|
|
|
|
Nsite-h |
Search for functional motifs conserved in orthologs
ACTION:
Search for Conservative Motifs of Regulatory Elements (REs)from both
Collection of thousands REs (of human and animals or plant species)
created by us and Collection of REs given by USER available in both of
2 aligned (in special FORMAT) homologous (orthologous) DNA sequences (Max. Length - 100 000 nt)
SEARCH CONDITIONS:
(1) Expected Mean Numbers of any regulatory motif found must be less than a given number (default: 0.01);
(2) Homology Level of any motif in one sequence with the corresponding area of another sequence (in relation to ALIGNMENT) must be higher
than a given level.
Output example:
Program Nsite-h (Softberry Inc.) | Version 2.2004 Search for motifs of 702 Regulatory Elements (REs) in a pair of Homologous Sequences
| SET of REs: REGSITE DB (Plants; version IV) ____________________________________________________________ Search PARAMETERS: Expected Mean Number : 0.0500000 Statistical Significance Level : 0.9500000 Minimal Conservative Level : 80 % Level of homology between known RE and motif: 80% Variation of Distance between RE Blocks : 20% NOTE: RE - Regulatory Element/Consensus | AC - Accession No of RE in a given DB OS - Organism/Species | BF - Binding Factor or One of them Mism. - Mismatches | Mean. Exp. Number - Mean Expected Number
| Up.Conf.Int. - Upper Confidence Interval ============================================================ QUERY: >H-NPPA/AL021155/[33199:35843/c]/-2000:+645/CDS: 33198/c,premRNA:>33843/c Length of Query Sequence: 2845 bp
| Nucleotide Frequencies: A - 0.25 G - 0.27 T - 0.24 C - 0.24 ............................................................ RE: 1. AC: RSP00001//OS: Spinach /GENE: rps1/RE: S1F_BS /BF: S1F, spinach leaf nuclear factor Motifs on "+" Strand: Mean Exp. Number 0.00090 Up.Conf.Int. 1 Found 1 2577 AGAATTGTTACCATGAAA 2594 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor Motifs on "+" Strand: Mean Exp. Number 0.01145 Up.Conf.Int. 1 Found 1 2619 ACACGTGGC 2627 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 4. AC: RSP00004//OS: Arabidopsis thaliana /GENE: CHS/RE: UV/BLRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.03635 Up.Conf.Int. 1 Found 1 2628 TAGACACGTAGA 2639 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 6. AC: RSP00006//OS: Soybean, Glysine max /GENE: GS15/RE: ATRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00728 Up.Conf.Int. 1 Found 1 2651 AAATTATTTTATAT 2664 (Mism.= 0; Cons.: 100 %) Motifs on "-" Strand: Mean Exp. Number 0.00763 Up.Conf.Int. 1 Found 1 831 AAATgATTTTATtT 818 (Mism.= 2; Cons.: 100 %) ............................................................ RE: 7. AC: RSP00007//OS: Tobacco; Nicotiana tabacum /GENE: CHN50/RE: ElRE /BF: unknown Motifs on "+" Strand: Mean Exp. Number 0.00003 Up.Conf.Int. 1 Found 1 2665 GATTTGGTCAGAAAGTCAGTCC 2686 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 8. AC: RSP00008//OS: Spinach; Spinachia oleracera /GENE: NiR/RE: NiRE /BF: NIT2 ZN-finger protein Motifs on "+" Strand: Mean Exp. Number 0.00000 Up.Conf.Int. 1 Found 1 2687 CAAAGCGACAAAAATAGATATTAGTAACACA 2717 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 9. AC: RSP00009//OS: Spinach; Spinachia oleracera /GENE: NiR/RE: GATA /BF: NIT2 ZN-finger protein Motifs on "+" Strand: Mean Exp. Number 0.02504 Up.Conf.Int. 1 Found 3 2466 TAGATA 2471 --24-- 2496 TATCTA 2501 (Mism.= 0/ 0; Cons.: 100/100 %) 2502 TAGATA 2507 --25-- 2533 TATCTA 2538 (Mism.= 0/ 0; Cons.: 100/100 %) 2539 TAGATA 2544 --26-- 2571 TATCTA 2576 (Mism.= 0/ 0; Cons.: 100/100 %) Motifs on "-" Strand: Mean Exp. Number 0.02573 Up.Conf.Int. 1 Found 3 2576 TAGATA 2571 --26-- 2544 TATCTA 2539 (Mism.