical characterisation of the recombinant protein

Zamocky et al.,
Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, University of Natural Resources and Applied Life Sciences, Muthgasse 18 A-1190 Vienna, Austria

... Prediction of intron and native promoter location within the genomic DNA of Magnaporthe grisea strain 70-15 was performed in SoftBerry suite (http://www ...


Bioscience, Biotechnology, and Biochemistry
Vol. 72 (2008) , No. 6 pp.1571-1579

Molecular Cloning, Characterization, and Differential Expression of a Farnesyl-Diphosphate Synthase Gene from the Basidiomycetous Fungus Ganoderma lucidum

Yi-Xin DING et al.,
College of Life Sciences, Nanjing Agricultural University, Key Laboratory of Microbiological Engineering of Agricultural Environment, Ministry of Agriculture

... The phylogenetic tree was gener- ated by MEGA. 18) The promoter sequences were analyzed online at the http://www.softberry.com/ berry.phtml website. Results ...


Applied and Environmental Microbiology
July 2008, p. 4359-4365, Vol. 74, No. 14 doi:10.1128/AEM.02499-07

Novel Bacterial Surface Display Systems Based on Outer Membrane Anchoring Elements from the Marine Bacterium Vibrio anguillarum

Zhao Yang, Qin Liu,* Qiyao Wang, and Yuanxing Zhang*
State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China

... of the above membrane-related proteins were analyzed with ExPASy Proteomics tools (TMHMM Server v.2.0 [http://kr.expasy.org/tools/]) and SoftBerry (data not ...


MPMI
April 2008, Volume 21, Number 4, Pages 469-479 DOI: 10.1094/MPMI-21-4-0469

Genetic Dissection Defines the Roles of Elsinochrome Phytotoxin for Fungal Pathogenesis and Conidiation of the Citrus Pathogen Elsinoe fawcettii

Hui-Ling Liao and Kuang-Ren Chung
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Rd., Lake Alfred 33850, U.S.A.

... ORF and exon/intron positions were predicted using the Softberry gene-finding software and confirmed by comparisons of genomic and cDNA sequences. ...


Microbiology
154 (2008), 3556-3566; DOI 10.1099/mic.0.2008/019414-0

Determination of a transcriptional regulator-like gene involved in biosynthesis of elsinochrome phytotoxin by the citrus scab fungus, Elsinoe fawcettii

Kuang-Ren Chung and Hui-Ling Liao
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA

... Prediction of ORFs and exon/intron junctions was first performed using the gene-finding software at http://www.softberry.com and further confirmed by comparing ...


BMC Genomics
2008; 9: 149. Published online 2008 March 31. doi: 10.1186/1471-2164-9-149.

Losing helena: The extinction of a drosophila line-like element

Rita Rebollo, Emmanuelle Lerat, Liliana Lopez Kleine, Christian Biemont, and Cristina Vieira
1Universite de Lyon; Universite Lyon 1; CNRS; UMR 5558, Laboratoire de Biometrie et Biologie Evolutive, Villeurbanne F-69622, France 2UR477 de Biochimie Bacterienne, UR341 de Mathematiques et informatiques Applique'es, INRA. 78352 Jouy en Josas, France

... Splice sites and transcription binding sites were predicted by the Softberry tools [40] and Genomatix [41]; PEPcoil ([42] allowed us to find the coiled coil ...


Blood Coagulation & Fibrinolysis.
19(3):240-242, April 2008

Four novel FXI gene mutations in three factor XI- deficient patients

de Raucourt, Emmanuelle a; de Mazancourt, Philippe b,c; Quelin, Florence b,c

... to the acceptor site for exon 7, but an exon prediction software did not show an effect on the probability of splicing (website: http://www.softberry.com/cgi ...


Food and Chemical Toxicology
Volume 46, Issue 4, April 2008, Pages 1249-1256

SULT1C3, an orphan sequence of the human genome, encodes an enzyme activating various promutagens

Walter Meinl, Claudia Donath, Heiko Schneider, Yasmin Sommer and Hansruedi Glat
German Institute of Human Nutrition (DIfE) Potsdam-Rehbrucke, Department of Nutritional Toxicology, Arthur-Scheunert-Allee 114-116, 14558 Nuthetal, Germany

... then used the Baylor College of Medicine (BCM) Search Launcher http://searchlauncher. bcm.tmc.edu/ (many modules are now hosted by http://www.softberry.com) to ...


Infection and Immunity
June 2008, p. 2411-2419, Vol. 76, No. 6

Identification of a Novel Prophage-Like Gene Cluster Actively Expressed in Both Virulent and Avirulent Strains of Leptospira interrogans Serovar Lai

Jin-Hong Qin et al.,
Department of Microbiology and Parasitology, Institutes of Medical Sciences, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025, China,1 Laboratory of Molecular Microbiology, Institute of Plant Physiology and Ecology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China

... uk/). Transcription operons and the corresponding promoters were predicted using Softberry software (Softberry, Mount Kisco, NY). ... ...The putative promoter or regulatory regions of transcripts I, II, and III, all proximal to gene LA0195 but with different transcription directions, were identified by using the Softberry prokaryotic promoter prediction tools....