= 0/ 0; Cons.: 100/100 %) 2538 TAGATA 2533 --25-- 2507 TATCTA 2502 (Mism.= 0/ 0; Cons.: 100/100 %) 2501 TAGATA 2496 --24-- 2471 TATCTA 2466 (Mism.= 0/ 0; Cons.: 100/100 %) ............................................................ RE: 11. AC: RSP00011//OS: Catharanthus roseus /GENE: Str/RE: G-box (ext) /BF: TAF-1 Motifs on "+" Strand: Mean Exp. Number 0.01262 Up.Conf.Int. 1 Found 1 2778 CTCCACGTGGT 2788 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 14. AC: RSP00014//OS: Arabidopsis thaliana /GENE: CHS/RE: MRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.03690 Up.Conf.Int. 1 Found 1 2789 TCTAACCTACC 2799 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 15. AC: RSP00015//OS: Arabidopsis /GENE: AtCDC6/RE: E2F1-BE /BF: E2F1 Motifs on "+" Strand: Mean Exp. Number 0.03645 Up.Conf.Int. 1 Found 1 2800 TTTCCCGC 2807 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 19. AC: RSP00019//OS: Catharantus roseus; Madafascar periwinkle /GENE: TDC/RE: GT-1#Box5 /BF: GT-1 Motifs on "+" Strand: Mean Exp. Number 0.00541 Up.Conf.Int. 1 Found 1 2822 AGATGGTATATT 2833 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 20. AC: RSP00020//OS: Catharantus roseus; Madafascar periwinkle /GENE: TDC/RE: GT-1#Box6 /BF: GT-1 Motifs on "+" Strand: Mean Exp. Number 0.00566 Up.Conf.Int. 1 Found 1 2834 GTCGAGTAAAAA 2845 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 39. AC: RSP00039//OS: tomato, Lycopersicon esculentum /GENE: LAT56; LAT59;/RE: 56/59 box
/BF: GT-1 related transcription factors Motifs on "+" Strand: Mean Exp. Number 0.04515 Up.Conf.Int. 1 Found 1 1487 gGAAATTGTGA 1497 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 48. AC: RSP00048//OS: barley, Hordeum vulgare /GENE: HVA1 gene/RE: ABRE A2; ABRE2 /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00701 Up.Conf.Int. 1 Found 1 1850 CCcACGTGGCGG 1861 (Mism.= 1; Cons.: 100 %) Motifs on "-" Strand: Mean Exp. Number 0.00655 Up.Conf.Int. 1 Found 1 719 CCTAaGTGGCGG 708 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 55. AC: RSP00055//OS: maize, Zea mays /GENE: /RE: ABRE A /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.00267 Up.Conf.Int. 1 Found 1 1859 GCCACGTGGG 1850 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 60. AC: RSP00060//OS: maize, Zea mays /GENE: rab28/RE: CE3 /BF: ABF Motifs on "-" Strand: Mean Exp. Number 0.00865 Up.Conf.Int. 1 Found 1 2490 ACGCGCCgCCTC 2479 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 67. AC: RSP00067//OS: maize, Zea mays /GENE: rab28/RE: ABRE A /BF: ABF Motifs on "-" Strand: Mean Exp. Number 0.00267 Up.Conf.Int. 1 Found 1 1859 GCCACGTGGG 1850 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 68. AC: RSP00068//OS: Arabidopsis thaliana /GENE: CHS/RE: UV LRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00295 Up.Conf.Int. 1 Found 1 2630 GACACGTAGA 2639 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 70. AC: RSP00070//OS: rice, Oryza sativa /GENE: Osem/RE: ABRE motif A /BF: TRAB1 Motifs on "-" Strand: Mean Exp. Number 0.04425 Up.Conf.Int. 1 Found 1 2637 TACGTGTC 2630 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 162. AC: RSP00163//OS: Soybean, Glycine max /GENE: /RE: DR5 /BF: ARF1 Motifs on "+" Strand: Mean Exp. Number 0.01815 Up.Conf.Int. 1 Found 1 1898 CCaTTTGTCTC 1908 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 164. AC: RSP00165//OS: tobacco (Nicotiana tabacum) /GENE: RNP2/RE: E2Fa /BF: E2F Motifs on "+" Strand: Mean Exp. Number 0.03645 Up.Conf.Int. 1 Found 1 2800 TTTCCCGC 2807 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 174. AC: RSP00175//OS: Arabidopsis thaliana /GENE: /RE: /BF: ABFs Motifs on "+" Strand: Mean Exp. Number 0.04596 Up.Conf.Int. 1 Found 2 1852 CACGTGGC 1859 (Mism.