Molecular Immunology
Volume 45, Issue 12, July 2008, Pages 3470-3476

IgD in the reptile leopard gecko

Francisco Gambon-Deza and Christian Sanchez Espinel
Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain

... Sequence characteristics were analysed in the Softberry Web to deduce the exons and introns, and to verify the presence of other interesting characteristics ...


Endocrinology
2008 Vol. 149, No. 9 4256-4266

Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures

Paola Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy

... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic promoter identification programs (http://www.softberry.com/berry.phtml? ...


Biochimie
Volume 90, Issue 6, June 2008, Pages 878-887

Fish specific duplication of Dmrt2: Characterization of zebrafish Dmrt2b

Xiang Zhou et al.,
Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072, P.R. China

... www.ensembl.org/Danio_rerio/), and the exons of Dmrt2b were predicted by CBS PREDICTION SERVERS (http://www.cbs.dtu.dk/services/) and SOFTBERRY (http://www ...


PNAS
February 27, 2007 | vol. 104 | no. 9 | 3336-3341

A common variant in combination with a nonsense mutation in a member of the thioredoxin family causes primary ciliary dyskinesia

Benedicte Duriez et al.,
Institut National de la Sante et de la Recherche Medicale, Unite 654, F-94000 Creteil, France; Faculte de Me'decine, Universite Paris 12, IFR10, F-94000 Creteil, France

... in Man, www.ncbi.nlm.nih.gov/Omim (for PCD and Kartagener syndrome); Ensembl, www.ensembl.org; NCBI, www.ncbi.nlm.nih.gov; and Softberry, www.softberry.com. ...


Journal of Bacteriology,
October 2007, p. 6928-6935, Vol. 189, No. 19

Negative Regulation of the EcoRI Restriction Enzyme Gene Is Associated with Intragenic Reverse Promoters

Yaoping Liu, and Ichizo Kobayashi
Department of Medical Genome Sciences, Graduate School of Frontier Science, University of Tokyo, Tokyo, Japan,1 Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan

... rebase.html). In silico promoter prediction was carried out with the tools available at http://www.softberry.com/all.htm. The RNA ...


Applied and Environmental Microbiology,
November 2007, p. 7367-7372, Vol. 73, No. 22

Regulation of a Novel Acidithiobacillus caldus Gene Cluster Involved in Metabolism of Reduced Inorganic Sulfur Compounds

Olena I. Rzhepishevska et al.,
Molecular Biology, Umea* University, SE-901 87 Umea*, Sweden,

... Promoter prediction was performed using programs available at www.fruitfly.org/ seq_tools/promoter.html and www.softberry.com and a combined Hidden Markov Model ...


Journal of Plant Physiology
Volume 164, Issue 3, 7 March 2007, Pages 350-363

Cloning and molecular characterization of a functional flavonoid 3'-hydroxylase gene from Brassica napus

Ben-Bo Xu et al.,
Chongqing Rapeseed Technology Research Center, Chongqing Key Laboratory of Crop Quality Improvement, Beibei, Chongqing 400716, People's Republic of China

... gov/). Protein structure predictions were carried out on websites (http://www.expasy.org and http://www.softberry.com/berry.phtml). ...


Biochemical and Biophysical Research Communications
Volume 358, Issue 2, 29 June 2007, Pages 590-595

Activation-induced changes in alternate splice acceptor site usage

T. Prescott Atkinson and Yuling Dai
Department of Pediatrics, University of Alabama at Birmingham, Birmingham, AL, USA

... A list of over 12,000 publicly available EST-verified human splice acceptor sites (www.softberry.com) was examined for the occurrence of the AGCAG motif, and ...


Journal of Bacteriology,
March 2007, p. 1774-1782, Vol. 189, No. 5

The fox Operon from Rhodobacter Strain SW2 Promotes Phototrophic Fe(II) Oxidation in Rhodobacter capsulatus SB1003

Laura R. Croal, Yongqin Jiao, and Dianne K. Newman
Division of Biology, Division of Geological and Planetary Sciences, Howard Hughes Medical Institute, California Institute of Technology, Pasadena, California 91125

... Predicted operons, promoters, and terminators were identified with the tools at Softberry (http://www.softberry.com/berry.phtml). ...


Crop Sci
47:2437-2444 (2007)

Identification, Characterization and Expression of Drought Related alpha-Crystalline Heat Shock Protein Gene (GHSP26) from Desi Cotton

Asma Maqbool et al.,
Center of Excellence in Molecular Biology, University of the Punjab, 87-Canal Bank Road, Thokar Niaz Baig Lahore (53700) Pakistan

... 2007). To find out the exon/intron boundaries, untranslated regions (UTRs), and poly-A tail, softberry server was used (http://www.softberry.com/berry.phtml). ...


Plant Molecular Biology
Volume 65, Number 4 / November 2007 p. 453-466

T-DNA tagged knockout mutation of rice OsGSK1 , an orthologue of Arabidopsis BIN2 , with enhanced tolerance to various abiotic stresses

Serry Koh et al.,
Department of Life Science, Sogang University, Seoul, 121-742, Korea

... 2002), and were annotated with the Softberry program (http://www. softberry.com/ berry.phtml), and BLASTP (http://www. ncbi.nlm.nih.gov/BLAST). ...


Molecular Immunology
doi:10.1016/j.molimm.2007.09.015

Global identification and comparative analysis of SOCS genes in fish: Insights into the molecular evolution of SOCS family

Hong-Jian Jin, Jian-Zhong Shao, Li-Xin Xiang, Hao Wanga and Li-Li Sun
College of Life Sciences, Zhejiang University, Hangzhou 310058, China

... search coding exons or open reading frames (ORF) by the GENSCAN program (http://genes.mit.edu/GENSCAN.html) or GENE FINDING programs at the Softberry web ...


Archives of Virology
Volume 152, Number 8 / August 2007 p. 1457-1465

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China

Y. Teng et al.,
State Key Laboratory of Biocontrol, College of Life Sciences, Sun Yat-sen University, Guangzhou, P.R. China

... the genomic map. Putative ORFs were predicted by submitting to http:== www.softberry.com (Softberry Inc., Mount Kisco, NY). In all ...


Molecular and Biochemical Parasitology
Volume 154, Issue 1, July 2007, Pages 52-61

Are Caenorhabditis elegans receptors useful targets for drug discovery: Pharmacological comparison of tyramine receptors with high identity from C. elegans (TYRA-2) and Brugia malayi (Bm4)

Katherine A. Smith, Elizabeth B. Rex and Richard W. Komunieck
Department of Biological Sciences, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606-3390, USA

... were performed with TYRA-2. Contigs with high matches to C. elegans proteins were run through a modified gene prediction program, Softberry (http://sun1 ...


Biochemical and Biophysical Research Communications
Volume 358, Issue 4, 13 July 2007, Pages 1148-1153

Characterization of two temperature-inducible promoters newly isolated from B. subtilis

Wang Li et al.,
College of Animal Sciences, Northwest A&F University, Yangling 712100, People’s Republic of China

... The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk); promoter region was predicted by softberry software (www.softberry.com). ...


Biochemical and Biophysical Research Communications
Volume 354, Issue 1, 2 March 2007, Pages 90-95

Assay and characterization of a strong promoter element from B. subtilis

Ai-Ling Zhang et al.,
College of Animal Sciences, Northwest A&F University, Yangling 712100, People’s Republic of China

... The sequence analysis was performed online with NCBI blast (http://www.ncbi.nih. gov), and promoters were predicted online by using of softberry (http://www ...


Crop Sci
47:14-26 (2007)

The FAD2 Gene Family of Soybean:
Insights into the Structural and Functional Divergence of a Paleopolyploid Genome


Jessica A. Schlueter et al.,
USDA-ARS-CICGR, Ames, IA 50011

... based parameters (www.softberry.com; verified 13 Dec. 2006), and GeneMark.hmm with A. thaliana based parameters (Lukashin and Borodovsky, 1998) were run. ...


J Gen Virol
88 (2007), 450-457; DOI 10.1099/vir.0.82396-0

Genome organization of the Chelonus inanitus polydnavirus: excision sites, spacers and abundance of proviral and excised segments

Marc Annaheim and Beatrice Lanzrein
Institute of Cell Biology, Baltzerstrasse 4, CH-3012 Bern, Switzerland

... Gene prediction with Softberry software suggested the presence of a gene with a deduced product of 57 amino acids and two exons on the spacer. ...


Molecular Biology and Evolution
2007 24(2):539-550; doi:10.1093/molbev/msl183

Mechanisms and Rates of Birth and Death of Dispersed Duplicated Genes during the Evolution of a Multigene Family in Diploid and Tetraploid Wheats

Eduard D. Akhunov, Alina R. Akhunova and Jan Dvorak
Department of Plant Sciences, University of California, Davis

... No known promoter or enhancer elements were found with the promoter prediction software (www.softberry.com/berry.phtml) within a 1,297-bp sequenced region ...


Journal of Bacteriology
March 2007, p. 1774-1782, Vol. 189, No. 5

The fox Operon from Rhodobacter Strain SW2 Promotes Phototrophic Fe(II) Oxidation in Rhodobacter capsulatus SB1003

Laura R. Croal, Yongqin Jiao, and Dianne K. Newman
Division of Biology, Division of Geological and Planetary Sciences, Howard Hughes Medical Institute, California Institute of Technology, Pasadena, California 91125

... Predicted operons, promoters, and terminators were identified with the tools at Softberry (http://www.softberry.com/berry.phtml). ...