= 0; Cons.: 100 %) 2620 CACGTGGC 2627 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 203. AC: RSP00204//OS: Arabidopsis thaliana /GENE: AtEm6/RE: ABRE/6.2 /BF: ABI5 Motifs on "+" Strand: Mean Exp. Number 0.00306 Up.Conf.Int. 1 Found 1 2618 GACACGTGGC 2627 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 226. AC: RSP00227//OS: pea, Pisum sativum /GENE: rbcS-3A/RE: BOX III* /BF: GT-1 Motifs on "-" Strand: Mean Exp. Number 0.00829 Up.Conf.Int. 1 Found 1 276 AAGATAAGA 268 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 228. AC: RSP00229//OS: Arabidopsis thaliana /GENE: AGAMAOUS (AG)/RE: CArG box 1 /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.01011 Up.Conf.Int. 1 Found 1 1953 CCAAATAAGG 1944 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 233. AC: RSP00234//OS: Arabidopsis thaliana /GENE: AGAMAOUS (AG)/RE: CArG Box 2 /BF: unknown Motifs on "+" Strand: Mean Exp. Number 0.02763 Up.Conf.Int. 1 Found 1 448 GCTTCTAAGG 457 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 249. AC: RSP00250//OS: pea, Pisum sativum /GENE: /RE: Myb2 /BF: Myb26; Myb-like DNA binding protein Motifs on "-" Strand: Mean Exp. Number 0.02440 Up.Conf.Int. 1 Found 1 2803 gAAAGgTAGGTTA 2791 (Mism.= 2; Cons.: 100 %) ............................................................ RE: 285. AC: RSP00286//OS: parsley (Petroselinum crispum) /GENE: PAL-1/RE: Box L /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.01735 Up.Conf.Int. 1 Found 1 2789 TCTaACCTACC 2799 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 297. AC: RSP00298//OS: Nicotiana benthamiana /GENE: PCNA; cell cycle-ralted genes/RE: E2F-1 /BF: E2F Motifs on "+" Strand: Mean Exp. Number 0.03645 Up.Conf.Int. 1 Found 1 2800 TTTCCCGC 2807 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 340. AC: RSP00341//OS: spinach (Spinacia oleracea); /GENE: rps1/RE: S1F BS1 /BF: S1F Motifs on "+" Strand: Mean Exp. Number 0.00310 Up.Conf.Int. 1 Found 1 2578 GAATTGTTACCATGAAA 2594 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 365. AC: RSP00366//OS: tobacco, Nicotiana tabacum /GENE: CHN50/RE: ERE /BF: TDBA12 Motifs on "-" Strand: Mean Exp. Number 0.00655 Up.Conf.Int. 1 Found 1 2682 TGACTTTCTGAC 2671 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 396. AC: RSP00397//OS: tobacco (Nicotiana tabacum) /GENE: RNP2/RE: CDE /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.03734 Up.Conf.Int. 1 Found 1 715 AGTGGCGG 708 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 449. AC: RSP00450//OS: bean, Phaseolus vulgaris /GENE: CHS/RE: AIV /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.00572 Up.Conf.Int. 1 Found 1 2822 TCAAAAATgTGC 2811 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 450. AC: RSP00450//OS: bean, Phaseolus vulgaris /GENE: CHS/RE: AIIV /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.00572 Up.Conf.Int. 1 Found 1 2822 TCAAAAATgTGC 2811 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 556. AC: RSP00556//OS: tomato, Lycopersicon esculentum /GENE: rbcS3C/RE: UN U1 /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.00839 Up.Conf.Int. 1 Found 1 111 GAAAAAtCAAAAGCct 96 (Mism.= 3; Cons.: 100 %) ............................................................ RE: 653. AC: RSP00653//OS: Spinach; Spinachia oleracera /GENE: petH/RE: CT-LB /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.03047 Up.Conf.Int. 1 Found 1 2620 gTCTCTCTCCT 2610 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 658. AC: RSP00658//OS: bean, Phaseolus vulgaris /GENE: beta-phaseolin/RE: G-box (ext) /BF: PG1 Motifs on "+" Strand: Mean Exp. Number 0.00835 Up.Conf.Int. 1 Found 1 2771 ACACGTGCTccAC 2783 (Mism.= 2; Cons.: 100 %) ............................................................ Totally 53 motifs of 43 different REs have been found Of them: 45 motifs of 37 different REs have Conservative Level >= 80 % ------------------------------------------------------------ QUERY: >H-NPPA/AL021155/[33199:35843/c]/-2000:+645/CDS: 33198/c,premRNA:>33843/c Length of Query Sequence: 2365 bp