PLoS Comput Biol
2006 2(3): e18 doi:10.1371/journal.pcbi.0020018

A Third Approach to Gene Prediction Suggests Thousands of Additional Human Transcribed Regions

Glusman G, Qin S, El-Gewely MR, Siegel AF, Roach JC, et al.
1 Institute for Systems Biology, Seattle, Washington, United States of America, 2 Institute of Medical Biology, University of Tromso, Tromso, Norway, 3 Departments of Management Science, Finance and Statistics, University of Washington, Seattle, Washington, United States of America

...We include here the genomewide annotation of known genes (KG), Ensembl genes (ENS), Twinscan (TW), GenScan (GS), Softberry genes (SB)..


Infection and Immunity,
January 2006, p. 410-424, Vol. 74, No. 1

DNA Adenine Methyltransferase Influences the Virulence of Aeromonas hydrophila

Tatiana E. Erova et al.,
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas 77555-1070

... Putative -10 (GGGTAGAAT) and -35 (TAGCCA) elements of the promoter were also identified in this region using a software program found at www.softberry.com. ...


Molecular Microbiology
Volume 59 Issue 2 Page 707-721, January 2006

Evidence for siderophore-dependent iron acquisition in group B streptococcus

Anne Clancy et al.,
1Division of Infectious Diseases, Immunology, and Rheumatology, Department of Pediatrics, Children's Hospital and Regional Medical Center/University of Washington, 307 Westlake Avenue N, Seattle WA 98109, USA. 2
Department of Microbiology and Immunology, University of Western Ontario, London, ON, Canada N6A 5C1.

... The promoter prediction programs utilized were http:/ / www.fruitfly.org/ seq_tools/ promoter.html and http:/ / www.softberry.com/ berry.phtml?topic=promoter . ...


Infection and Immunity,
October 2006, p. 5763-5772, Vol. 74, No. 10

Mutations within the Catalytic Motif of DNA Adenine Methyltransferase (Dam) of Aeromonas hydrophila Cause the Virulence of the Dam-Overproducing Strain To Revert to That of the Wild-Type Phenotype

Tatiana E. Erova et al.,
Department of Microbiology and Immunology, The University of Texas Medical Branch, Galveston, Texas 77555-1070

... be methylated by Dam, resulting in increased Act production, were detected within the putative promoter region by using a software program from Softberry, Inc. ...


JBC Papers in Press.
Published on May 15, 2006 as Manuscript M601307200

Importance of CREB in Regulation of Expression of the Murine Cyclic Nucleotide Phosphodiesterase 3B (PDE3B) Gene in Differentiating 3T3-L1 Preadipocytes

Hanguan Liu et al.,
Pulmonary/Critical Care Medicine Branch, National Heart, Lung, and Blood Institute, National
Institutes of Health, Bethesda, MD 20892 and +Section for Molecular Signaling, Department of Cell and Molecular Biology, University of Lund, S-22100, Lund, Sweden

Consistent with our experimental results, two promoter regions (beginning at position -4061 and another, at-364) were predicted when 5105 bp of the 5’-flanking sequence of the murine PDE3B gene was queried at http://www.softberry.com/all.htm.


Molecular Biology and Evolution
2006 23(7):1386-1396; doi:10.1093/molbev/msl004

Molecular Characterization of a Diagnostic DNA Marker for Domesticated Tetraploid Wheat Provides Evidence for Gene Flow from Wild Tetraploid Wheat to Hexaploid Wheat

Jan Dvorak, Eduard D. Akhunov, Alina R. Akhunov, Karin R. Deal and Ming-Cheng Luo
Department of Plant Sciences, University of California, Davis

A putative transcription start was identified 166 bp upstream of the translation start by searching promoter a database at http://www.softberry.com/berry.phtml.


Genetics,
Vol. 172, 1251-1261, February 2006

The Maize aberrant pollen transmission 1 Gene Is a SABRE/KIP Homolog Required for Pollen Tube Growth

Zhennan Xu*, and Hugo K. Dooner*
* Waksman Institute, Rutgers University, Piscataway, New Jersey 08855 and Department of Plant Biology, Rutgers University, New Brunswick, New Jersey 08901

...The exon–intron junctions of the rice SAK genes were determined with the Softberry sequence analysis program (http:// www.softberry.com/berry.phtml), aided by the maize apt1 full-length cDNA sequence....


Science
28 April 2006: Vol. 312. no. 5773, pp. 583 - 588

Global Control of Dimorphism and Virulence in Fungi

Julie C. Nemecek,1 Marcel Wuthrich,2 Bruce S. Klein
Department of Medical Microbiology and Immunology, University of Wisconsin Medical School, University of Wisconsin Hospital and Clinics, Madison, WI 53792, USA.