| Nucleotide Frequencies: A - 0.25 G - 0.28 T - 0.23 C - 0.24 ............................................................ RE: 1. AC: RSP00001//OS: Spinach /GENE: rps1/RE: S1F_BS /BF: S1F, spinach leaf nuclear factor Motifs on "+" Strand: Mean Exp. Number 0.00075 Up.Conf.Int. 1 Found 1 2097 AGAATTGTTACCATGAAA 2114 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor Motifs on "+" Strand: Mean Exp. Number 0.01013 Up.Conf.Int. 1 Found 1 2139 ACACGTGGC 2147 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 4. AC: RSP00004//OS: Arabidopsis thaliana /GENE: CHS/RE: UV/BLRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.03182 Up.Conf.Int. 1 Found 1 2148 TAGACACGTAGA 2159 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 6. AC: RSP00006//OS: Soybean, Glysine max /GENE: GS15/RE: ATRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00484 Up.Conf.Int. 1 Found 1 2171 AAATTATTTTATAT 2184 (Mism.= 0; Cons.: 100 %) Motifs on "-" Strand: Mean Exp. Number 0.00573 Up.Conf.Int. 1 Found 1 831 AAATgATTTTATtT 818 (Mism.= 2; Cons.: 100 %) ............................................................ RE: 7. AC: RSP00007//OS: Tobacco; Nicotiana tabacum /GENE: CHN50/RE: ElRE /BF: unknown Motifs on "+" Strand: Mean Exp. Number 0.00003 Up.Conf.Int. 1 Found 1 2185 GATTTGGTCAGAAAGTCAGTCC 2206 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 8. AC: RSP00008//OS: Spinach; Spinachia oleracera /GENE: NiR/RE: NiRE /BF: NIT2 ZN-finger protein Motifs on "+" Strand: Mean Exp. Number 0.00000 Up.Conf.Int. 1 Found 1 2207 CAAAGCGACAAAAATAGATATTAGTAACACA 2237 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 9. AC: RSP00009//OS: Spinach; Spinachia oleracera /GENE: NiR/RE: GATA /BF: NIT2 ZN-finger protein Motifs on "+" Strand: Mean Exp. Number 0.01849 Up.Conf.Int. 1 Found 3 1986 TAGATA 1991 --24-- 2016 TATCTA 2021 (Mism.= 0/ 0; Cons.: 100/100 %) 2022 TAGATA 2027 --25-- 2053 TATCTA 2058 (Mism.= 0/ 0; Cons.: 100/100 %) 2059 TAGATA 2064 --26-- 2091 TATCTA 2096 (Mism.= 0/ 0; Cons.: 100/100 %) Motifs on "-" Strand: Mean Exp. Number 0.01942 Up.Conf.Int. 1 Found 3 2096 TAGATA 2091 --26-- 2064 TATCTA 2059 (Mism.= 0/ 0; Cons.: 100/100 %) 2058 TAGATA 2053 --25-- 2027 TATCTA 2022 (Mism.= 0/ 0; Cons.: 100/100 %) 2021 TAGATA 2016 --24-- 1991 TATCTA 1986 (Mism.= 0/ 0; Cons.: 100/100 %) ............................................................ RE: 11. AC: RSP00011//OS: Catharanthus roseus /GENE: Str/RE: G-box (ext) /BF: TAF-1 Motifs on "+" Strand: Mean Exp. Number 0.00999 Up.Conf.Int. 1 Found 1 2298 CTCCACGTGGT 2308 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 14. AC: RSP00014//OS: Arabidopsis thaliana /GENE: CHS/RE: MRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.02926 Up.Conf.Int. 1 Found 1 2309 TCTAACCTACC 2319 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 15. AC: RSP00015//OS: Arabidopsis /GENE: AtCDC6/RE: E2F1-BE /BF: E2F1 Motifs on "+" Strand: Mean Exp. Number 0.02610 Up.Conf.Int. 1 Found 1 2320 TTTCCCGC 2327 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 19. AC: RSP00019//OS: Catharantus roseus; Madafascar periwinkle /GENE: TDC/RE: GT-1#Box5 /BF: GT-1 Motifs on "+" Strand: Mean Exp. Number 0.00419 Up.Conf.Int. 1 Found 1 2342 AGATGGTATATT 2353 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 20. AC: RSP00020//OS: Catharantus roseus; Madafascar periwinkle /GENE: TDC/RE: GT-1#Box6 /BF: GT-1 Motifs on "+" Strand: Mean Exp. Number 0.00519 Up.Conf.Int. 1 Found 1 2354 GTCGAGTAAAAA 2365 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 39. AC: RSP00039//OS: tomato, Lycopersicon esculentum /GENE: LAT56; LAT59;/RE: 56/59 box