... ORFA encodes a protein of 1274 residues (on the basis of transcript size) and predicted by gene-finding software (Softberry, Mount Kisco, NY). ...


Applied and Environmental Microbiology
February 2006, p. 1086-1095, Vol. 72, No. 2

The Naphthalene Catabolic (nag) Genes of Polaromonas naphthalenivorans CJ2: Evolutionary Implications for Two Gene Clusters and Novel Regulatory Control

Che Ok Jeon,1,2 Minjeong Park,2 Hyun-Su Ro,2,3 Woojun Park,4 and Eugene L. Madsen1
Department of Microbiology, Cornell University, Ithaca, New York 14853-8101,
1 Division of Environmental Biotechnology, EBNCRC & PMBBRC, Gyeongsang National University, 900 Gazwa-dong, JinJu, GyeongNam 660-701, Korea,

... 1). Transcription promoters and termination sequences of the nag gene clusters were analyzed by using web-based programs (http://www.softberry.com/; http://www ...


Blood Coagulation & Fibrinolysis.
17(1):69-73, January 2006.

Identification of five novel mutations in the factor XI gene (F11) of patients with factor XI deficiency

Quelin, Florence et al.,
... NetGene2/ ; http://www.fruitfly.org/cgi-bin/seq_tools/splice.pl ; http://125.itba. mi.cnr.it/?webgene/wwwspliceview.html ; http://www.softberry.com/cgi-bin ...


Acta Biochimica et Biophysica Sinica,
Volume 38, Number 7, July 2006 , pp. 492-499(8)

OsFY, a Homolog of AtFY, Encodes a Protein that Can Interact with OsFCA-g in Rice (Oryza sativa L.)

LU, Qi; XU, Zheng-Kai; SONG, Ren-Tao
Shanghai Key Laboratory of Bio-energy Crop, School of Life Sciences, Shanghai University, Shanghai 200444, China

... AP003735). We predicted OsFY mRNA using HMM-based gene structure prediction with the monocot setting at http:/ /www.softberry.com/berry.phtml. ...


Archives of Microbiology
Volume 186, Number 6 / December, 2006 513-517

The ntp operon encoding the Na+ V-ATPase of the thermophile Caloramator fervidus

Trees Ubbink-Kok1, Jeroen Nijland1, Dirk-Jan Slotboom2 and Juke S. Lolkema1

(1) Molecular Microbiology, Biomolecular Sciences and Biotechnology Institute, University of Groningen, Kerklaan 30, 9751 NN, Haren, Groningen, The Netherlands (2) Membrane Enzymology, Biomolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 4, 9747 AG Groningen, The Netherlands

... related organ- isms. Putative promoters and terminators were identi- Wed at http://www.softberry.com/berry.phtml. The sequence was ...


Molecular Biology and Evolution
2006 23(3):550-558

Molecular Evolution of the Ankyrin Gene Family

Xinjiang Cai, and Yanhong Zhang
Howard Hughes Medical Institute and Departments of Cell Biology, Biochemistry, and Neuroscience, Duke University Medical Center and Department of Medicine, Duke University Medical Center

... open reading frames using the GENSCAN program (Burge and Karlin 1997 Go) (http://genes.mit.edu/GENSCAN.html) or GENE FINDING programs at the Softberry Web ...


DNA Sequence
Volume 17, Issue 1 February 2006 , pages 31 - 40

Alternative splicing and expression analysis of OsFCA (FCA in Oryza sativa L.), a gene homologous to FCA in Arabidopsis

Xiling Du; Xiaoyin Qian; Dong Wang; Jinshui Yang
Institute of Genetics, School of Life Sciences, Fudan University. Shanghai. China

... The obtained genomic sequence was sent to Softberry (www.softberry.com) to predict the sequence of full length cDNA of OsFCA. ... Softberry (www.softberry.com). ...


Applied and Environmental Microbiology
February 2006, p. 1496-1506, Vol. 72, No. 2

Paenibacillus sp. Strain JDR-2 and XynA1: a Novel System for Methylglucuronoxylan Utilization

Franz J. StJohn, John D. Rice, and James F. Preston*
Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida 32611

... Analysis of sequences for regulatory elements was conducted using the online tools available through Softberry (http://www.softberry.com/berry.phtml). ...


Microbiology
151 (2005), 1671-1682; DOI 10.1099/mic.0.27848-0

mrpA, a gene with roles in resistance to Na+ and adaptation to alkaline pH in the cyanobacterium Anabaena sp. PCC7120

A. Blanco-Rivero1,, F. Leganes1, E. Fernandez-Valiente1, P. Calle2 and F. Fernandez-Pinas1
1 Departamento de Biologia, Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid 28049, Spain 2 Departamento de Quimica Fisica Aplicada, Universidad Autonoma de Madrid, Madrid 28049, Spain

... A promoter-like sequence (-35 region and -10 region; http://www.softberry.com/ berry.phtml) was found in the upstream region (data not shown). ...