/BF: GT-1 related transcription factors Motifs on "+" Strand: Mean Exp. Number 0.03550 Up.Conf.Int. 1 Found 1 1007 gGAAATTGTGA 1017 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 48. AC: RSP00048//OS: barley, Hordeum vulgare /GENE: HVA1 gene/RE: ABRE A2; ABRE2 /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00605 Up.Conf.Int. 1 Found 1 1490 CCcACGTGGCGG 1501 (Mism.= 1; Cons.: 100 %) Motifs on "-" Strand: Mean Exp. Number 0.00586 Up.Conf.Int. 1 Found 1 719 CCTAaGTGGCGG 708 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 55. AC: RSP00055//OS: maize, Zea mays /GENE: /RE: ABRE A /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.00228 Up.Conf.Int. 1 Found 1 1499 GCCACGTGGG 1490 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 60. AC: RSP00060//OS: maize, Zea mays /GENE: rab28/RE: CE3 /BF: ABF Motifs on "-" Strand: Mean Exp. Number 0.00847 Up.Conf.Int. 1 Found 1 2010 ACGCGCCgCCTC 1999 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 67. AC: RSP00067//OS: maize, Zea mays /GENE: rab28/RE: ABRE A /BF: ABF Motifs on "-" Strand: Mean Exp. Number 0.00228 Up.Conf.Int. 1 Found 1 1499 GCCACGTGGG 1490 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 68. AC: RSP00068//OS: Arabidopsis thaliana /GENE: CHS/RE: UV LRE /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.00275 Up.Conf.Int. 1 Found 1 2150 GACACGTAGA 2159 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 70. AC: RSP00070//OS: rice, Oryza sativa /GENE: Osem/RE: ABRE motif A /BF: TRAB1 Motifs on "-" Strand: Mean Exp. Number 0.03915 Up.Conf.Int. 1 Found 1 2157 TACGTGTC 2150 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 162. AC: RSP00163//OS: Soybean, Glycine max /GENE: /RE: DR5 /BF: ARF1 Motifs on "+" Strand: Mean Exp. Number 0.01155 Up.Conf.Int. 1 Found 1 1538 CCaTTTGTCTC 1548 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 164. AC: RSP00165//OS: tobacco (Nicotiana tabacum) /GENE: RNP2/RE: E2Fa /BF: E2F Motifs on "+" Strand: Mean Exp. Number 0.02610 Up.Conf.Int. 1 Found 1 2320 TTTCCCGC 2327 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 174. AC: RSP00175//OS: Arabidopsis thaliana /GENE: /RE: /BF: ABFs Motifs on "+" Strand: Mean Exp. Number 0.03975 Up.Conf.Int. 1 Found 2 1492 CACGTGGC 1499 (Mism.= 0; Cons.: 100 %) 2140 CACGTGGC 2147 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 187. AC: RSP00188//OS: Arabidopsis thaliana /GENE: AtEm1/RE: ABRE/1.2 /BF: ABI5 Motifs on "-" Strand: Mean Exp. Number 0.04614 Up.Conf.Int. 1 Found 1 2159 TCtACGTGTC 2150 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 203. AC: RSP00204//OS: Arabidopsis thaliana /GENE: AtEm6/RE: ABRE/6.2 /BF: ABI5 Motifs on "+" Strand: Mean Exp. Number 0.00279 Up.Conf.Int. 1 Found 1 2138 GACACGTGGC 2147 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 226. AC: RSP00227//OS: pea, Pisum sativum /GENE: rbcS-3A/RE: BOX III* /BF: GT-1 Motifs on "-" Strand: Mean Exp. Number 0.00512 Up.Conf.Int. 1 Found 1 276 AAGATAAGA 268 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 228. AC: RSP00229//OS: Arabidopsis thaliana /GENE: AGAMAOUS (AG)/RE: CArG box 1 /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.00732 Up.Conf.Int. 1 Found 1 1593 CCAAATAAGG 1584 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 233. AC: RSP00234//OS: Arabidopsis thaliana /GENE: AGAMAOUS (AG)/RE: CArG Box 2 /BF: unknown Motifs on "+" Strand: Mean Exp. Number 0.02123 Up.Conf.Int. 1 Found 1 448 GCTTCTAAGG 457 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 249. AC: RSP00250//OS: pea, Pisum sativum /GENE: /RE: Myb2 /BF: Myb26; Myb-like DNA binding protein Motifs on "-" Strand: Mean Exp. Number 0.01682 Up.Conf.Int. 1 Found 1 2323 gAAAGgTAGGTTA 2311 (Mism.= 2; Cons.: 100 %) ............................................................ RE: 285. AC: RSP00286//OS: parsley (Petroselinum crispum) /GENE: PAL-1/RE: Box L /BF:unknown Motifs on "+" Strand: Mean Exp. Number 0.01271 Up.Conf.Int. 1 Found 1 2309 TCTaACCTACC 2319 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 297. AC: RSP00298//OS: Nicotiana benthamiana /GENE: PCNA; cell cycle-ralted genes/RE: E2F-1 /BF: E2F Motifs on "+" Strand: Mean Exp. Number 0.02610 Up.Conf.Int. 1 Found 1 2320 TTTCCCGC 2327 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 340. AC: RSP00341//OS: spinach (Spinacia oleracea); /GENE: rps1/RE: S1F BS1 /BF: S1F Motifs on "+" Strand: Mean Exp. Number 0.00254 Up.Conf.Int. 1 Found 1 2098 GAATTGTTACCATGAAA 2114 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 365. AC: RSP00366//OS: tobacco, Nicotiana tabacum /GENE: CHN50/RE: ERE /BF: TDBA12 Motifs on "-" Strand: Mean Exp. Number 0.00588 Up.Conf.Int. 1 Found 1 2202 TGACTTTCTGAC 2191 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 396. AC: RSP00397//OS: tobacco (Nicotiana tabacum) /GENE: RNP2/RE: CDE /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.03015 Up.Conf.Int. 1 Found 1 715 AGTGGCGG 708 (Mism.= 0; Cons.: 100 %) ............................................................ RE: 449. AC: RSP00450//OS: bean, Phaseolus vulgaris /GENE: CHS/RE: AIV /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.00402 Up.Conf.Int. 1 Found 1 2342 TCAAAAATgTGC 2331 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 450. AC: RSP00450//OS: bean, Phaseolus vulgaris /GENE: CHS/RE: AIIV /BF: unknown Motifs on "-" Strand: Mean Exp. Number 0.00402 Up.Conf.Int. 1 Found 1 2342 TCAAAAATgTGC 2331 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 556. AC: RSP00556//OS: tomato, Lycopersicon esculentum /GENE: rbcS3C/RE: UN U1 /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.00469 Up.Conf.Int. 1 Found 1 111 GAAAAAtCAAAAGCct 96 (Mism.= 3; Cons.: 100 %) ............................................................ RE: 653. AC: RSP00653//OS: Spinach; Spinachia oleracera /GENE: petH/RE: CT-LB /BF:unknown Motifs on "-" Strand: Mean Exp. Number 0.03241 Up.Conf.Int. 1 Found 1 2140 gTCTCTCTCCT 2130 (Mism.= 1; Cons.: 100 %) ............................................................ RE: 658. AC: RSP00658//OS: bean, Phaseolus vulgaris /GENE: beta-phaseolin/RE: G-box (ext) /BF: PG1 Motifs on "+" Strand: Mean Exp. Number 0.00686 Up.Conf.Int. 1 Found 1 2291 ACACGTGCTccAC 2303 (Mism.= 2; Cons.: 100 %) ............................................................ RE: 682. AC: RSP00682//OS: Arabidopsis thaliana /GENE: Adh/RE: -214 G-box /BF: GBF3 Motifs on "-" Strand: Mean Exp. Number 0.04189 Up.Conf.Int. 1 Found 2 2308 aCCACGTGGA 2299 (Mism.= 1; Cons.: 100 %) 1499 GCCACGTGGg 1490 (Mism.= 1; Cons.: 100 %) ............................................................ Totally 49 motifs of 40 different REs have been found Of them: 48 motifs of 39 different REs have Conservative Level >= 80 % ------------------------------------------------------------