Journal of Bacteriology
December 2005, p. 8247-8255, Vol. 187, No. 24 doi:10.1128/JB.187.24.8247-8255.2005

Distribution and Expression of the ZmpA Metalloprotease in the Burkholderia cepacia Complex

S. Gingues, C. Kooi, M. B. Visser, B. Subsin, and P. A. Sokol
Department of Microbiology & Infectious Diseases, University of Calgary, Calgary, Alberta T2N 4N1, Canada

... promoter sequences of J2315 and Pc715j zmpA were compared and found to be identical in both the -35 (TTGTAA) and -10 (TTCTAGCAT) regions (www.softberry.com ...


Current Microbiology
Volume 50, Number 3 / March, 2005 pp. 129-132

Characterization of a 4 kb Variant of the nifD Element in Anabaena sp. Strain ATCC 33047

Brian J. Henson1, Linda E. Watson1 and Susan R. Barnum1
(1) Department of Botany, Miami University, Oxford, OH 45056, USA

... ORF searches were performed with the NCBI ORF finder (www.ncbi.nlm.nih.gov), Gene Finder (www.softberry.com), and Gene Mark (http://opa1.biology.gatech.edu ...


Microbiology
151 (2005), 1381-1393; DOI 10.1099/mic.0.27718-0

Enterococcus faecalis divIVA: an essential gene involved in cell division, cell growth and chromosome segregation

Sandra Ramirez-Arcos1,2,, Mingmin Liao1, Susan Marthaler1, Marc Rigden1 and Jo-Anne R. Dillon1,2,
1 Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON, Canada K1H 8M5 2 Centre for Research in Biopharmaceuticals and Biotechnology, University of Ottawa, Ottawa, ON, Canada K1H 8M5

... and the presence of putative promoters and transcriptional terminators in the E. faecalis dcw gene cluster was completed using http://sun1.softberry.com/berry ...


Journal of Experimental Botany
2005 56(414):1177-1188; doi:10.1093/jxb/eri110

Molecular characterization of DNA sequences from the Primula vulgaris S-locus

Manfield et al.,
Centre for Plant Sciences, Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, UK

... Prediction of putative genes structures was undertaken using gene prediction software using the default parameters (www.softberry.com/berry.phtml). Results. ...


Antimicrobial Agents and Chemotherapy
April 2005, p. 1432-1440, Vol. 49, No. 4 doi:10.1128/AAC.49.4.1432-1440.20

Acquisition of Resistance to Carbapenems in Multidrug-Resistant Clinical Strains of Acinetobacter baumannii: Natural Insertional Inactivation of a Gene Encoding a Member of a Novel Family of ?-Barrel Outer Membrane Proteins

Maria A. Mussi, Adriana S. Limansky, and Alejandro M. Viale
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, Rosario, Argentina

... Predictions of consensus bacterial promoter sequences were conducted at http://www.softberry.com. Nucleotide sequence accession numbers. ...


Nucleic Acids Research
2005 33(5):1739; doi:10.1093/nar/gki320

Human pol II promoter prediction: time series descriptors and machine learning

Rajeev Gangal and Pankaj Sharma
SciNova Technologies Pvt. Ltd 528/43 Vishwashobha, Adjacent to Modi Ganpati, Narayan Peth, Pune 411030, Maharashtra, India

... for promoter prediction, eg Neural Network Promoter Prediction (http://www.fruitfly. org/seq_tools/promoter.html), SoftBerry (http://www.softberry.com/berry ...


Plant Molecular Biology
Volume 58, Number 3 / June, 2005 pp.421-433

OsPPR1, a pentatricopeptide repeat protein of rice is essential for the chloroplast biogenesis

Kodiveri M. Gothandam1, Eun-Sook Kim1, Hongjoo Cho1 and Yong-Yoon Chung1
(1) School of Life Sciences and Biotechnology, Korea University, Sungbuk-ku, 136-701, Seoul, Anam-Dong, Korea

... nucleotide and amino acid sequences were analyzed by the Basic Local Alignment Search Tool (BLAST) and the Softberry prog- rame (http://www.softberry.com/). ...


Mol Cells.
2005 Apr 30;19(2):212-8.

Characterization of an abiotic stress-inducible dehydrin gene, OsDhn1, in rice (Oryza sativa L.)

Lee SC et al.,
Department of Life Science, Sogang University, Seoul 121-742, Korea

... genomic sequences were retrieved (with E-values < 3.8) all of which contained putative dehydrin genes as predicted by the annotation tool, Softberry (http://www ...


Microbiol Res.
2005;160(3):233-42.

Salt stress induction of glutamyl endopeptidase biosynthesis in Bacillus intermedius

Gabdrakhmanova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia

... was inspected for the occurrence of the characteristic -35 and -10 boxes of SigA-type promoters (Helmann, 1995) by using the Softberry Prediction of ...


Biochim Biophys Acta.
2005 Jan 3;1739(2-3):140-9

Potential structure/function relationships of predicted secondary structural elements of tau

Gamblin TC.
Department of Molecular Biosciences, University of Kansas, 1200 Sunnyside Ave. Lawrence, KS 66045, USA

... sequence [17]. This analysis was originally performed on-line, and is now available at http://www.softberry.com/berry.phtml. The ...


Microbiology
150 (2004), 518-520; DOI 10.1099/mic.0.26871-0

IVET experiments in Pseudomonas fluorescens reveal cryptic promoters at loci associated with recognizable overlapping genes

Mark W. Silby1, Paul B. Rainey2,3 and Stuart B. Levy1,4
1 Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, USA

...Using SoftBerry software (http://www.softberry.com/berry.phtml), -35 and -10 boxes and a transcriptional start site were predicted 84, 60 and 44 bp upstream of the iiv5 ORF, respectively...


alzheimer’s disease brain Journal Journal of Molecular Neuroscience
Volume 24, Number 2 / June, 2004 pp.269-275

The splicing regulatory protein p18SRP is down-regulated in alzheimer’s disease brain

Heese et al.,
(1) BF Research Institute, c/o National Cardiovascular Center, 565-0873 Suita, Osaka, Japan (2) Choju Medical Institute, Fukushimura Hospital, Noyori, 441-8124 Toyohashi, Aichi, Japan

... Protein sequence analysis was per- formed with Prosite, Profile, Blocks, ProDom, Prints, Pfam, PsortII, Softberry, AACompIdent, Inter- ProScan, SMART,and ELM ...


Plant Science
Volume 166, Issue 1, January 2004, Pages 69-79

Trapping and characterization of cold-responsive genes from T-DNA tagging lines in rice

Lee et al.,
a Department of Life Science, Sogang University, Seoul 121-742, South Korea b Department of Life Science, Pohang University of Science and Technology, Pohang 790-784, South Korea

... database, and were annotated using the Rice Genome Automated Annotation System (RiceGAAS; http://www.ricegaas.dna.affrc.go.jp), the Softberry program (http ...


Plant Molecular Biology
Volume 54, Number 4 / March, 2004 pp. 489-502

Generation of T-DNA Tagging Lines with a Bidirectional Gene Trap Vector and the Establishment of an Insertion-Site Database

Ryu et al.,
(1) National Research Laboratory of Plant Functional Genomics, Department of Life Science, Pohang University of Science and Technology (POSTECH), Pohang, 790-784, Republic of Korea (2) Department of Molecular Biology, Pusan National University, Busan, 609-735, Republic of Korea

... been annotated in the public databases, we undertook annotation with the Softberry program (http:// www.softberry.com/berry.phtml). ...


J Cell Biochem.
2004 Apr 1;91(5):1030-42

Characterizing the new transcription regulator protein p60T

Heese et al.,
BF Research Institute, c/o National Cardiovascular Center, 5-7-1 Fujishirodai, Suita, Osaka 565-0873, Japan

... expasy.ch): softberry: http://www.softberry. com/index.html; and Amino Acid Composition Search (AACompIdent): http://kr.expasy.org/ tools/aacomp/. ...


Journal of Photoscience
2004, Vol. 11(3), pp. 115-120

Construction of Gene-Specific Primers for Various AntioxidantIsoenzyme Genes and Their Expressions in Rice (Oryza sativa L.)Seedlings Obtained from Gamma-irradiated Seed

Kim et al.,
1 Division of Radiation Application Research, Korea Atomic Energy Research Institute, Daejeon 305-353, Korea

... in the database (Table 1). In the case of CATa, its cDNA sequence was predicted from the genomic DNA at a gene prediction site (http:// www.softberry.com/). ...


Genome Biol.
2003;5(1):R3. Epub 2003 Dec 22

An integrated gene annotation and transcriptional profiling approach towards the full gene content of the Drosophila genome.

Hild et al.,
Zentrum fur Molekulare Biologie Heidelberg, University of Heidelberg, Im Neuenheimer Feld 282, 69120 Heidelberg, Germany.

... Max Planck Institute for Molecular Genetics, Ihnestra?e 73, 14195 Berlin, Germany. § Softberry, Inc., 116 Radio Circle, Suite ...


Invest Ophthalmol Vis Sci
2003;44: E-Abstract 418. 418—B393

Identification of Promoter and Other Regulatory Regions of Pitx3 Gene

E.V. Semina1, K. Frees2, S. Tomarev3, A. Cvekl4 and J.C. Murray4
1 Pediatrics, Medical College of Wisconsin, Milwaukee, WI, United States 2 Pediatrics, University of Iowa, Iowa City, IA, United States

... MatInspector and Softberry software have been utilized to perform promoter searches and to identify binding sites for transcription factors/potential ...


Physiological and Molecular Plant Pathology
Vol. 62, no. 5, pp. 305-313. May 2003

Characterisation of neutral trehalase and UDP-glucose:sterol glucosyltransferase genes from the plant pathogenic fungus Leptosphaeria maculans

Idnurm, A., Warnecke, DC., Heinz, E., Howlett, BJ.*

... The larger transcript, detected by amplification of cDNA using primers designed within an exon predicted by DNA analysis software (www.softberry.com), encodes ...


Plant Physiology
133:2040-2047 (2003)

Generation and Analysis of End Sequence Database for T-DNA Tagging Lines in Rice

Suyoung An et al.,
National Research Laboratory of Plant Functional Genomics, Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang 790-784, Korea (S.A., S.P., D.-H.J., D.-Y.L., H.-G.K., J.-H.Y., J.H., S.-R.K., Y.-H.K., M.L., G.A.

... sequence had not yet been annotated in the public database, the sequence surrounding the insertion site was annotated using the Softberry program (http://www ...


Plant Molecular Biology
Volume 52, Number 5 / July, 2003, pp. 923-934

Abundance of plastid DNA insertions in nuclear genomes of rice and Arabidopsis

Ilham A. Shahmuradov 1 , Yagut Yu. Akbarova 2, Victor V. Solovyev 3 and Jalal A. Aliyev 2
(1) Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK (2) Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan (3) Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA


Nucleic Acids Research,
2003, Vol. 31, No. 4 1148-1155

Characterization of Arabidopsis thaliana ortholog of the human breast cancer susceptibility gene 1: AtBRCA1, strongly induced by gamma rays

S. Lafarge and M.-H. Montane*
CEA Cadarache, DSV-DEVM, Laboratoire de Radiobiologie Vegetale, Bat 185, F-13108 St Paul Lez Durance Cedex, France

...Gene structure prediction was done on software implemented on the Softberry web page (http://www.softberry.com/), analysis of protein domains using the SMART... ...The gene structure of At4g21070 was determined with three gene structure prediction software packages (Softberry, GenScan, Grail). .... To resolve this ambiguity in intron-exon prediction, we postulated the presence of two genes given by Softberry prediction software and performed northern blotting and 5' RACE to characterize the structural organization of the At4g21070 locus...


The Plant Cell
Vol. 14, 2107-2119, September 2002

Two Novel Fungal Virulence Genes Specifically Expressed in Appressoria of the Rice Blast Fungus

Chaoyang Xue a et al.,
a Department of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907

... were sequenced and analyzed with several programs, including TRES (www.bioportal. bic.nus.edu.sg/tres), Expasy (www.expasy.org), and SoftBerry (www.softberry.com ...


Biological Psychiatry
Volume 51, Issue 11, Pages 896-901

Association study of novel human serotonin 5-HT1B polymorphisms with alcohol dependence in taiwanese han

H.Sun et al.,

... be identified within the 5? regulatory region; however, sequence annotation using the Nucleotide Sequence Analysis program (http://softberry.com/) predicts a ...


Journal of Bacteriology
January 2002, p. 183-190, Vol. 184, No. 1

Regulation of the acuF Gene, Encoding Phosphoenolpyruvate Carboxykinase in the Filamentous Fungus Aspergillus nidulans

Michael J. Hynes,* Oliver W. Draht,, and Meryl A. Davis
Department of Genetics, University of Melbourne, Parkville, Victoria 3010, Australia

... The Protein Sequence Analysis program (http://www.softberry.com/protein.html) predicted a PEPCK (ATP) signature sequence between amino acids 275 and 290. ...


Eur J Neurosci.
2002 Jan;15(1):79-86.

Characterizing CGI-94 (comparative gene identification-94) which is down-regulated in the hippocampus of early stage Alzheimer's disease brain

Heese et al.,
BF Research Institute, c/o National Cardiovascular Center, 5-7-1 Fujishiro-dai, Suita, Osaka, 565-0873 Japan

... Additionally, protein sequence analysis was performed using the following programs at ExPASy, http://www.expasy.ch; softberry, http://www/softberry.com/index ...


Plant Cell
2002 September; 14(9): 2107–2119. doi: 10.1105/tpc.003426

Two Novel Fungal Virulence Genes Specifically Expressed in Appressoria of the Rice Blast Fungus

Chaoyang Xue et al.,
aDepartment of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907

... were sequenced and analyzed with several programs, including TRES (www.bioportal. bic.nus.edu.sg/tres), Expasy (www.expasy.org), and SoftBerry (www.softberry.com ...


Plant Physiol.
February 2002, Vol. 128, pp. 336-340

Cellulose Synthase-Like Genes of Rice

Samuel P. Hazen, John S. Scott-Craig, and Jonathan D. Walton
Department of Energy-Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824

... the corresponding proteins were deduced using gene prediction software from GeneMark (Atlanta; http://opal.biology.gatech.edu/GeneMark) and Softberry, Inc. ...



©2001-2024   www.softberry.com